Hier, laten we het proces van het creëren van een cellulaire elektrische spanning verslaggever zebrafish lijn om te visualiseren van embryonale ontwikkeling, beweging, en vis tumor cellen in vivo.
Method Article
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 14mL cell culture tubes | VWR | 60818-725 | E.Coli culture |
| Agarose electrophoresis tank | Thermo Scientific | Owl B2 | DNA eletrophoresis |
| Agarose RA | Amresco | N605-500G | For making the injection gels |
| Attb1-ASAP1-F primer | IDT DNA | GGGGACAAGTTTGTACAAAAAA GCAGGCTTCACCATGGAGACGA CTGTGAGGTATGAACA | ASAP1 coding region amplification for subcloning |
| Attb2-ASAP1-R primer | IDT DNA | GGGGACCACTTTGTACAAGAAA GCTGGGTCTTAGGTTACCACTTC AAGTTGTTTCTTCTGTGAAGCCA | ASAP1 coding region amplification for subcloning |
| Bright field dissection scope | Nikon | SMZ 745 | Dechorionation, microinjection, mounting |
| Color camera | Zeiss | AxioCam MRc | Fish embryo image recording |
| Concave slide | VWR | 48336-001 | For holding fish embryos during imaging process |
| Disposable transfer pipette 3.4 ml | Thermo Scientific | 13-711-9AM | Fish embryos and water transfer |
| Endonuclease enzyme, Not I | NEB | R0189L | For linearizing plasmid DNA |
| Epifuorescent compound scope | Zeiss | Axio Imager.A2 | Fish embryo imaging |
| Epifuorescent stereo dissection scope | Zeiss | Stereo Discovery.V12 | Fish embryo imaging |
| Fluorescent light source | Lumen dynamics | X-cite seris 120 | Light source for fluorescence microscopes |
| Forceps #5 | WPI | 500342 | Dechorionation and needle breaking |
| Gateway BP Clonase II Enzyme mix | Thermo Scientific | 11789020 | Gateway BP recombination cloning |
| Gateway LR Clonase II Plus enzyme | Thermo Scientific | 12538120 | Gateway LR recombination cloning |
| Gel DNA Recovery Kit | Zymo Research | D4002 | DNA gel purification |
| Loading tip | Eppendorf | 930001007 | For loading injection solution into capilary needles |
| Methylcellulose (1600cPs) | Alfa Aesar | 43146 | Fish embryo mounting |
| Methylene blue | Sigma-Aldrich | M9140 | Suppresses fungal outbreaks in Petri dishes |
| Microinjection mold | Adaptive Science Tools | TU-1 | To prepare agaorse mold tray for holding fish embryos during injection |
| Microinjector | WPI | Pneumatic Picopump PV820 | Microinjection injector |
| Micro-manipulator | WPI | Microinjector MM3301R | Microinjection operation |
| Micropipette puller | Sutter instrument | P-1000 | For preparing capillary needle |
| Mineral oil | Amresco | J217-500ml | For calibrating injection volume |
| mMESSAGE mMACHINE SP6 Transcription Kit | Thermo Scientific | AM1340 | mRNA in vitro transcription |
| Monocolor camera | Zeiss | AxioCam MRm | Fish embryo image recording |
| Plasmid Miniprep Kit | Zymo Research | D4020 | Prepare small amount of plasmid DNA |
| Plastic Petri dishes | VWR | 25384-088 | For holding fish or fish embryos during imaging process |
| RNA Clean & Concentrator-5 | Zymo Research | R1015 | mRNA cleaning after in vitro transcription |
| Spectrophotometer | Thermo Scientific | NanoDrop 2000 | For measuring DNA and RNA concentrations |
| Stage Micrometer | Am Scope | MR100 | Microinjection volume calibration |
| Thermocycler | Bio-Rad | T100 | DNA amplification for gene cloning |
| Thin wall glass capillaries | WPI | TW100F-4 | Raw glass for making cappilary needle |
| Tol2-exL1 primer | IDT DNA | GCACAACACCAGAAATGCCCTC | Tol2 excise assay |
| Tol2-exR primer | IDT DNA | ACCCTCACTAAAGGGAACAAAAG | Tol2 excise assay |
| TOP10 Chemically Competent E. coli | Thermo Scientific | C404006 | Used for transformation during gene cloning |
| Tricaine mesylate | Sigma-Aldrich | A5040 | For anesthetizing fish or fish embryos |
| UV trans-illuminator 302nm | UVP | M-20V | DNA visualization |
| Water bath | Thermo Scientific | 2853 | For transformation process of gene cloning |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission