Geração e Caracterização Fenotípica de um Modelo de Camundongo Deficiente em Cracd Modificado por CRISPR/Cas9 para Estudos de Remodelamento Pós-Infarto do Miocárdio

Resumo

Este protocolo descreve a geração e caracterização fenotípica de um modelo de camundongo C57BL/6N-Cracd^{em1(c.538-83 to c.3352+255 del)} utilizando a tecnologia CRISPR/Cas9 para estudar o papel do CRACD na remodelação cardíaca após infarto do miocárdio.

Resumo

Myocardial infarction (MI) remains a major cause of morbidity and mortality worldwide. This protocol describes a method for generating and characterizing a Cracd-deficient mouse line on the C57BL/6N background using CRISPR/Cas9 technology. Zygotes were co-injected with Cas9 mRNA, a gRNA construct, and a donor template designed to generate a 3153-bp genomic deletion. The edited allele was confirmed by PCR genotyping and Sanger sequencing. To assess the functional role of CRACD in post-MI remodeling, Cracd-deficient and wild-type (WT, C57BL/6N) mice underwent MI induced by permanent ligation of the left anterior descending coronary artery. On postoperative day 7, cardiac function and left ventricular wall motion were assessed using transthoracic echocardiography and speckle-tracking strain imaging, followed by histopathological evaluation with H&E and Masson's trichrome staining. Representative results showed that Cracd-deficient mice exhibited reduced ventricular dilation and preserved systolic function compared to WT controls. This protocol provides a reliable experimental platform for mechanistic studies of CRACD in cardiac pathophysiology.

Introdução

O infarto do miocárdio (IM) continua sendo uma das principais causas de morbidade e mortalidade no mundo, contribuindo significativamente para a sobrecarga da saúde cardiovascular global.¹O prognóstico a longo prazo após infarto do miocárdio é determinado principalmente pelo processo de remodelação do ventrículo esquerdo (VE).², que envolve dilatação ventricular, afinamento da parede e fibrose intersticial^3,4, que são fatores-chave na progressão para insuficiência cardíaca (IC). A incidência global de IC resultante da remodelação cardíaca pós-infarto do miocárdio agrava ainda mais o ônus da doença cardiovascular⁵Apesar dessas observações clínicas bem estabelecidas, faltam estudos sistemáticos que utilizem modelos in vivo sensíveis e reprodutíveis para avaliar o papel de genes específicos no remodelamento pós-IM. Atualmente, nenhum protocolo combina um modelo de nocaute engenharizado por CRISPR/Cas9 com imagem avançada de deformação para avaliar um regulador do citoesqueleto como o CRACD. Assim, é urgentemente necessária uma metodologia que permita manipulação genética precisa e fenotipagem cardíaca de alta resolução.

A proteína reguladora da inibição da polimerização da actina (CRACD), também conhecida como KIAA1211, é um regulador da polimerização da actina predominantemente localizado no citosol que desempenha um papel crítico na dinâmica do citoesqueleto⁶. Ela regula positivamente a polimerização da actina ao se ligar às proteínas de capeamento da actina (CAPZA1, CAPZA2, CAPZB) e impedir que estas se liguem às extremidades pontiagudas dos filamentos de actina⁷. Em tecidos epiteliais, a CRACD desempenha um papel essencial na manutenção da morfologia celular e na transdução de sinais, preservando a integridade do citoesqueleto de actina^8,9. Em células tumorais, sua desregulação está associada ao aumento da metástase e proliferação celular^6,10. O papel da CRACD no coração ainda não foi completamente compreendido. Estudos de transcriptoma cardíaco e intervenções experimentais mostram que a expressão do gene Cracd responde ao estresse patológico e pode regular genes relacionados à dinâmica citoesquelética durante o remodelamento ventricular^9,11. Além disso, sua proteína inibidora, CapZ, está fortemente associada à patologia cardíaca: a fosforilação da CapZ regula o crescimento dos miofilamentos durante a hipertrofia induzida pela fenilefrina¹². Nossa pesquisa inicial indica que a diminuição moderada da CRACD confere proteção contra danos miocárdicos e preserva a contratilidade dos miofilamentos após isquemia aguda¹³. Esses achados levantam a possibilidade de que a CRACD desempenhe um papel no remodelamento ventricular maladaptativo após infarto do miocárdio (MI). No entanto, estudos sistemáticos in vivo de perda de função, que testem se a deficiência de Cracd modula o remodelamento pós-MI, ainda são escassos, principalmente devido à ausência de um protocolo validado, passo a passo, para gerar e fenotipar um camundongo deficiente em Cracd sob estresse isquêmico.

Várias abordagens existem para gerar camundongos knockout constitutivos. A recombinação homóloga tradicional em células-tronco embrionárias (ES) é precisa, mas cara e demorada (12–18 meses), além de limitada a certas linhagens de camundongos¹⁴. A mutagênese com ENU (N-etil-N-nitrosoureia) produz mutações pontuais aleatórias, exigindo retrocruzamentos extensivos e sequenciamento¹⁵. Em contraste, o CRISPR/Cas9 oferece vantagens práticas distintas para este estudo: (i) a injeção direta em zigotos reduz o tempo para 4–6 meses; (ii) permite a deleção de um grande fragmento genômico (3153 pb) para assegurar a perda completa da função; (iii) funciona diretamente na linhagem C57BL/6N, sem necessidade de conversão de linhagem; e (iv) evita a utilização de um marcador selecionável, minimizando interferências transcricionais não intencionais. Portanto, o CRISPR/Cas9 é a escolha mais eficiente para gerar uma linhagem deficiente em Cracd, adequada para fenotipagem cardiovascular de rotina. Essa tecnologia tem sido amplamente utilizada para realizar estudos precisos in vivo de perda de função^16,17.

A imagem de deformação por rastreamento de speckle é uma técnica de pós-processamento que acompanha o movimento de speckles acústicos naturais no miocárdio quadro a quadro, permitindo o cálculo de parâmetros de deformação miocárdica, como deformação (mudança fracional no comprimento) e taxa de deformação (velocidade de deformação)¹⁸. Diferentemente da ecocardiografia em modo M convencional ou bidimensional, que fornece índices funcionais globais (fração de ejeção, encurtamento fracional, diâmetro interno do ventrículo esquerdo) e é relativamente insensível a anormalidades regionais do movimento da parede, a imagem de deformação pode quantificar a função contrátil segmentar. Isso é particularmente importante no período inicial após o infarto, quando a hipercinesia compensatória de segmentos não infartados pode preservar a fração de ejeção global apesar de disfunção regional significativa. O rastreamento de speckle oferece várias vantagens sobre os pontos finais padrão: fornece deformação segmentar e taxa de deformação, deslocamento e velocidade, detectando assim alterações subclínicas sutis¹⁹; pode identificar dessincronia e déficits contráteis precoces antes que ocorra remodelação irreversível; e investiga diretamente o subendocárdio, a camada mais vulnerável à isquemia²⁰. Neste estudo, CRACD é um regulador do citoesqueleto que pode influenciar a contratilidade das miofibras em nível microscópico. Medidas baseadas na cavidade convencional podem facilmente deixar passar esses efeitos mecânicos locais. Assim, a integração da análise por rastreamento de speckle neste protocolo aumenta a capacidade de detectar efeitos protetores precoces da deficiência de Cracd. Portanto, integrar o rastreamento de speckle neste protocolo fornece uma ferramenta sensível e quantitativa para avaliar a remodelação pós-infarto, especialmente durante a primeira semana após o IAM, quando ocorrem dilatação precoce e disfunção contrátil^21,22.

Este protocolo foi desenvolvido para pesquisadores que investigam o impacto funcional da deleção de um gene específico no remodelamento agudo (7 dias) pós-IM, utilizando uma combinação de camundongos knockout constitutivos e imagens de alta resolução. É adequado para estudos geradores de hipóteses em que a perda global do gene-alvo é aceitável e o principal desfecho são as alterações estruturais e funcionais sistólicas precoces. No entanto, várias limitações devem ser consideradas. Primeiro, o camundongo deficiente em Cracd é um knockout global; portanto, os efeitos cardioprotetores observados não podem ser atribuídos exclusivamente à perda de CRACD nos cardiomiócitos, já que contribuições sistêmicas também podem desempenhar um papel. Estudos futuros utilizando estratégias de knockout condicional serão necessários para obter deleção específica do coração. Segundo, o protocolo concentra-se em um único ponto temporal (dia 7) e não aborda o remodelamento crônico nem a progressão da IC. Estudos longitudinais além da fase aguda serão necessários. Terceiro, a análise por rastreamento de speckle exige imagens de alta qualidade (bordas endocárdicas bem definidas) e software dedicado, os quais podem não estar disponíveis em todas as instalações centrais. Apesar dessas limitações, o protocolo fornece uma plataforma robusta e reprodutível para a caracterização funcional inicial de genes envolvidos no remodelamento cardíaco pós-IM.

Este estudo teve como objetivo utilizar o sistema CRISPR/Cas9 para gerar e validar um modelo de camundongo deficiente em Cracd (C57BL/6N-Cracd^{em1 (c.538-83 a c.3352+255 del)}) para investigar o impacto da deficiência de Cracd no remodelamento cardíaco pós-IM e no movimento da parede ventricular. O infarto do miocárdio (IM) foi induzido em camundongos selvagens (WT, C57BL/6N) e em camundongos deficientes em Cracd, sendo realizadas avaliações abrangentes uma semana após o IM. As avaliações incluíram parâmetros ecocardiográficos convencionais, análise de deformação por rastreamento de padrão aleatório (speckle-tracking) e avaliação histopatológica. Concentramo-nos especificamente na fase inicial após o IM (dia 7) para captar os eventos iniciais de remodelamento e determinar se a deficiência de Cracd afeta a dilatação ventricular e a função sistólica durante a fase aguda do IM. Os resultados devem fornecer informações valiosas sobre o papel do CRACD na modulação do remodelamento cardíaco adverso após o infarto do miocárdio.

Protocolo

All animal experiments were approved by the Institutional Animal Care and Use Committee of the Guangdong Institute of Biotechnology (Approval No. IACUC2025179). The study utilized 20 SPF Cracd-deficient and 20 age- and weight-matched WT mice. All mice were 10–12 weeks old and weighed 20–25 g. All male animals were housed in an AAALAC-accredited facility (License No. SYXK (Yue) 2016-0122) at the Guangdong Institute of Biotechnology (Guangdong Laboratory Animals Monitoring Institute). The housing environment was maintained at 22–25 °C with 50–70% relative humidity under a 12 h light/12 h dark cycle.

1. Generation of Cracd-deficient mice using CRISPR/Cas9

1. Use CRISPR/Cas9 gene editing technology to generate Cracd-deficient mice on a C57BL/6N background. Delete the genomic sequence from c.538-83 to c.3352+255 (partial intron 5 to intron 6) of Cracd by homology-directed repair.
   NOTE: The mouse Cracd gene (NCBI RefSeq: NM_001163793.1; Ensembl: ENSMUSG00000036377) is located on chromosome 5 and contains 9 exons, with the ATG start codon in exon 2 and the TAA stop codon in exon 9.
2. Design the sequence of gRNA targeting vector and donor oligonucleotide (with targeting sequence flanked by 120 bp homologous sequences combined on both sides).
   1. Log in to the NCBI website, select the Primer-BLAST function, and design PCR primers for genotyping.
   2. Paste the NCBI reference sequence number of Cracd (NM_001163793.1) into the PCR template field, specify the exon range for amplification, and click “Get Primers” to retrieve multiple pairs of candidate primers for PCR-based detection of the deletion and wild-type alleles.
3. Design single-guide RNAs (gRNAs) to target sites flanking the intended deletion interval in the Cracd gene.
   1. Select four gRNA sequences (20 nt upstream of the PAM) using online CRISPR design tools.
   2. To minimize potential off-target effects, score the candidate gRNAs with CRISPRater and select the two optimal sequences (including the NGG PAM).
      NOTE: Example selected sequences:
      gRNA-A1: CGGCGCTCTTAACATCCAGAGGG (score: 0.71)
      gRNA-A2: CCCTTCAGTCTGGGTAGTAGAGG (score: 0.71)
      ​Accept gRNAs with a CRISPRater score ≥ 0.5. For in vitro validation, accept gRNAs with > 50% cleavage efficiency in a Cas9/gRNA target efficiency detection kit.
4. Design a single-stranded donor oligonucleotide to promote efficient joining of the intended breakpoints. Example donor sequence: TTAACCATCAACGGGCCGCTGCAAGGGCTGCTGT
   GTCTATA CTCAGGACCACCTGCCCTCTAGAGGCAGGAAGGT
   AGAGTTCCAAGCTCTGCTGTGCTAGGTTAAATGCAACTTAACATC.
5. Co-inject Cas9 mRNA, gRNA and donor oligonucleotide into fertilized eggs to generate Cracd-deficient mice. Prepare Cas9 mRNA and gRNA by in vitro transcription.
   1. Preparation of gRNA.
      1. Transcribe gRNAs in vitro from DNA templates using the MEGAshortscript™ T7 transcription kit (see Table of Materials) following the manufacturer's protocol.
      2. Purify the transcribed gRNAs using an RNA purification kit (see Table of Materials) and elute them in RNase-free water.
      3. Assess gRNA cleavage activity using an in vitro Cas9/gRNA target efficiency detection kit (see Table of Materials).
      4. Perform all RNA preparation steps on ice using RNase‑free consumables (pipette tips, tubes, water). Keep RNA samples on ice at all times to prevent degradation.
   2. To perform the cleavage assay: mix the transcribed gRNA (25 ng/µL) with recombinant Cas9 protein (50 ng/µL) and a PCR-amplified DNA fragment containing the target sequence (50 ng).
      1. Incubate the reaction at 37 °C for 30 min.
      2. Run the products on a 2% agarose gel to visualize uncleaved and cleaved bands.
      3. Calculate cleavage efficiency as the ratio of cleaved band intensity to total (cleaved + uncleaved) band intensity.
      4. Accept gRNAs with > 50% cleavage efficiency.
   3. Preparation of Cas9 mRNA.
      1. Thaw the reagents from the T7 ARCA mRNA Kit (see Table of Materials).
      2. At room temperature, combine 10 µL of 2× ARCA/NTP mix, 1 µL of template DNA, 2 µL of T7 RNA polymerase mix, and nuclease-free water to 20 µL.
      3. Mix thoroughly, pulse-spin in a microfuge (5 s at 5000 × g), and incubate at 37 °C for 30 min.
   4. Remove the template DNA by adding 2 µL of DNase I (1 U/µL), mix well, and incubate at 37 °C for 15 min to obtain Cas9 mRNA. Optionally add 1 µL of RNase inhibitor (40 U/µL) (see Table of Materials) to the reaction to prevent RNA degradation.
      1. Perform all steps on ice with RNase‑free consumables. Keep the Cas9 mRNA on ice until use.
   5. Superovulate 4-week-old C57BL/6N female mice by intraperitoneal injection of 5 IU of pregnant mare serum gonadotropin (PMSG), followed 48 h later by 5 IU of human chorionic gonadotropin (hCG).
      CAUTION: PMSG and hCG are hormones that may cause skin sensitization. Wear gloves and dispose of needles in a sharps container.
   6. Approximately 14–18 h after hCG injection, euthanize the C57BL/6N female mice and one 8–12-week-old C57BL/6N male mouse by cervical dislocation. Collect oocytes from the oviducts of the females and sperm from the cauda epididymis of the male.
      ​CAUTION: Euthanasia must be performed in accordance with institutional guidelines. Cervical dislocation should only be performed by trained personnel.
   7. Capacitate the sperm in capacitation medium (see Table of Materials).
      1. Add a small volume of the sperm suspension to the oocytes for in vitro fertilization and co-culture for 3–4 h at 37 °C to obtain fertilized zygotes.
   8. Dilute the transcribed gRNA and Cas9 mRNA with RNase-free water to working concentrations (typically 25 ng/µL for gRNA and 50 ng/µL for Cas9 mRNA) and donor oligonucleotide at 10 ng/µL.
      1. Microinject 1–2 pL of the mixture into the cytoplasm of fertilized zygotes using a microinjection system (see Table of Materials).
      2. Identify healthy zygotes by the presence of two distinct pronuclei and an intact polar body under a stereomicroscope.
      3. Transplant 300 healthy fertilized zygotes into the oviducts of pseudopregnant female mice that have been mated with vasectomized males.
         ​NOTE: This results in the generation of 2 positive founder mice (F0).
      4. Use RNase‑free water and ice‑cold conditions during dilution to maintain RNA integrity.
   9. Identify F0 mice by PCR genotyping of tail biopsies (see section 1.6).
      1. Breed F0 founders with WT mice to generate F1 heterozygous offspring, to obtain germline transmission of the deletion.
      2. Intercross heterozygous F1 mice to produce F2 homozygous Cracd-deficient mice.
6. Genotype by Polymerase Chain Reaction (PCR)
   NOTE: The following protocol uses a commercial TIANamp Genomic DNA Kit (see Table of Materials). Buffer GL is the lysis buffer, Buffer GB is the binding buffer, and Buffer WA and Buffer WB are wash buffers.
   1. Place approximately 2–5 mm of mouse tail tissue in a microcentrifuge tube containing 180 µL of Buffer GL, 20 µL of Proteinase K (20 mg/mL stock solution), and 10 µL of RNase A (10 mg/mL stock solution).
      1. Incubate the sample at 56 °C overnight to digest the tissue.
   2. Centrifuge the tube at 13800 × g for 2 min at room temperature to pellet tissue debris and transfer the supernatant to a new tube.
   3. Add 200 µL of Buffer GB and 200 µL of 100% ethanol to the supernatant, mix thoroughly, and apply the mixture to a spin column placed in a collection tube.
      1. Centrifuge at 13800 × g for 2 min at room temperature and discard the flow-through.
   4. Add 500 µL of Buffer WA to the column, centrifuge at 13800 × g for 1 min at room temperature and discard the flow-through.
   5. Carefully add 700 µL of Buffer WB (wash buffer containing ethanol, pre-mixed with 100% ethanol) to the spin column, centrifuge at 13800 × g for 1 min at room temperature and discard the flow-through.
      1. Apply Buffer WB to the inner wall of the column to wash residual salts.
   6. Repeat step 1.6.5 once, then transfer the column into a new collection tube and centrifuge at 13800 × g for 2 min at room temperature to dry the membrane and remove residual ethanol.
   7. Place the column into a new 1.5 mL microcentrifuge tube. Add 50–200 µL of sterilized water or elution buffer (preheated to 65 °C) to the center of the membrane, incubate for 5 min.
      1. Centrifuge the column at 13800 × g for 2 min at room temperature to elute the DNA.
      2. To increase DNA yield, either reapply the flow-through to the membrane or add an additional 50–200 µL of sterilized water, incubate for 5 min.
      3. Perform a final centrifugation at 13800 × g for 2 min.
         ​NOTE: Expect DNA yield of 50–200 ng/µL from tail tissue; A260/A280 ratio of 1.8–2.0 indicates pure DNA.
7. Genotyping by multiplex PCR using three primers in a single reaction.
   1. Design three primers to distinguish WT, heterozygous, and homozygous genotypes in one PCR reaction: Forward primer F1 (5’-CAGAAGTCATAGCAGCAAGGCAG-3’, binds upstream of the deletion), Forward primer F2 (5’-GAGGGAATTGAGAGGGAGCC-3’, binds within the deleted region, present only in the WT allele), and Reverse primer R1 (5’-GCCAATTTAGCTGCTTCAAATGTTC-3’, common reverse primer downstream of the deletion).
      NOTE: The targeted allele generates a 421 bp amplicon (F1 + R1) only when the deletion is present; the WT allele generates a 357 bp amplicon (F2 + R1) only when the intact allele is present.
   2. Set up the PCR reaction in a 25 µL total volume containing 50–100 ng genomic DNA, 0.2 µM of each primer (F1, F2, and R1), 200 µM dNTPs, 1.5 mM MgCl₂, and 1 U Taq DNA polymerase (see Table of Materials).
   3. Use the following thermocycling program: initial denaturation at 95 °C for 3 min; 35 cycles of denaturation at 95 °C for 15 s, annealing at 60°C for 15 s, and extension at 72 °C for 25 s; and a final extension at 72 °C for 5 min.
      1. Separate the PCR products by 1–2% agarose gel electrophoresis (120 V, 30 min) in 1× TAE buffer.
   4. Genotype interpretation based on band pattern: WT shows only a 357 bp band (F2+R1); Heterozygous shows both 421 bp (F1+R1) and 357 bp (F2+R1) bands; Homozygous shows only a 421 bp band (F1+R1).

2. Myocardial infarction model establishment

1. Anesthetize the mice via inhalation of 3% isoflurane (delivered in 100% oxygen at 1 L/min), place them in a supine position on a surgical platform, and confirm deep anesthesia by the absence of pedal withdrawal reflex.
   CAUTION: Isoflurane is a volatile anesthetic. Use only in a well-ventilated area or under a fume hood to avoid inhalation.
2. Perform orotracheal intubation using a 20-gauge intravenous catheter sheath. Apply ophthalmic ointment to both eyes to prevent corneal drying during surgery.
   1. Connect the tube to a mechanical ventilator upon successful intubation to maintain ventilation and anesthesia with 2% isoflurane.
      NOTE: Successful intubation is confirmed by visible chest movements synchronized with the ventilator.
3. Remove hair from the anterior chest with depilatory cream. Disinfect the surgical area by applying povidone-iodine and 70% alcohol in a circular motion for multiple times, starting from the center and moving outward.
   1. After fully exposing the skin, make a 1–1.5 cm incision in the left chest wall between the 2nd and 3rd intercostal spaces to open the thoracic cavity.
   2. Incise the pericardium to fully expose the heart.
      CAUTION: Surgical procedures must be performed under sterile conditions. Use appropriate personal protective equipment (PPE), including gloves and a surgical mask.
4. Using the inferior border of the left auricle as a landmark, pass a 7–0 atraumatic suture needle beneath the left anterior descending coronary artery (LAD) approximately 2–3 mm distal to its origin.
   1. Pass the needle to a depth of approximately 0.5–1 mm and tighten the ligature slowly to avoid myocardial tearing.
   2. Confirm successful occlusion by observing pallor (whitening) of the left ventricular anterior wall distal to the ligation site within 30 s.
      1. In sham-operated controls, open the chest and pass the suture beneath the coronary artery without tying the knot.
5. After establishing the model, sequentially suture the ribs (4-0 absorbable suture, simple interrupted pattern) and skin (4-0 absorbable suture, continuous pattern) to close the thoracic cavity. Remove the endotracheal tube once the mouse resumes stable spontaneous breathing.
6. Place mice on a heating pad (37 °C) until fully conscious.
   1. Administer postoperative analgesia (e.g., buprenorphine 0.05–0.1 mg/kg, subcutaneously, every 12 h for 48 h) according to institutional IACUC guidelines and closely monitor the postoperative health status for several days.
      NOTE: Monitor for signs of distress (hunched posture, ruffled fur, reduced mobility, weight loss > 20%).
7. Mortality and exclusion criteria.
   1. Record the number of mice that die within the first 7 days after MI surgery.
      NOTE: In a typical cohort, expect a mortality rate of approximately 10–20% by postoperative day 7, with no significant difference between WT and Cracd‑deficient mice. Common causes of death include extensive infarction leading to acute heart failure, surgical bleeding, or pneumothorax. Exclude any mouse with persistent arrhythmia (heart rate < 350 bpm) or signs of severe distress (e.g., hunched posture, ruffled fur, weight loss > 20%) from subsequent echocardiographic and histological analyses. For sham‑operated mice, mortality should be < 5%.

3. Echocardiographic assessment

1. Animal Preparation and Anesthesia
   1. Power on the high-resolution small animal ultrasound imaging system (see Table of Materials) and its integrated heated stage.
      1. Ensure that the appropriate high-frequency transducer is securely connected to the mounting apparatus following the manufacturer’s instructions. Set the temperature of the heated stage to 37 °C and allow it to stabilize.
   2. Place mice in an induction chamber and anesthetize them with 3% isoflurane in oxygen (1–2 L/min) until the pedal withdrawal reflex is absent. Transfer anesthetized mice to the heated platform in a supine position.
      1. Maintain anesthesia with 1–1.5% isoflurane delivered via a nose cone, adjusting to maintain heart rate between 450–550 beats per min.
   3. Apply ophthalmic ointment to both eyes to prevent corneal drying.
      1. Shave the thoracic region, evenly apply depilatory cream for no longer than 3 min, then remove the depilatory cream thoroughly with wet gauze.
      2. Rinse the skin gently with warm saline if necessary and dry the area. Attach surface ECG electrodes to the limbs using electrode gel at the contact sites and secure them with tape.
         ​NOTE: Confirm stable ECG and heart rate within 450–550 bpm before proceeding to ultrasound imaging.
2. Conventional Echocardiography Image Acquisition
   1. Position the mouse in a horizontal, supine posture on the heated stage, with a slight leftward tilt if needed to optimize cardiac imaging.
      1. Apply a generous amount of pre-warmed ultrasound coupling gel to the hairless left precordial region, avoiding air bubbles.
      2. Place the transducer gently on the chest wall at the left parasternal position. Adjust its orientation so that the index mark points toward the mouse’s right shoulder and fine-tune the angle and pressure to optimize image quality.
   2. Switch to B-mode (two-dimensional) imaging, adjust depth, focus zone, and frame rate to obtain a clear parasternal long-axis view of the left ventricle. Acceptable image quality requires clear visualization of the endocardial border with no dropouts.
   3. Once the heart rate stabilizes (450–550 bpm), acquire three separate parasternal long-axis B-mode cine loops, each containing at least 3–5 consecutive cardiac cycles.
      1. Save each loop by pressing “Cine Store”, and store representative still frames using “Frame Store”.
   4. From the long‑axis view, rotate the transducer 90° clockwise to obtain a short‑axis view at the mid‑papillary level.
      1. Acquire three separate short‑axis B‑mode cine loops (each with ≥ 3–5 cycles).
      2. Activate M‑mode, position the cursor perpendicular to the interventricular septum and posterior wall, and record three separate M‑mode tracings.
         ​NOTE: Acceptable M‑mode tracings require clear endocardial borders throughout the cardiac cycle.
   5. Use the VevoLab 3.2.0 software (see Table of Materials) to measure the following parameters from M‑mode tracings according to the American Society of Echocardiography leading‑edge method: interventricular septum thickness at diastole and systole (IVSd, IVSs), left ventricular internal diameter at diastole and systole (LVIDd, LVIDs), and left ventricular posterior wall thickness at diastole and systole (LVPWd, LVPWs).
      1. Calculate left ventricular ejection fraction (EF) and fractional shortening (FS) using the Teichholz formula: EF (%) = [(LV Vold - LV Vols) / LV Vold] × 100, LV Vold = ((7 / (2.4 + LVIDd)) × LVIDd³), LV Vol;s = ((7 / (2.4 + LVIDs)) × LVIDs³), FS (%) = [(LVIDd – LVIDs) / LVIDd] × 100.
         NOTE: For each mouse, measurements were averaged from three consecutive cardiac cycles per M‑mode recording, and the average was taken across three separate recordings, resulting in a total of 9 measurements per parameter per mouse.
3. Speckle-Tracking Strain Analysis
   1. Perform speckle-tracking analysis using the dedicated analysis software (VevoStrain module within VevoLab 3.2.0).
      1. Open a clear parasternal long-axis B-mode cine loop, select "Vevo Strain" to enter the strain analysis mode, retain only complete cardiac cycles, and choose "Long Axis".
   2. Manually trace the endocardial border at the end‑diastolic frame. After the endocardial border is drawn, the software automatically generates an epicardial border (adjust as needed). Then start the strain analysis and activate the "toggle contour/vector/orbit line/B mode" function to visualize the motion trajectory.
   3. Assess tracking quality via the colour‑coded mesh: it should appear green, closely follow the endocardial and epicardial borders without jerking, and move synchronously with myocardial contraction/relaxation. If not, manually refine the borders and re‑analyze.
   4. Activate "Time‑to‑peak analysis" to divide the left ventricle into six segments (basal anterior, mid anterior, apical anterior, apical posterior, mid posterior, basal posterior), with each colour representing an individual segment. Once satisfactory tracking is achieved, export data for wall motion parameters: velocity (cm/s), displacement (cm), strain (%), strain rate (1/s) for both longitudinal and radial.
      NOTE: If tracking quality remains poor after three acquisition attempts (e.g., erratic strain curves, or inability to visualise clear motion trajectories), exclude the mouse from strain analysis.

4. Histopathological analysis

1. After echocardiography, administer a lethal dose of isoflurane to deeply anesthetized mice and apply a secondary physical method (e.g., cervical dislocation) according to institutional guidelines.
   1. Open the thoracic cavity, rapidly harvest the hearts and rinse the hearts gently in cold phosphate-buffered saline (PBS).
      CAUTION: Euthanasia must be performed according to institutionally approved protocols.
2. Trim the hearts, remove the great vessels and cut transversely from apex to base into 2–3 slices (approximately 2–3 mm thick).
   1. Immerse the tissue slices in 4% paraformaldehyde in PBS and fix them at 4 °C for 12–24 h.
      NOTE: Use a volume ratio of fixative to tissue of at least 10:1.
      CAUTION: Paraformaldehyde is toxic and a suspected carcinogen. Handle in a fume hood and wear appropriate PPE (gloves, lab coat, safety goggles). Dispose of paraformaldehyde waste as hazardous chemical waste according to institutional guidelines.
3. Dehydrate tissue through a graded ethanol series (50%, 70%, 80%, 95%, 100% ethanol, each for 1 h), clear them in xylene (2 changes, 30 min each), embed them in paraffin, and section them at 4–5 µm thickness using a microtome.
   NOTE: Sections should be free of folds and tears.
   CAUTION: Xylene is flammable and toxic. Use only in a fume hood and avoid skin contact. Collect xylene waste in a designated container and dispose of as hazardous chemical waste.
4. Deparaffinize the sections in xylene (2 changes, 5–10 min each), rehydrate them through descending ethanol series (100%, 95%, 80%, 70%, each for 3 min) to water.
   1. Stain them using standard Hematoxylin and Eosin (H&E) (see Table of Materials) and Masson’s trichrome protocols (see Table of Materials).
      CAUTION: Xylene is toxic. Use only in a fume hood and avoid skin contact. Dispose of xylene waste as hazardous material.
5. Examine the stained sections under a light microscope (see Table of Materials).
   1. For quantitative analysis, capture digital images at 4×, 20×, and 40× magnification using a digital camera attached to the microscope. Measure infarct size and fibrotic area using ImageJ.
      NOTE: Infarct size (%) = (infarct area / total LV area) × 100; collagen content (%) = (blue-stained area / total myocardial area) × 100.

Resultados

Generation of Cracd-deficient mice

A heritable mouse model carrying a targeted deficiency in the Cracd gene was generated using CRISPR/Cas9-mediated genome editing (Figure 1A, Figure 1B). To distinguish WT, heterozygous, and homozygous genotypes, a multiplex PCR was performed using three primers (F1, F2, R1) in a single reaction. Mice homozygous for the deletion (Cracd‑deficient) displayed only the 421 bp band, WT mice showed only the 357 bp band (Figure 1C). Sanger sequencing of genomic DNA from Cracd-deficient mice confirmed the predicted deletion in the target gene compared to WT controls (Figure 1D). Western blot analysis further demonstrated a marked reduction in CRACD protein levels in cardiac tissues from Cracd-deficient mice compared with WT controls (Figure 1E). Together, these data confirm the successful establishment of the Cracd-deficient mouse line.

Echocardiography

Echocardiographic assessment on postoperative day 7 revealed pronounced pathological cardiac remodeling in WT mice after MI (WT-MI) compared with sham-operated controls (Figure 2A). The WT-MI group showed thinning of the interventricular septum (Figure 2B, C), significant left ventricular (LV) dilation as reflected by increased LVIDd (Figure 2D) and LVIDs (Figure 2E), and thinning of the posterior wall (Figure 2F, G). These structural alterations were associated with a pronounced decline in global systolic function, as demonstrated by significantly reduced EF (Figure 2H) and FS (Figure 2I). In contrast, Cracd-deficient mice displayed a cardioprotective phenotype following MI. LV dilation was significantly attenuated, with notably smaller LVIDd and LVIDs compared with the WT-MI group. Furthermore, these mice exhibited improved systolic thickening of the posterior wall and maintained significantly higher EF and FS values. These findings indicate that Cracd deficiency effectively attenuates post-infarction LV dilation and preserves global systolic function.

Speckle-tracking strain analysis

Left ventricular myocardial motion and deformation were further evaluated by speckle‑tracking echocardiography using only parasternal long‑axis views (Figure 3A). To ensure data reliability, we defined pragmatic criteria for acceptable output based on the capabilities of the VevoStrain software. Acceptable strain analysis required: (i) a clear parasternal long‑axis view with endocardial borders visible throughout the cardiac cycle; (ii) a stable heart rate between 450–550 bpm during acquisition; (iii) after automatic tracking, the colour‑coded mesh (activated via “toggle contour/vector/orbit line/B mode”) had to closely follow the endocardial and epicardial borders without jerking or losing contact; and (iv) strain curves had to be smooth, show consistent waveforms across segments, and lack sudden spikes or arrhythmic interruptions. Suboptimal output—most commonly erratic strain curves or inability to visualise clear motion trajectories—led to manual adjustment of endocardial or epicardial contours and re‑analysis. If quality remained poor after three attempts, the mouse was excluded. Using these criteria, we obtained reliable strain data in WT‑MI mice and Cracd‑deficient MI mice.

Compared with the sham group, WT-MI mice exhibited significantly reduced radial velocity (Figure 3B) and longitudinal velocity (Figure 3C), as well as radial displacement (Figure 3D) and longitudinal displacement (Figure 3E), indicating impaired global myocardial motion. The absolute values of radial strain (Figure 3F), radial strain rate (Figure 3G), longitudinal strain (Figure 3H), and longitudinal strain rate (Figure 3I) were also markedly decreased, reflecting severely compromised regional myocardial deformation and function. In contrast, Cracd-deficient mice showed significant improvement in these parameters. Compared with the WT-MI group, they displayed better recovery of radial and longitudinal displacements. Furthermore, radial velocity, radial strain, and radial strain rate were maintained at higher levels, while longitudinal strain and longitudinal strain rate were significantly improved. These results suggest that Cracd deficiency not only preserves global systolic function but also enhances regional LV myocardial deformation after MI.

The speckle‑tracking imaging analysis also included visualization of segmental strain distribution and cardiac motion trajectories. Parasternal long‑axis B‑mode images with segmented six regions (BA, MA, AA, AP, MP, BP) and color gradient mapping are displayed in Figure 4A. Cardiac motion trajectories, time‑to‑peak curves for radial and longitudinal strain, parametric distribution maps of strain synchrony, and three‑dimensional reconstructions are presented in Figure 4B. These data further support the functional improvements observed in Cracd‑deficient mice.

Histological examination

To assess the protective effect of Cracd deficiency against MI, histopathological examination was performed on heart sections from WT and Cracd-deficient mice at 7 days post-MI using H&E and Masson's trichrome staining. Whole‑heart longitudinal sections are shown in Figure 5A, with quantitative analysis of infarct size and collagen content presented in Figure 5B and Figure 5C, respectively. High‑magnification views of the infarct zone, border zone, and remote zone are displayed in Figure 5D. In WT-MI hearts, H&E staining showed pronounced left ventricular wall thinning and a well-demarcated infarct zone. Within the infarct region, extensive inflammatory cell infiltration, myocardial necrosis, and marked fibrosis with scar formation were observed. In the border zone, inflammatory infiltration, myocardial necrosis, fibrosis and cardiomyocyte hypertrophy were evident, while the remote zone displayed prominent hypertrophic changes. Corresponding Masson's trichrome staining further demonstrated extensive interstitial fibrosis within both the infarct and border zones of WT hearts following MI. In contrast, Cracd-deficient mice exhibited substantially attenuated pathological alterations, including reduced wall thinning, diminished inflammatory infiltration and myocardial necrosis, less pronounced cardiomyocyte hypertrophy, and markedly decreased interstitial fibrosis compared with WT-MI hearts. These histological findings indicate that Cracd deficiency mitigates post-infarction myocardial damage and adverse remodeling.

Successful protocol execution should yield: (i) a well‑demarcated infarct zone with extensive collagen deposition in WT-MI hearts; (ii) clear cellular morphology without staining artifacts; and (iii) significantly attenuated pathology in Cracd‑deficient MI hearts. Although infarct size may vary with ligation precision, the genotype‑dependent difference is a reliable indicator of successful performance.

Figure 1: Generation of Cracd-deficient mice. (A) Construction of Cracd-deficient mice. (B) Schematic of the Cracd gene modification strategy. (C) PCR genotyping of tail genomic DNA. WT mice show a single 357 bp band, while homozygous (Cracd‑deficient) mice show a single 421 bp band. (D) Sanger sequencing of genomic DNA confirmed the predicted deletion in the Cracd locus of deficient mice compared to WT controls. (E) Western blot analysis showed significantly reduced CRACD protein levels in the hearts of Cracd-deficient mice compared to WT controls. n = 6 mice per group. Data are presented as mean ± SEM. Statistical significance was calculated with a two-tailed unpaired Student's t-test. Please click here to view a larger version of this figure.

Figure 2: Echocardiographic assessment of cardiac function. (A) Representative B-mode and M-mode echocardiographic images of mouse hearts at diastole and systole. Quantitative analysis of (B) interventricular septum thickness at diastole (IVSd) and (C) systole (IVSs), (D) left ventricular internal diameter at diastole (LVIDd) and (E) systole (LVIDs), (F) left ventricular posterior wall thickness at diastole (LVPWd) and (G) systole (LVPWs), (H) ejection fraction (EF), and (I) fractional shortening (FS). n = 10 mice per group. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey's multiple comparisons test. Please click here to view a larger version of this figure.

Figure 3: Speckle-tracking strain analysis. (A) Representative images of left ventricular wall motion and deformation at diastole and systole. Quantitative analyses of the following parameters: (B) radial velocity, (C) longitudinal velocity, (D) radial displacement, (E) longitudinal displacement, (F) radial strain, (G) radial strain rate, (H) longitudinal strain, and (I) longitudinal strain rate. n = 10 mice per group. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey's multiple comparisons test. Please click here to view a larger version of this figure.

Figure 4: Speckle-tracking imaging in WT-Sham, WT-MI, Cracd-deficient Sham, and Cracd-deficient MI groups at 7 days post-MI. (A) Parasternal long‑axis B‑mode images. Left ventricular wall was segmented into six regions: BA (basal anterior), MA (mid anterior), AA (apical anterior), AP (apical posterior), MP (mid posterior), and BP (basal posterior). Color gradient from blue to red represents increasing strain magnitude. (B) Cardiac motion trajectories; time-to-peak curves for radial and longitudinal strain values along with corresponding peak times. Parametric distribution maps of strain synchrony (blue/red indicate direction: radial – away from/toward center; longitudinal – away from/toward apex). White dots = highest velocity regions, black dots = lowest velocity. Three-dimensional reconstructions (X: time, Y: spatial position, Z: strain magnitude). Please click here to view a larger version of this figure.

Figure 5: Histopathological analysis of cardiac remodeling after MI. (A) Whole-heart longitudinal sections with H&E and Masson's trichrome staining. Scale bars: 2 mm. (B) Quantitative analysis of infarct size and (C) collagen content. (D) High‑magnification views of infarct zone (IZ), border zone (BZ), and remote zone (RZ). H&E: yellow circles = inflammatory infiltration; black arrows = myocardial necrosis; green stars = fibrosis; blue arrows = hypertrophy. Masson’s trichrome: blue indicates collagen deposition. Scale bar: 50 μm. n = 5 mice per group. Data are presented as mean ± SEM. Statistical significance was determined by one-way ANOVA followed by Tukey's multiple comparisons test. Please click here to view a larger version of this figure.

Discussão

Neste estudo, geramos um camundongo deficiente em Cracd projetado com CRISPR/Cas9 e estabelecemos um fluxo de trabalho para fenotipá-lo após IAM utilizando ecocardiografia convencional, imagem de deformação por rastreamento de speckle e histologia. O protocolo gerou animais knockout com perda confirmada da proteína CRACD. Camundongos deficientes em Cracd apresentaram menor dilatação ventricular, melhor FE e fibrose reduzida em comparação aos controles WT após IAM, confirmando a utilidade do modelo para o estudo do remodelamento cardíaco.

O sucesso deste modelo depende de várias etapas críticas. O planejamento do gRNA e sua validação in vitro afetam diretamente a eficiência da edição em zigotos²³. Utilizamos o CRISPick ou o Benchling para selecionar gRNAs com pontuações CRISPRater ≥ 0,5 e, em seguida, testamos a eficiência de clivagem com um ensaio in vitro de Cas9/gRNA. Apenas gRNAs que atinjam clivagem > 50% são microinjetados. A ligadura adequada da ADA também é igualmente crucial: o fio 7‑0 deve passar a 2–3 mm da origem da ADA com uma profundidade de 0,5–1 mm para evitar perfurar o ventrículo direito (muito profundo) ou não obstruir o vaso (muito superficial); o embranquecimento imediato da parede anterior confirma a obstrução. O controle da frequência cardíaca durante a ecocardiografia também é essencial²⁴; manter a frequência entre 450–550 bpm mediante ajuste da concentração de isoflurano (geralmente 1–2%) melhora a reprodutibilidade das medidas convencionais e de deformação. Por fim, para a análise de rastreamento de padrão de ruído (speckle-tracking), a avaliação visual da malha codificada por cores é essencial²⁵. A malha deve seguir os limites do miocárdio sem movimentos abruptos; caso contrário, é necessária correção manual; se a qualidade permanecer insatisfatória após três tentativas, o camundongo é excluído.

Mesmo quando o protocolo é seguido meticulosamente, certas dificuldades técnicas podem surgir. A solução sistemática de problemas pode resolver a maioria delas. Taxas baixas de transmissão germinativa (abaixo de 10%) geralmente indicam má integração do oligonucleotídeo doador ou atividade fraca do gRNA²⁶. Consequentemente, aumentar o oligo doador para 20 ng/µL, estender os braços de homologia para 120–200 pb e reavaliar a clivagem do gRNA (> 50%) pode melhorar a transmissão. Alta mortalidade pós-IM (acima de 30%) frequentemente resulta de pneumotórax, hemorragia e grande infarto²⁷. Assim, manter os camundongos com oxigênio contínuo até despertarem e usar uma placa aquecida para manter a temperatura corporal reduz significativamente as taxas de mortalidade. Se a parede anterior não ficar pálida após a ligadura, provavelmente a artéria descendente anterior (ADA) foi mal identificada ou o ponto está muito superficial. Nesse caso, relocar a ADA (um vaso diagonal vermelho brilhante) e passar novamente a agulha a uma profundidade de 0,5–1 mm, às vezes com auxílio de um microscópio estereoscópico, resolve esse problema. Para qualidade ruim no rastreamento de speckle, baixa taxa de quadros, bordas desfocadas ou artefatos de movimento são as causas mais comuns²⁸. Assim sendo, aumentar a taxa de quadros, ajustar com precisão o ganho, corrigir manualmente o traçado endocárdico e descartar ciclos com arritmias ajudam a resolver o problema.

Além dessas considerações operacionais, o método apresenta limitações claras. O knockout de Cracd é global, de modo que CRACD está ausente em todos os tecidos. Consequentemente, a proteção observada não pode ser atribuída exclusivamente aos cardiomiócitos, já que contribuições sistêmicas também podem desempenhar um papel. Seria necessário um knockout condicional para separar os papéis específicos a cada tipo celular. Outra limitação é o único ponto temporal no dia 7; não se observa nada sobre remodelação crônica. Portanto, pontos temporais posteriores (4 ou 8 semanas) devem ser adicionados para estudos de longo prazo. A reprodutibilidade também é afetada pela dependência da qualidade da imagem: nem todo sistema de ultrassom consegue fornecer bordas endocárdicas nítidas, e a experiência do operador é relevante. Assim, recomenda-se que uma pessoa profissionalmente treinada realize todas as cirurgias e medições.

Diante dessas limitações, é útil comparar nossa abordagem com estratégias alternativas para estudar a função gênica no remodelamento pós-IM. A manipulação genética mediada por AAV e oligonucleotídeos antisense (ASOs) são duas alternativas comuns^29,30. O AAV9 pode promover superexpressão ou silenciamento transitórios e específicos para o coração sem a necessidade de cruzamento, mas suas limitações de empacotamento (~4,7 kb), eficiência variável de transdução e efeitos fora do alvo são desvantagens³¹. Em contraste, nosso modelo de interrupção por CRISPR/Cas9 oferece perda permanente e completa da função, o que é vantajoso para estudos de longo prazo. Os ASOs proporcionam silenciamento reversível e dependente de dose, com início rápido, tornando-os adequados para intervenções agudas; no entanto, exigem administração repetida e não possuem especificidade tecidual³². Portanto, a interrupção constitutiva descrita aqui é a mais indicada para descobertas iniciais e fenotipagem crônica.

Por fim, o protocolo pode ser ampliado para além do CRACD. O mesmo fluxo de trabalho — geração de camundongos knockout por CRISPR/Cas9 combinada com ecocardiografia, imagem de deformação e histologia — pode avaliar qualquer gene candidato no remodelamento pós-IM. A estrutura de fenotipagem também se adapta a outros modelos de doenças cardiovasculares, como constrição aórtica transversa (sobrecarga de pressão) ou lesão por isquemia-reperfusão. Além disso, as amostras de tecido obtidas com este protocolo podem ser utilizadas em análises de multi-ômicas (transcriptômica, proteômica, metabolômica) para revelar mecanismos moleculares. O modelo deficiente em Cracd pode servir como uma ferramenta para testes de fármacos: compostos suspeitos de agir por meio da via CRACD podem ser avaliados. Assim, este protocolo fornece uma plataforma adaptável a uma ampla gama de estudos mecanísticos e translacionais na pesquisa cardiovascular.

