Name: Genoombrede CRISPR-screening voor het onthullen van stralingsgevoelige en radioresistente genen (Video) | JoVE Journal
Uploaded: 2025-05-23T13:25:00.000+00:00
Duration: 8 min 32 s
Description: Ontdek genoombrede CRISPR-screening voor het identificeren van stralingsgevoelige en radioresistente genen in longkankercellen. Deze methode verbetert het begrip van resistentiemechanismen tegen radiotherapie.

ai_agent_IP

ai_agent

maintenance

instantTrialDurationMinutes

isBiopharma

enableNewMyJoveSectionDesign

educationFeatures

seoMetaApi

ai_copilot_institution_blacklist

ai_chat_institution_blacklist

freeAccessWindow

ssoRoleCapture

scheduledMaintenanceBanner

joveLabsFeatures

disable_autoplay_for_bots

extended_trial_duration

5 minutes

<ol><li>Barrangou, R., Marraffini, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas+systems%3A+Prokaryotes+upgrade+to+adaptive+immunity%5BTitle%5D)+AND+%22Mol+Cell%22%5BJournal%5D)">CRISPR-Cas systems: Prokaryotes upgrade to adaptive immunity.</a> Mol Cell. 54 (2), 234-244 (2014).</li>
<li>Joung, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-scale+CRISPR-Cas9+knockout+and+transcriptional+activation+screening%5BTitle%5D)+AND+%22Nat+Protoc%22%5BJournal%5D)">Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening.</a> Nat Protoc. 12 (4), 828-863 (2017).</li>
<li>Sanjana, N. E., Shalem, O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Improved+vectors+and+genome-wide+libraries+for+CRISPR+screening%5BTitle%5D)+AND+%22Nat+Methods%22%5BJournal%5D)">Improved vectors and genome-wide libraries for CRISPR screening.</a> Nat Methods. 11 (8), 783-784 (2014).</li>
<li>Arroyo, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+Genome-wide+CRISPR+death+screen+identifies+genes+essential+for+oxidative+phosphorylation%5BTitle%5D)+AND+%22Cell+Metab%22%5BJournal%5D)">A Genome-wide CRISPR death screen identifies genes essential for oxidative phosphorylation.</a> Cell Metab. 24 (6), 875-885 (2016).</li>
<li>Sidik, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genome-wide+CRISPR+screen+in+toxoplasma+identifies+essential+apicomplexan+genes%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">A genome-wide CRISPR screen in toxoplasma identifies essential apicomplexan genes.</a> Cell. 166 (6), 1423-1435 (2016).</li>
<li>Jing, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+activation+screening+in+senescent+cells+reveals+SOX5+as+a+driver+and+therapeutic+target+of+rejuvenation%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Genome-wide CRISPR activation screening in senescent cells reveals SOX5 as a driver and therapeutic target of rejuvenation.</a> Cell Stem Cell. 30 (11), 1452-1471 (2023).</li>
<li>Shifrut, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screens+in+primary+human+t+cells+reveal+key+regulators+of+immune+function%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Genome-wide CRISPR screens in primary human t cells reveal key regulators of immune function.</a> Cell. 175 (7), 1958-1971 (2018).</li>
<li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li>
<li>Katti, A., Diaz, B. J., Caragine, C. M., Sanjana, N. E., Dow, L. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+in+cancer+biology+and+therapy%5BTitle%5D)+AND+%22Nat+Rev+Cancer%22%5BJournal%5D)">CRISPR in cancer biology and therapy.</a> Nat Rev Cancer. 22 (5), 259-279 (2022).</li>
<li>Sasmal, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Synthetic+host-guest+assembly+in+cells+and+tissues%3A+Fast%2C+stable%2C+and+selective+bioorthogonal+imaging+via+molecular+recognition%5BTitle%5D)+AND+%22Anal+Chem%22%5BJournal%5D)">Synthetic host-guest assembly in cells and tissues: Fast, stable, and selective bioorthogonal imaging via molecular recognition.</a> Anal Chem. 90 (19), 11305-11314 (2018).</li>
<li>Roos, W. P., Thomas, A. D., Kaina, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+damage+and+the+balance+between+survival+and+death+in+cancer+biology%5BTitle%5D)+AND+%22Nat+Rev+Cancer%22%5BJournal%5D)">DNA damage and the balance between survival and death in cancer biology.</a> Nat Rev Cancer. 16 (1), 20-33 (2016).</li>
<li>Huang, R., Zhou, P. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+damage+repair%3A+Historical+perspectives%2C+mechanistic+pathways+and+clinical+translation+for+targeted+cancer+therapy%5BTitle%5D)+AND+%22Signal+Transduct+Target+Ther%22%5BJournal%5D)">DNA damage repair: Historical perspectives, mechanistic pathways and clinical translation for targeted cancer therapy.</a> Signal Transduct Target Ther. 6 (1), 254(2021).</li>
<li>O'Connor, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeting+the+DNA+damage+response+in+cancer%5BTitle%5D)+AND+%22Mol+Cell%22%5BJournal%5D)">Targeting the DNA damage response in cancer.</a> Mol Cell. 60 (4), 547-560 (2015).</li>
<li>Lord, C. J., Ashworth, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+DNA+damage+response+and+cancer+therapy%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">The DNA damage response and cancer therapy.</a> Nature. 481 (7381), 287-294 (2012).</li>
<li>Carusillo, A., Mussolino, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+Damage%3A+From+threat+to+treatment%5BTitle%5D)+AND+%22Cells%22%5BJournal%5D)">DNA Damage: From threat to treatment.</a> Cells. 9 (7), 1665(2020).</li>
<li>Li, X., Heyer, W. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Homologous+recombination+in+DNA+repair+and+DNA+damage+tolerance%5BTitle%5D)+AND+%22Cell+Res%22%5BJournal%5D)">Homologous recombination in DNA repair and DNA damage tolerance.</a> Cell Res. 18 (1), 99-113 (2008).</li>
<li>Chang, H., Pannunzio, N. R., Adachi, N., Lieber, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Non-homologous+DNA+end+joining+and+alternative+pathways+to+double-strand+break+repair%5BTitle%5D)+AND+%22Nat+Rev+Mol+Cell+Biol%22%5BJournal%5D)">Non-homologous DNA end joining and alternative pathways to double-strand break repair.</a> Nat Rev Mol Cell Biol. 18 (8), 495-506 (2017).</li>
<li>Andratschke, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((European+society+for+radiotherapy+and+oncology+and+European+organization+for+research+and+treatment+of+cancer+consensus+on+re-irradiation%3A+Definition%2C+reporting%2C+and+clinical+decision+making%5BTitle%5D)+AND+%22Lancet+Oncol%22%5BJournal%5D)">European society for radiotherapy and oncology and European organization for research and treatment of cancer consensus on re-irradiation: Definition, reporting, and clinical decision making.</a> Lancet Oncol. 23 (10), e469-e478 (2022).</li>
<li>Olivares-Urbano, M. A., Grinan-Lison, C., Marchal, J. A., Nunez, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CSC+radioresistance%3A+A+therapeutic+challenge+to+improve+radiotherapy+effectiveness+in+cancer%5BTitle%5D)+AND+%22Cells%22%5BJournal%5D)">CSC radioresistance: A therapeutic challenge to improve radiotherapy effectiveness in cancer.</a> Cells. 9 (7), 1651(2020).</li>
<li>Schaue, D., McBride, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Opportunities+and+challenges+of+radiotherapy+for+treating+cancer%5BTitle%5D)+AND+%22Nat+Rev+Clin+Oncol%22%5BJournal%5D)">Opportunities and challenges of radiotherapy for treating cancer.</a> Nat Rev Clin Oncol. 12 (9), 527-540 (2015).</li>
<li>Allen, C., Her, S., Jaffray, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Radiotherapy+for+cancer%3A+Present+and+future%5BTitle%5D)+AND+%22Adv+Drug+Deliv+Rev%22%5BJournal%5D)">Radiotherapy for cancer: Present and future.</a> Adv Drug Deliv Rev. 109, 1-2 (2017).</li>
<li>Xue, C., Greene, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((DNA+repair+pathway+choices+in+CRISPR-Cas9-Mediated+genome+editing%5BTitle%5D)+AND+%22Trends+Genet%22%5BJournal%5D)">DNA repair pathway choices in CRISPR-Cas9-Mediated genome editing.</a> Trends Genet. 37 (7), 639-656 (2021).</li>
<li>Tzelepis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+CRISPR+dropout+screen+identifies+genetic+vulnerabilities+and+therapeutic+targets+in+acute+myeloid+leukemia%5BTitle%5D)+AND+%22Cell+Rep%22%5BJournal%5D)">A CRISPR dropout screen identifies genetic vulnerabilities and therapeutic targets in acute myeloid leukemia.</a> Cell Rep. 17 (4), 1193-1205 (2016).</li>
<li>Rottner, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genome-wide+CRISPR+screen+identifies+CALCOCO2+as+a+regulator+of+beta+cell+function+influencing+type+2+diabetes+risk%5BTitle%5D)+AND+%22Nat+Genet%22%5BJournal%5D)">A genome-wide CRISPR screen identifies CALCOCO2 as a regulator of beta cell function influencing type 2 diabetes risk.</a> Nat Genet. 55 (1), 54-65 (2023).</li>
<li>Chen, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9+for+cancer+therapy%3A+Opportunities+and+challenges%5BTitle%5D)+AND+%22Cancer+Lett%22%5BJournal%5D)">CRISPR-Cas9 for cancer therapy: Opportunities and challenges.</a> Cancer Lett. 447, 48-55 (2019).</li>
<li>Gupta, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9+system%3A+A+new-fangled+dawn+in+gene+editing%5BTitle%5D)+AND+%22Life+Sci%22%5BJournal%5D)">CRISPR-Cas9 system: A new-fangled dawn in gene editing.</a> Life Sci. 232, 116636(2019).</li>
<li>Li, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screen+identifies+host+dependency+factors+for+influenza+A+virus+infection%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">Genome-wide CRISPR screen identifies host dependency factors for influenza A virus infection.</a> Nat Commun. 11 (1), 164(2020).</li>
<li>Hung, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Targeted+profiling+of+human+extrachromosomal+DNA+by+CRISPR-CATCH%5BTitle%5D)+AND+%22Nat+Genet%22%5BJournal%5D)">Targeted profiling of human extrachromosomal DNA by CRISPR-CATCH.</a> Nat Genet. 54 (11), 1746-1754 (2022).</li>
<li>Bhattacharya, D., Van Meir, E. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+simple+genotyping+method+to+detect+small+CRISPR-Cas9+induced+indels+by+agarose+gel+electrophoresis%5BTitle%5D)+AND+%22Sci+Rep%22%5BJournal%5D)">A simple genotyping method to detect small CRISPR-Cas9 induced indels by agarose gel electrophoresis.</a> Sci Rep. 9 (1), 4437(2019).</li>
<li>Razavi, Z., Soltani, M., Souri, M., Van Wijnen, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+innovations+in+tissue+engineering+and+gene+editing%5BTitle%5D)+AND+%22Life+Sci%22%5BJournal%5D)">CRISPR innovations in tissue engineering and gene editing.</a> Life Sci. 358, 123120(2024).</li>
<li>Wang, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genome-wide+CRISPR-based+screen+identifies+KAT7+as+a+driver+of+cellular+senescence%5BTitle%5D)+AND+%22Sci+Transl+Med%22%5BJournal%5D)">A genome-wide CRISPR-based screen identifies KAT7 as a driver of cellular senescence.</a> Sci Transl Med. 13 (575), eabd2655(2021).</li>
<li>Xu, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Engineered+miniature+CRISPR-Cas+system+for+mammalian+genome+regulation+and+editing%5BTitle%5D)+AND+%22Mol+Cell%22%5BJournal%5D)">Engineered miniature CRISPR-Cas system for mammalian genome regulation and editing.</a> Mol Cell. 81 (20), 4333-4345 (2021).</li>
<li>Huang, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((FACS-based+genome-wide+CRISPR+screens+define+key+regulators+of+DNA+damage+signaling+pathways%5BTitle%5D)+AND+%22Mol+Cell%22%5BJournal%5D)">FACS-based genome-wide CRISPR screens define key regulators of DNA damage signaling pathways.</a> Mol Cell. 83 (15), 2810-2828 (2023).</li>
<li>Feng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screen+identifies+synthetic+lethality+between+DOCK1+inhibition+and+metformin+in+liver+cancer%5BTitle%5D)+AND+%22Protein+Cell%22%5BJournal%5D)">Genome-wide CRISPR screen identifies synthetic lethality between DOCK1 inhibition and metformin in liver cancer.</a> Protein Cell. 13 (11), 825-841 (2022).</li>
<li>Saurat, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screen+identifies+neddylation+as+a+regulator+of+neuronal+aging+and+AD+neurodegeneration%5BTitle%5D)+AND+%22Cell+Stem+Cell%22%5BJournal%5D)">Genome-wide CRISPR screen identifies neddylation as a regulator of neuronal aging and AD neurodegeneration.</a> Cell Stem Cell. 31 (8), 1162-1174 (2024).</li>
<li>Du, Y., Liu, Y., Hu, J., Peng, X., Liu, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR%2FCas9+systems%3A+Delivery+technologies+and+biomedical+applications%5BTitle%5D)+AND+%22Asian+J+Pharm+Sci%22%5BJournal%5D)">CRISPR/Cas9 systems: Delivery technologies and biomedical applications.</a> Asian J Pharm Sci. 18 (6), 100854(2023).</li>
<li>Shi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+genome-wide+CRISPR+screen+identifies+WDFY3+as+a+regulator+of+macrophage+efferocytosis%5BTitle%5D)+AND+%22Nat+Commun%22%5BJournal%5D)">A genome-wide CRISPR screen identifies WDFY3 as a regulator of macrophage efferocytosis.</a> Nat Commun. 13 (1), 7929(2022).</li>
<li>Liu, N., Olson, E. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR+modeling+and+correction+of+cardiovascular+disease%5BTitle%5D)+AND+%22Circ+Res%22%5BJournal%5D)">CRISPR modeling and correction of cardiovascular disease.</a> Circ Res. 130, (2022).</li>
<li>Feng, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Genome-wide+CRISPR+screens+using+isogenic+cells+reveal+vulnerabilities+conferred+by+loss+of+tumor+suppressors%5BTitle%5D)+AND+%22Sci+Adv%22%5BJournal%5D)">Genome-wide CRISPR screens using isogenic cells reveal vulnerabilities conferred by loss of tumor suppressors.</a> Sci Adv. 8 (19), 6638(2022).</li>
<li>Ghaemi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9+genome+editing+delivery+systems+for+targeted+cancer+therapy%5BTitle%5D)+AND+%22Life+Sci%22%5BJournal%5D)">CRISPR-Cas9 genome editing delivery systems for targeted cancer therapy.</a> Life Sci. 267, 118969(2021).</li>
<li>Derry, W. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR%3A+Development+of+a+technology+and+its+applications%5BTitle%5D)+AND+%22FEBS+J%22%5BJournal%5D)">CRISPR: Development of a technology and its applications.</a> FEBS J. 288 (2), 358-359 (2021).</li>
<li>Sharma, G., Sharma, A. R., Bhattacharya, M., Lee, S. S., Chakraborty, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas9%3A+A+preclinical+and+clinical+perspective+for+the+treatment+of+human+diseases%5BTitle%5D)+AND+%22Mol+Ther%22%5BJournal%5D)">CRISPR-Cas9: A preclinical and clinical perspective for the treatment of human diseases.</a> Mol Ther. 29 (2), 571-586 (2021).</li>
</ol>

<table><tbody><tr><td>150 mm cel- en weefselkweekbakje</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>715011</td><td>Celcultuur</td></tr><tr><td>35 mm cel- en weefselkweekbakje</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>706011</td><td>Celcultuur</td></tr><tr><td>A549-cellijn</td><td>ATCC</td><td>-</td><td>-</td></tr><tr><td>Celtellingsklem-8</td><td>Shanghai Beyotime Biotech Inc</td><td>C0041</td><td>Voor cellevensvatbaarheidstest</td></tr><tr><td>CO2-onafhankelijk medium</td><td>PHCbi</td><td>MCO-50AIC</td><td>Celcultuur</td></tr><tr><td>Countess 3 FL geautomatiseerde celteller</td><td>Thermo Scientific</td><td>AMQAF2001</td><td>Voor celtelling</td></tr><tr><td>EDTA</td><td>Gibco</td><td>25200056</td><td>Celcultuur</td></tr><tr><td>Fetaal bovien serum</td><td>Gibco</td><td>10099141</td><td>Celcultuur</td></tr><tr><td>Fluorescentiemicroscoop</td><td>LEICA</td><td>ebq 100-04</td><td>Voor fluorescentiemicroscoop</td></tr><tr><td>Genoombrede CRISPR-lentivirale bibliotheek</td><td>Shanghai OBiO Technology Co., Ltd.</td><td>H5070</td><td>Voor lentivirale infectie</td></tr><tr><td>MiniAmp plus PCR</td><td>Thermo Scientific</td><td>C37835</td><td>Voor PCR-amplificatie</td></tr><tr><td>NEST celcultuurplaten, 12-well</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>712002</td><td>Celcultuur</td></tr><tr><td>NEST celcultuurplaten, 6-well</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>703002</td><td>Celcultuur</td></tr><tr><td>NEST celcultuurplaten, 96-well</td><td>Wuxi NEST Biotechnology Co., Ltd.</td><td>701001</td><td>Celcultuur</td></tr><tr><td>PBS</td><td>Gibco</td><td>C10010500BT</td><td>Celcultuur</td></tr><tr><td>PCR-forwardprimer (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG)</td><td>Beijing AuGCT Biotech Co., Ltd.</td><td>-</td><td>Voor PCR-amplificatie</td></tr><tr><td>PCR-reverseprimer (GATGTGCGCTCTGCCCACTGACGGGCA)</td><td>Beijing AuGCT Biotech Co., Ltd.</td><td>-</td><td>Voor PCR-amplificatie</td></tr><tr><td>Polybreen</td><td>Shanghai Beyotime Biotech Inc</td><td>C0351</td><td>Voor lentivirale infectie</td></tr><tr><td>Puromycin</td><td>MCE</td><td>HY-K1057</td><td>Voor selectie na lentivirale infectie</td></tr><tr><td>RPMI 1640 celcultuurmedium</td><td>Gibco</td><td>23400-021</td><td>Celcultuur</td></tr><tr><td>TIANGENamp genomisch DNA-kit</td><td>Beijing TIANGEN Biotech Co.,Ltd.</td><td>DP304</td><td>Voor genomische DNA-extractie</td></tr><tr><td>X-ray poederdiffractometer</td><td>PerkinElmer</td><td></td><td>Voor radiotherapie</td></tr></tbody></table>

genoombrede crispr-screening voor het onthullen van stralingsgevoelige en radioresistente genen

Genome-Wide CRISPR Screen for Unveiling Radiosensitive and Radioresistant Genes

Genoombrede CRISPR-screening voor het onthullen van stralingsgevoelige en radioresistente genen

The CRISPR-Cas9 system has been harnessed and repurposed into a powerful genome editing tool. By leveraging this technology, researchers can precisely ...

genome-wide-crispr-screen-for-unveiling-radiosensitive-radioresistant

Research

JoVE Journal

Cancer Research

Kankeronderzoek

Deze video beschrijft een screeningsmethode om transgene Drosophila-vliegen te identificeren, waarvan het genoom is gewijzigd met CRISPR-Cas9. CRISPR-Cas9 is een krachtige genoombewerkingstool die een revolutie teweegbracht in de manier waarop wetenschappers het genoom van een organisme kunnen manipuleren. In het voorbeeldprotocol zullen we zien hoe crispr-gegenereerde mutanten kunnen worden geïdentificeerd, waarbij het inbrengen van een transactiveringssequentie de eerste exon van het...

Screening op genomische modificaties: een methode om CRISPR-gegenereerde mutanten in Drosophila te identificeren

Genotypering techniek beschreven voor koppeling fluorescent polymerasekettingreactie (PCR) met capillaire gelelektroforese, maakt genotypering van nuclease-gemedieerde knockout klonen. Het omzeilt beperkingen geconfronteerd met andere genotyperingstechnieken en kosteneffectiever is dan sequencing methoden.

Gebruikmaking van een fluorescentie PCR-capillaire gelelektroforese techniek voor CRISPR Genotype / Cas9-gemedieerde knockout mutanten in een High-throughput Format

Recente vooruitgang in het vermogen om somatische cellijnen genetisch te manipuleren, biedt een groot potentieel voor basis en toegepast onderzoek. Hier presenteren wij twee benaderingen voor CRISPR / Cas9 gegenereerde knockout productie en screening in zoogdiercellijnen, met en zonder het gebruik van selecteerbare markers.

Selectieafhankelijke en onafhankelijke generatie van CRISPR / Cas9-gemedieerde Gene Knockouts in zoogdiercellen

Een CRISPR/sgRNA-bibliotheek is toegepast op het ondervragen van eiwit-codeert genen. De haalbaarheid van een bibliotheek van de sgRNA aan het licht brengen van de functie van een scheidingswand CTCF in genregulatie blijft echter onontgonnen. Hier beschrijven we een HOX loci specifieke sgRNA bibliotheek te verhelderen van de functie van CTCF grenzen in HOX loci.

HOX Loci gericht CRISPR/sgRNA bibliotheek Screening identificeren kritische CTCF grenzen

Crispr Cas9-technologie biedt een efficiënte methode om het genoom van zoogdieren in elk celtype nauwkeurig te bewerken en vertegenwoordigt een nieuw middel om genoom-brede genetische schermen uit te voeren. Hier vindt u een gedetailleerd protocol over de stappen die nodig zijn voor het succesvol uitvoeren van gepoolde CRISPR Cas9 schermen.

Gepoolde CRISPR-gebaseerde genetische schermen in zoogdiercellen

Dit manuscript beschrijft een genoom-schaal celgebaseerde screening benadering om extracellulaire receptor-ligand interacties te identificeren.

Celoppervlakreceptoridentificatie met genoomschaal CRISPR/Cas9 genetische schermen

Hier beschrijven we een snelle en directe in vivo CRISPR/Cas9 screeningsmethodologie met behulp van echogeleide in utero embryonale lentivirale injecties om tegelijkertijd functies van verschillende genen in de huid en mondholte van immunocompetente muizen te beoordelen.

In Vivo CRISPR/Cas9-screening om tegelijkertijd de genfunctie in de huid en mondholte van de muis te evalueren

Een belangrijke barrière voor technologieën zoals CRISPR zijn de off-target gebeurtenissen die vitale genen kunnen verstoren. 'Circularization for In Vitro Reporting of Cleavage Effects by Sequencing' (CIRCLE-seq) is een techniek die is ontworpen om onbedoelde splitsingsplaatsen te identificeren. Deze methode brengt de genoombrede activiteit van CRISPR-Cas9 met hoge gevoeligheid en zonder bias in kaart.

CIRCLE-Seq voor ondervraging van off-target genbewerking

Het artikel beschrijft een protocol voor de toepassing van een in vitro model voor uitputting om een genoombrede CRISPR-knockoutscreening te voltooien in gezonde chimere antigeenreceptor-T-cellen van de donor.

Uitvoeren van een in vitro genoombrede CRISPR-knock-outscreening in chimere antigeenreceptor-T-cellen

Hier presenteren we een protocol dat CRISPR/Cas9-technologie integreert met de Cell Counting Kit-8 (CCK-8)-test om kandidaatgenen te identificeren die cruciaal zijn voor de abnormale proliferatieve capaciteit van hematopoëtische stam- en voorlopercellen.

Evaluatie van abnormale groeigerelateerde genen van hematopoëtische stam- en voorlopercellen door CRISPR/Cas9-technologie te combineren met celtelling

Ontdek genoombrede CRISPR-screening voor het identificeren van stralingsgevoelige en radioresistente genen in longkankercellen. Deze methode verbetert het begrip van resistentiemechanismen tegen radiotherapie.

Genoombrede CRISPR-screening voor het onthullen van stralingsgevoelige en radioresistente genen

Meer video's verkennen