Een abonnement op JoVE is vereist om deze inhoud te bekijken. Log in of start vandaag met uw gratis proefperiode.

Methodenartikel

Multiplex PCR-test voor het typen van Staphylococcus Cassette Chromosome Mec Types I tot en met V in Methicilline-resistente

11.7K weergaven

⸱

DOI:

10.3791/50779

⸱

5 september 2013

In dit artikel

Erratum-melding

Important: There has been an erratum issued for this article. View Erratum Notice

Samenvatting

We demonstreren een eenvoudige multiplex PCR-test voor snel screenen en typeren van Staphylococcal Cassette Chromosome mec (SCCmec) typen I-V voor methicilline-resistente Staphylococcus aureus, en bieden enkele van de essentiële stappen en procedurele nuances die het succesvol maken om deze test aan te passen aan individuele laboratoria.

Samenvatting

Staphylococcen Cassette Chromosome mec (SCC mec) typen is een zeer belangrijke moleculaire tool voor het begrijpen van de epidemiologie en klonale stam verwantschap van methicilline-resistente Staphylococcus aureus (MRSA), met name de opkomende uitbraken van de gemeenschap-geassocieerde MRSA (CA-MRSA) die zich op een wereldwijde basis. Traditionele PCR typering's classificeren SCC mec door targeting en identificeerbaar is mec en ccr gen complexe vormen, maar vereisen het gebruik van veel primer sets en meerdere afzonderlijke PCR experimenten. We ontwierpen en publiceerde een eenvoudige multiplex PCR-test voor het snel-screening van grote SCC mec types en subtypes I tot V, en later bijgewerkt als beschikbaar werd nieuwe sequentie-informatie. Deze eenvoudige test richt zich op individuele SCC mec types in een enkele reactie, is het gemakkelijk te interpreteren en is uitgebreid wereldwijd gebruikt. Vanwege de verfijnde nature van de test en het grote aantal primers in de reactie, is de kans op problemen tijdens de aanpassing van deze assay aan elk laboratorium. Om het proces van de oprichting van een MRSA SCC mec test te vergemakkelijken, hier laten we zien hoe het opzetten van onze multiplex PCR-test, en bespreken een aantal van de essenti

Inleiding

Methicilline-resistente Staphylococcus aureus (MRSA) is overgenomen en ge

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Protocol

Deze procedures moeten worden uitgevoerd in een gecertificeerde bioveiligheidsniveau 2 laboratorium. Geschikte persoonlijke beschermingsmiddelen zoals handschoenen en witte jassen moeten worden gebruikt op alle tijden.

1. Monstervoorbereiding

  1. Verse overnight plaat culturen van MRSA zijn vereist. Op de dag voor PCR gedaan moet worden, selecteert u een enkele kolonie van MRSA met een steriele cultuur stok en bereiden een zware streep van de bacteri

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Resultaten

Deze bijgewerkte M-PCR is in staat om SCCmec-typen I-V te bepalen (classificeren), evenals de belangrijkste subtypen van SCCmec IV. De assay richt zich op unieke en specifieke loci van SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE en V, met gelijktijdige detectie van het mecA-gen. Voorlopige identificatie van SCCmec VI en VIII is ook mogelijk, maar zou verdere testen vereisen ter bevestiging. Figuur 3 illustreert representatieve SCCmec I-VI en VIII en de...

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Discussie

De hier beschreven multiplex PCR-assay biedt een eenvoudige, betrouwbare methode voor het classificeren van typen en belangrijke subtypes van SCCmec I-V in Staphylococci, met gelijktijdige onderscheiding van MRSA van MSSA. De assay is robuust, gemakkelijk uit te voeren in een enkele PCR-reactie en de resultaten zijn eenvoudig te interpreteren. De assay heeft wel beperkingen, omdat hij zich richt op individuele loci binnen elk SCCmec-type, maar biedt geen uitgebreide ccr- en mec-complex...

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Openbaarmakingen

Geen belangenconflicten verklaard.

Dankbetuigingen

We danken T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre en D. Coleman voor de vriendelijke gift van enkele referentiestammen die in dit onderzoek zijn gebruikt. Dit werk werd gedeeltelijk financieel ondersteund door het Centre for Antimicrobial Resistance (CAR), Alberta Health Services-Calgary/Calgary Laboratory Services/University of Calgary.