Materiais

Lista de materiais utilizados neste artigo

Nome	Empresa	Número de catálogo	Comentários
ACRISPR/Cas9
Solução de Cloreto de Trizma	Sigma-Aldrich, USA	T2663	Utilizada para preparar o tampão de extração de DNA
Protease K	Sigma-Aldrich, USA	539480	Utilizada para digestão da cauda de camundongo
Green Taq Mix	Vazyme, China	P131	Utilizada para amplificação por PCR
Agarose	BioFroxx, Germany	1110GR500	Utilizada para eletroforese em gel de DNA em concentração de 1–2%
Marcador de DNA	Thermo Scientific, USA	SM0242	Utilizado como escada de DNA para determinação do tamanho dos produtos de PCR
Kit TIANamp de DNA Genômico	Tiangen Biotech, China	DP304	Utilizado para extração de DNA genômico a partir de tecido da cauda de camundongo
Kit de transcrição MEGAshortscript™ T7	Thermo Scientific, USA	AM1354	Utilizado para transcrição in vitro de gRNA
Kit de purificação de RNA	Zymo Research, USA	R1016	Utilizado para purificação do gRNA transcrito
Kit de Triagem de sgRNA BeyoCRISPR™	Beyotime, China	D8412S	Utilizado para avaliação in vitro da atividade de clivagem do gRNA
Inibidor de RNase	NEB, USA	M0314	Utilizado para prevenir a degradação do RNA durante a transcrição in vitro
TaKaRa Taq	Takara Bio, Japan	R001A	Utilizado para genotipagem por PCR do DNA da cauda de camundongo
Meio de Pré-incubação de Espermatozoides FERTIUP® para Camundongos: PM	Cosmo Bio, Japan	KYD-002-EX	Utilizado para capacitação espermática antes da fertilização in vitro
Kit T7 ARCA mRNA	NEB, USA	E2060	Utilizado para transcrição in vitro de mRNA de Cas9
Gonadotrofina de Soro de Égua Preñada	MCE, USA	9002-70-4	Utilizada para superovulação, administrada por injeção intraperitoneal
Gonadotrofina Coriônica Humana	ProSpec, Israel	HOR-250	Utilizada para indução da ovulação, administrada por injeção intraperitoneal
Água livre de RNase	Aladdin, China	R665526	Utilizada para dissolução de RNA e preparação de reações de PCR
Primer	Sangon Biotech, China	/	Utilizados para genotipagem
Cirurgia
Isóflurano	RWD Life Science, China	R510-22-10	Utilizado para indução e manutenção da anestesia durante a cirurgia
Creme depilatório	Veet, France	1000207	Aplicado na região torácica para remoção de pelos antes da cirurgia e ultrassonografia
Sutura 7-0	Lingqiao, China	LQ7022380206	Utilizada para ligadura permanente da artéria coronária descendente anterior esquerda (LAD)
Sutura 4-0	Lingqiao, China	LQ4022380412	Utilizada para fechamento da incisão cutânea após a cirurgia
Ventilador anestésico	Harvard Apparatus, USA	Tabletop	Utilizado para administração de isóflurano e suporte respiratório
Ventilador para pequenos animais	Taimeng, China	HX-101E	Utilizado para fornecer ventilação com pressão positiva durante cirurgia torácica aberta
Almofada aquecida com temperatura constante	TigerGene, USA	TG-TP-GS	Utilizada para manter a temperatura corporal do camundongo durante a cirurgia e recuperação
Retrador de costelas	Shenzhen Huayon Biotech, China	LN-18-4101	Utilizado para separar as costelas e expor o coração para ligadura da LAD
Tesoura	Shenzhen Huayon Biotech, China	18-0551	Utilizada para fazer incisões na pele e cortar tecidos
Microsscópio estereoscópico	Nikon, Japan	SMZ 745	Utilizado para fornecer uma visão ampliada durante a cirurgia de ligadura da artéria LAD
Porta-agulha microscópico	Shenzhen Huayon Biotech, China	18-2211	Utilizado para manipular a agulha fina de sutura 7-0 sob o microscópio
Produtos químicos e reagentes
Agentes acoplantes ultrassônicos	Tianjin Jinya Technology Development, China	TM-100	Aplicados no tórax para ecocardiografia, garantem contato adequado da sonda
Paraformaldeído	Sigma-Aldrich, USA	V900894	Utilizado para fixação do tecido cardíaco após a coleta
Xilol	Macklin, China	1330-20-7	Utilizado para remoção de parafina e clareamento do tecido antes da coloração
Hematoxilina	Sigma-Aldrich, USA	H3136	Corante nuclear, utilizado na coloração HE
Eosina	Sigma-Aldrich, USA	E4009	Corante citoplasmático, utilizado na coloração HE
Ponceau S	Sigma-Aldrich, USA	P3504	Utilizado na coloração de Masson para coloração do citoplasma
Ácido fosfomolíbdico	Sigma-Aldrich, USA	221856	Utilizado na coloração de Masson como mordente e para diferenciação
Solução de azul de anilina	Sigma-Aldrich, USA	415049	Utilizada na coloração de Masson para coloração de fibras colágenas (azul)
Anticorpo CRACD	Absea, China	KC-35356	Anticorpo primário para detecção da proteína CRACD por Western Blot, diluição 1:2000
Anticorpo GAPDH	CST, USA	2118S	Anticorpo de controle de carga para Western Blot, diluição 1:5000
Etanol	Macklin, China	64-17-5	Utilizado para desidratação e preparação de reagentes (concentrações de 70%, 80%, 95%, 100%)
Equipamentos de laboratório
Centrifuga Sorvall™ Legend™ Micro 17	Thermo Scientific, USA	75002541	Utilizada para preparação rotineira de amostras
Ciclador térmico de PCR	Bio-Rad Laboratories, USA	1861096	Utilizado para amplificação de DNA
Sistema de microinjeção	Eppendorf, Germany	5193000020	Utilizado para microinjeção de reagentes CRISPR/Cas9 em zigotos
Sistema de imagem Vevo 2100	VisualSonics, Canada	Vevo2100	Sistema de imagem de alta frequência para avaliação não invasiva da função e estrutura cardíaca após infarto
Microsscópio óptico	Leica, Germany	DM2500	Utilizado para observar cortes cardíacos corados com HE e Masson
Software de análise
ImageJ	National Institutes of Health, USA	/	Utilizado para análise de imagens, incluindo medição de área, quantificação de sinal e processamento de imagens histológicas (colorações HE e Masson)
VevoLab 3.2.0 / VevoStrain	VisualSonics, Canada	/	Software VevoLab para análise da função cardíaca; módulo VevoStrain utilizado para análise de deformação miocárdica para avaliação do desempenho cardíaco após infarto
GraphPad Prism 8	GraphPad Software, USA	/	Utilizado para análise estatística e preparação de gráficos