이 프로토콜은 세포 수율, 순도 및 생존성에 최적화된 뮤린 출생후 망막 내피 세포의 단리를 위한 방법을 설명한다. 이 세포는 차세대 시퀀싱 접근법에 적합합니다.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 2 mL 에펜도르프 safe-lock tubes | USA Scientific | 4036-3352 | |
| 5 ml Falcon Test Tubes with Cell Strainer Snap Cap | Corning | 352235 | |
| 60 mm Non-TC-treated Culture Dish | Corning | 430589 | |
| APC Rat Anti-Mouse CD31 | BD Biosciences | 551262 | |
| APC Rat IgG2a κ Isotype Control | BD Biosciences | 553932 | |
| BD FACSChorus Software | BD Biosciences | FACSCHORUS | |
| BD FACSMelody Cell Sorter | BD Biosciences | FACSMELODY | |
| Collagenase Type II | Sigma-Aldrich | 234115 | |
| Costar 48-well Clear TC-treated Multiple Well Plates, Individualped, Sterile Corning | 3548 | ||
| D-Glucose | Gibco | A2494001 | |
| 일회용 눈금 전달 피펫 | Fisher Scientific | 12-711-9AM | |
| 해부 팬 왁스 | 캐롤라이나 | 629100 | |
| 해부 가위 | Fine Science Tools | 14085-08 | |
| 해부 실체 현미경 M165 FC | Leica | M165FC | |
| Dulbecco's Modified Eagle Medium (DMEM) | Gibco | 11965-052 | |
| Dulbecco' s 인산염 완충 식염수 (PBS) | Gibco | 14190144 | |
| Eppendorf Flex-Tubes 마이크로 원심분리기 튜브 1.5 mL | Sigma-Aldrich | 22364120 | |
| Fetal Bovine Serum (FBS) | Gemini Bio | 100-106 | |
| 미세 해부 겸자 | Fine Science Tools | 11250-00 | |
| Hank's Buffered Salt Solution (HBSS) | Gibco | 14175095 | |
| Hepes (1M) | Gibco | 15630130 | |
| iScript cDNA 합성 키트 | Bio-Rad | 1708890 | |
| Isoflurane, USP | Covetrus | 11695067772 | |
| Isotemp 범용 디럭스 수조 | Fisher Scientific | FSGPD20 | |
| 프라이머: ActB_Forward: 5'- agagggaaatcgtgcgtgac -3' | 통합 DNA 기술 | N/A | |
| 프라이머: ActB_Reverse: 5'- caatagtgatgacctggccgt -3' | 통합 DNA 기술 | N/A | |
| 입문서: CD31_Forward: 5'- gagcccaatcacgtttcagttt -3' | 통합 DNA 기술 | N/A | |
| 프라이머: CD31_Reverse: 5'- tccttcctgcttcttgctagct -3' | 통합 DNA 기술 | N/A | |
| 프라이머: CD45_Forward: 5'- gggttgttctgtgccttgtt -3' | 통합 DNA 기술 | N/A | |
| Primer: CD45_Reverse: 5'- ctggacggacacagttagca -3' | 통합 DNA 기술 | N/A | |
| 프라이머: VE-Cadherin_Forward: 5'- tcctctgcatcctcactatcaca -3' | 통합 DNA 기술 | N/A | |
| 프라이머: VE-Cadherin_Reverse: 5'- gtaagtgaccaactgctcgtgaat -3' | Integrated DNA Technologies | N/A | |
| 프로피듐 요오드화물 | Sigma-Aldrich | P4864 | |
| RNeasy Plus 미니 키트 | Qiagen | 74134 | |
| Sorvall Legend Micro 21R 원심분리기, 냉장 | ThermoFisher | 75002477 | |
| SYBR-Green iTaq Universal SYBR Green Supermix | Bio-Rad | 172-5120 | |
| Trypan Blue Solution | ThermoFisher | 15250061 | |
| V450 쥐 안티-마우스 CD45 | BD Biosciences | 560501 | |
| V450 쥐 IgG2b, κ 동형(Isotype) 제어 | BD 생명과학 | 560457 |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission