Reakcja łańcuchowa polimerazy: podstawowy protokół oraz strategie rozwiązywania problemów i optymalizacji

Summary

PCR pojawił się jako powszechna technika w wielu laboratoriach biologii molekularnej. Poniżej znajduje się krótki przewodnik po kilku konwencjonalnych protokołach PCR. Ponieważ każda reakcja jest unikalnym eksperymentem, optymalne warunki wymagane do wytworzenia produktu są różne. Zrozumienie zmiennych w reakcji znacznie zwiększy skuteczność rozwiązywania problemów, zwiększając w ten sposób szansę na uzyskanie pożądanego rezultatu.

Abstract

W naukach biologicznych nastąpił postęp technologiczny, który katapultował tę dyscyplinę do złotego wieku odkryć. Na przykład dziedzina mikrobiologii zmieniła się wraz z pojawieniem się mikroskopu Antona van Leeuwenhoeka, który pozwolił naukowcom po raz pierwszy uwidocznić prokariota. Rozwój reakcji łańcuchowej polimerazy (PCR) jest jedną z tych innowacji, które zmieniły bieg nauk molekularnych, wywierając wpływ na niezliczone subdyscypliny biologii. Proces teoretyczny został nakreślony przez Keppe i współpracowników w 1971 roku; jednak minęło kolejne 14 lat, zanim pełna procedura PCR została opisana i eksperymentalnie zastosowana przez Kary'ego Mullisa podczas pracy w Cetus Corporation w 1985 roku. Automatyzacja i udoskonalenie tej techniki postępowały wraz z wprowadzeniem stabilnej termicznie polimerazy DNA z bakterii Thermus aquaticus, stąd nazwa polimerazy DNA Taq.

PCR to potężna technika amplifikacji, która może wygenerować wystarczającą ilość określonego segmentu DNA (tj. amplikonu) z niewielkiej ilości materiału wyjściowego (tj. matrycy DNA lub sekwencji docelowej). Chociaż jest to proste i ogólnie bezproblemowe, istnieją pułapki, które komplikują reakcję, dając fałszywe wyniki. Gdy PCR nie powiedzie się, może to prowadzić do powstania wielu niespecyficznych produktów DNA o różnych rozmiarach, które pojawiają się jako drabina lub rozmaz prążków na żelach agarozowych. Czasami w ogóle nie tworzą się żadne produkty. Inny potencjalny problem pojawia się, gdy mutacje są nieumyślnie wprowadzane do amplikonów, co skutkuje niejednorodną populacją produktów PCR. Niepowodzenia PCR mogą stać się frustrujące, chyba że zastosuje się cierpliwość i staranne rozwiązywanie problemów w celu uporządkowania i rozwiązania problemu. Protokół ten nakreśla podstawowe zasady PCR, zapewnia metodologię, która spowoduje amplifikację większości sekwencji docelowych oraz przedstawia strategie optymalizacji reakcji. Postępując zgodnie z tym przewodnikiem PCR, uczniowie powinni być w stanie:

● Skonfiguruj reakcje i warunki cykli termicznych dla konwencjonalnego eksperymentu PCR
● Zrozumienie funkcji różnych składników reakcji i ich ogólnego wpływu na eksperyment PCR
● Zaprojektuj i zoptymalizuj eksperyment PCR dla dowolnej matrycy DNA
● Rozwiązywanie problemów z nieudanymi eksperymentami PCR

Protocol

1. Designing Primers

Designing appropriate primers is essential to the successful outcome of a PCR experiment. When designing a set of primers to a specific region of DNA desired for amplification, one primer should anneal to the plus strand, which by convention is oriented in the 5' → 3' direction (also known as the sense or nontemplate strand) and the other primer should complement the minus strand, which is oriented in the 3' → 5' direction (antisense or template strand). There are a few common problems that arise when designing primers: 1) self-annealing of primers resulting in formation of secondary structures such as hairpin loops (Figure 1a); 2) primer annealing to each other, rather then the DNA template, creating primer dimers (Figure 1b); 3) drastically different melting temperatures (T_m) for each primer, making it difficult to select an annealing temperature that will allow both primers to efficiently bind to their target sequence during themal cycling (Figure 1c) (See the sections CALCULATING MELTING TEMPERATURE (T_m) and MODIFICATIONS TO CYCLING CONDITIONS for more information on T_ms).

1. Below is a list of characteristics that should be considered when designing primers.
   1. Primer length should be 15-30 nucleotide residues (bases).
   2. Optimal G-C content should range between 40-60%.
   3. The 3' end of primers should contain a G or C in order to clamp the primer and prevent "breathing" of ends, increasing priming efficiency. DNA "breathing" occurs when ends do not stay annealed but fray or split apart. The three hydrogen bonds in GC pairs help prevent breathing but also increase the melting temperature of the primers.
   4. The 3' ends of a primer set, which includes a plus strand primer and a minus strand primer, should not be complementary to each other, nor can the 3' end of a single primer be complementary to other sequences in the primer. These two scenarios result in formation of primer dimers and hairpin loop structures, respectively.
   5. Optimal melting temperatures (T_m) for primers range between 52-58 °C, although the range can be expanded to 45-65 °C. The final T_m for both primers should differ by no more than 5 °C.
   6. Di-nucleotide repeats (e.g., GCGCGCGCGC or ATATATATAT) or single base runs (e.g., AAAAA or CCCCC) should be avoided as they can cause slipping along the primed segment of DNA and or hairpin loop structures to form. If unavoidable due to nature of the DNA template, then only include repeats or single base runs with a maximum of 4 bases.

Notes:

1. There are many computer programs designed to aid in designing primer pairs. NCBI Primer design tool http://www.ncbi.nlm.nih.gov/tools/primer-blast/ and Primer3 http://frodo.wi.mit.edu/primer3/ are recommended websites for this purpose.
2. In order to avoid amplification of related pseudogenes or homologs it could be useful to run a blast on NCBI to check for the target specificity of the primers.

2. Materials and Reagents

1. When setting up a PCR experiment, it is important to be prepared. Wear gloves to avoid contaminating the reaction mixture or reagents. Include a negative control, and if possible a positive control.
2. Arrange all reagents needed for the PCR experiment in a freshly filled ice bucket, and let them thaw completely before setting up a reaction (Figure 2). Keep the reagents on ice throughout the experiment.
   • Standard PCR reagents include a set of appropriate primers for the desired target gene or DNA segment to be amplified, DNA polymerase, a buffer for the specific DNA polymerase, deoxynucleotides (dNTPs), DNA template, and sterile water.
   • Additional reagents may include Magnesium salt Mg²⁺ (at a final concentration of 0.5 to 5.0 mM), Potassium salt K⁺ (at a final concentration of 35 to 100 mM), dimethylsulfoxide (DMSO; at a final concentration of 1-10%), formamide (at a final concentration of 1.25-10%), bovine serum albumin (at a final concentration of 10-100 μg/ml), and Betaine (at a final concentration of 0.5 M to 2.5 M). Additives are discussed further in the trouble shooting section.
3. Organize laboratory equipment on the workbench.
   • Materials include PCR tubes and caps, a PCR tube rack, an ethanol-resistant marker, and a set of micropipettors that dispense between 1 - 10 μl (P10), 2 - 20 μl (P20), 20 - 200 μl (P200) and 200 - 1000 μl (P1000), as well as a thermal cycler.
   • When setting up several PCR experiments that all use the same reagents, they can be scaled appropriately and combined together in a master mixture (Master Mix). This step can be done in a sterile 1.8 ml microcentrifuge tube (see Notes).
   • To analyze the amplicons resulting from a PCR experiment, reagents and equipment for agarose gel electrophoresis is required. To approximate the size of a PCR product, an appropriate, commercially available molecular weight size standard is needed.

3. Setting up a Reaction Mixture

1. Start by making a table of reagents that will be added to the reaction mixture (see Table 1).
2. Next, label PCR tube(s) with the ethanol-resistant marker.
3. Reaction volumes will vary depending on the concentrations of the stock reagents. The final concentrations (CF) for a typical 50 μl reaction are as follows.
   • X buffer (usually supplied by the manufacturer of the DNA polymerase; may contain 15 mM MgCl₂). Add 5 μl of 10X buffer per reaction.
   • 200 μM dNTPs (50 μM of each of the four nucleotides). Add 1 μl of 10 mM dNTPs per reaction (dATP, dCTP, dTTP and dGTP are at 2.5 mM each).
   • 1.5 mM Mg²⁺. Add only if it is not present in the 10X buffer or as needed for PCR optimization. For example, to obtain the 4.0 mM Mg²⁺ required for optimal amplicon production of a conserved 566 bp DNA segment found in an uncharacterized Mycobacteriophage add 8 μl of 25 mM MgCl₂ to the reaction (Figure 3).
   • 20 to 50 pmol of each primer. Add 1 μl of each 20 μM primer.
   • Add 10⁴ to 10⁷ molecules (or about 1 to 1000 ng) DNA template. Add 0.5 μl of 2ng/μl genomic Mycobacteriophage DNA.
   • Add 0.5 to 2.5 units of DNA polymerase per 50 μl reaction (See manufacturers recommendations) For example, add 0.5 μl of Sigma 0.5 Units/μl Taq DNA polymerase. </

Discussion

PCR stał się nieodzownym narzędziem w arsenale nauk biologicznych. PCR zmienił bieg nauki, umożliwiając biologom przejęcie władzy nad genomami i tworzenie hybrydowych genów o nowych funkcjach, umożliwiając specyficzne i dokładne testy kliniczne, uzyskanie wglądu w genomy i różnorodność, a także po prostu klonowanie genów w celu dalszej analizy biochemicznej. Zastosowanie PCR jest ograniczone jedynie wyobraźnią naukowca, który dzierży jego moc. Istnieje wiele książek i artykułów, które opisują nowe specjalistyczne zastosowania PCR, a wiele innych zostanie opracowanych w ciągu następnej generacji nauk biologicznych. Jednak niezależnie od przewidywanych podejść, podstawowe ramy pozostały takie same. PCR, w całej swojej okazałości, jest zastosowaniem in vitro do generowania dużych ilości określonego segmentu DNA.

Zaprojektowanie eksperymentu PCR wymaga przemyślenia i cierpliwości. Wyniki przedstawione na rysunku 3 ilustrują jedno z głównych wyzwań podczas projektowania strategii optymalizacji PCR. Oznacza to, że gdy jeden parametr PCR zostanie zmieniony, może wpłynąć na inny. Na przykład, jeśli początkowy PCR został przeprowadzony w nieoptymalnej temperaturze wyżarzania (58°C) przy optymalnym stężeniu Mg²⁺ wynoszącym 2,0 mM, wynik dałby rozmaz, jak pokazano na rysunku 3c. Próba usunięcia rozmazu może polegać na ustawieniu warunków PCR z reakcjami zawierającymi 2,0 mM MgCl₂ i dostosowaniu temperatury wyżarzania do 61°C. Jednak, jak widać na rys. 3a, nie dałoby to żadnego produktu. W związku z tym zaleca się miareczkowanie odczynników, a nie dodawanie jednego stężenia do pojedynczej reakcji, podczas rozwiązywania problemów z fałszywymi wynikami. Ponadto najczęstszymi korektami, które są wymagane do optymalizacji eksperymentu PCR, są zmiana stężenia Mg²⁺ i korekta temperatur wyżarzania. Jeśli jednak zmiany te nie zminimalizują lub nie zniosą nieprawidłowych wyników, miareczkowanie dodatków i/lub zmiana protokołów warunków cyklicznych zgodnie z opisem w tabelach 2-6 może złagodzić problem. Jeśli wszystko inne zawiedzie, przeprojektuj podkłady i spróbuj, spróbuj ponownie.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Taq Polimery	Sigma-Aldrich	D4545-25UN
dNTPs	Qiagen	201225
0,2 ml Probówki cienkościenne Probówki PCR	Bio-Rad	223-9469
0,2 ml Nakrętki do probówek cienkościennych	Bio-Rad	223-9472
EDTA sól disodowa dwuwodna	Sigma-Aldrich	E5134
Trizma-HCl	Sigma-Aldrich	T-3253
Niestandardowy podkład fagowy	Invitrogen	25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCGGG
Niestandardowy podkład fagowy	Invitrogen	26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Niestandardowy podkład drożdżowy	Zintegrowane technologie DNA	SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Niestandardowy starter drożdżowy	Zintegrowane technologie DNA Gal3	(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Termocykler	Bio-Rad	170-9703	Mój cykler
Agaroza	ISC BioExpress	E-3120-500
Elektroforeza żelowa	Hoeffer Instrumenty	Model HE33
1 kb Drabina DNA	Nowa Anglia Biolabs	N3232S
Bio Rad Power Pack	Bio-Rad	164-5050	PowerPac
Basic Gel Doc system	Fotodyne Incorporated	FOTO/Analyst Investigator FX Workstation