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Materialen

Lijst van materialen gebruikt in dit artikel
NaamBedrijfCatalogusnummerOpmerkingen
Tryptic Soy AgarFisher (BD)CA90002-700 (236920)
Sterieel gedistilleerd waterLife Technologies10977-015
Platinum Taq: inclusief 10x PCR buffer en 50 mM MgCl2Life Technologies10966-034
100 mM dNTPLife Technologies10297-018
Tris baseSigma-AldrichT6066
BoorzuurSigma-AldrichB7901
EDTALife Technologies15576-028
AgaroseLife Technologies16500-500
GlycerolLife Technologies15514-011
BroomfenolblauwSigma-AldrichB8026
1Kb+ DNA ladderLife Technologies10787-026
EthidiumbromideSigma-AldrichE7637
1,5 ml microcentrifugebuisjes VWR (Axygen Scientific)10011-700
CultuurstokjesVWRCA10805-018
PCR buisjesDiamedAD0210-FCN (nieuw nummer: DIATEC420-1250)
CentrifugeEppendorf5417c
Heat blockVWR13259-030 / 13259-286
Thermische cyclerApplied Biosystems (2720)4359659
Horizontaal, dompelbaar gelelektroforese systeem met gelvormBioRad170-4469
VoedingBioRad164-5050
Roterende schudlerVWR40000-300
Moleculair beeldvormingsgel Doc systeemBioRad1708170

Referenties

  1. IWG-SCC. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).
  2. Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al. Guidelines for Reporting Novel mecA Gene Homologues. Antimicrobial Agents and Chemotherapy. 56 (10), 4997-4999 (2012).
  3. Okuma, K., Iwakawa, K., Turnidge, J. D., Grubb, W. B., Bell, J. M., O'Brien, F. G., et al. Dissemination of new methicillin-resistant Staphylococcus aureus clones in the community. Journal of Clinical Microbiology. 40 (11), 4289-4294 (2002).
  4. Kondo, Y., Ito, T., Ma, X. X., Watanabe, S., Kreiswirth, B. N., Etienne, J., et al. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents and Chemotherapy. 51 (1), 264-274 (2007).
  5. Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for rapid identification of structural types and variants of the mec element in methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 46 (7), 2155-2161 (2002).
  6. Milheirico, C., Oliveira, D. C., de Lencastre, H. Update to the multiplex PCR strategy for assignment of mec element types in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 51 (9), 3374-3377 (2007).
  7. Milheirico, C., Oliveira, D. C., de Lencastre, H. Multiplex PCR strategy for subtyping the staphylococcal cassette chromosome mec type IV in methicillin-resistant Staphylococcus aureus: 'SCCmec IV multiplex'. Journal of Antimicrobial Chemotherapy. 60 (1), 42-48 (2007).
  8. Zhang, K., McClure, J. A., Elsayed, S., Louie, T., Conly, J. M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Journal of Clinical Microbiology. 43 (10), 5026-5033 (2005).
  9. Zhang, K., McClure, J. A., Conly, J. M. Enhanced multiplex PCR assay for typing of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. Molecular and Cellular Probes. 26 (5), 218-221 (2012).
  10. de Lamballerie, X., Zandotti, C., Vignoli, C., Bollet, C., de Micco, P. A one-step microbial DNA extraction method using "Chelex 100" suitable for gene amplification. Research in Microbiology. 143 (8), 785-790 (1992).
  11. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (62), e3923(2012).
  12. McClure, J. A., Conly, J. M., Elsayed, S., Zhang, K. Multiplex PCR assay to facilitate identification of the recently described Staphylococcal cassette chromosome mec type VIII. Molecular and Cellular Probes. 24 (4), 229-232 (2010).
  13. Zhang, K., McClure, J. A., Elsayed, S., Conly, J. M. Novel staphylococcal cassette chromosome mec type, tentatively designated type VIII, harboring class A mec and type 4 ccr gene complexes in a Canadian epidemic strain of methicillin-resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy. 53 (2), 531-540 (2009).

Toegang beperkt. Log in of start een proefperiode om deze inhoud te bekijken.

Herprints en machtigingen

Erratum


Formal Correction: Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus
Posted by JoVE Editors on 3/19/2019. Citeable Link.

An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus.  There was a typo in Table 1.

In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:

TTCTCATTGATGCTGAAGCC

To:

GAAACTAGTTATTTCCAACGG

Tags

SCCmec-typeringMRSA-detectieDNA-extractiegelelektroforeseprimerontwerpPCR-optimalisatieantibioticaresistentie