A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Nanoblade-Based Delivery of Nucleic Acid Cargo: A Technique to Deliver Cas9-sgRNA Complex to Target Cells via Virus-Like Particles

3.2K views

July 8th, 2025

In This Article

Abstract

Source: Mangeot, P. E., et al. Delivery of the Cas9/sgRNA Ribonucleoprotein Complex in Immortalized and Primary Cells via Virus-like Particles ("Nanoblades"). J. Vis. Exp. (2021).

This video demonstrates a technique for nanoblade-based delivery of Cas9-sgRNA ribonucleoprotein complex inside target cells for genome editing. Nanoblades are virus-like particles devoid of the ability to multiply and infect neighboring cells, therefore are very useful for rapid and dose-dependent transportation of bio- and nanomaterials.

Protocol

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.

1. sgRNA Design and cloning

NOTE: Guidelines for the design of sgRNAs can be obtained from multiple sources such as https://blog.addgene.org/how-to-design-your-grna-for-crispr-genome-editing or from Hanna and Doench.

  1. Once the 20 nucleotide sgRNA sequences have been designed, order the following single-stranded DNA oligonucleotides:
    1. Forward: 5' caccgNNNNNNNNNNNNNNNNNNNN 3' (N corresponds to the targeted locus without the protospacer-adjacent motif (PAM) sequence)
    2. Reverse: 5' aaacNNNNNNNNNNNNNNNNNNNNc 3' (N correspond to the reverse-complement of the targeted locus without the PAM sequence)
      NOTE: No special modifications are required when ordering the oligonucleotides (no requirement for 5' phosphate).
  2. Hybridize the two DNA oligonucleotides in a 0.2 mL polymerase chain reaction (PCR) tube by mixing 5 µL of annealing buffer (500 mM NaCl; 100 mM Tris-HCl; 100 mM MgCl2; 10 mM DTT; pH 7.9 at 25 °C), 1 µL of each DNA oligonucleotide (100 µM stock solution in water), and 42 µL of water.
  3. On a PCR block, incubate samples at 95 °C for 15 s and then decrease the temperature to 20 °C with a ramp of 0.5 °C/s. Keep at room temperature or store at -20 °C.
    NOTE: The protocol can be paused here.
  4. Digest 10 µg of the BLADE or SUPERBLADE sgRNA expression plasmids with 10 units of BsmBI-v2 restriction enzyme for 3 h at 55 °C in a total reaction volume of 50 µL.
    NOTE: The digested vector should release a DNA insert of ~1.9 kb and a second DNA fragment of ~3.3 kb.
  5. Load the restriction reaction on a 1% agarose gel stained with 5 µg/mL of ethidium bromide (or a safer alternative DNA gel stain).
    NOTE: Wear appropriate protection gear when manipulating ethidium bromide, which is suspected of causing genetic defects.
    1. On an ultraviolet (UV) table set at a wavelength of 312 nm (to avoid damaging the DNA), cut the 3.3 kb DNA fragment from the gel, and place it in a 1.5 mL microcentrifuge tube.
      NOTE: Wear appropriate protection gear (gloves and UV protection goggles) when manipulating ethidium bromide and working on the UV table.
    2. Extract DNA from the sliced gel containing the 3.3 kb DNA fragment using a dedicated DNA gel extraction kit (see the Table of Materials). Quantify the amount of purified DNA using a spectrophotometer.
      NOTE: The protocol can be paused here.
  6. Ligate the hybridized forward and reverse DNA oligonucleotides from step 1.2 to the BsmB1-digested, gel-purified BLADES or SUPERBLADE vector from step 1.5.2. For this, add 2 µL of T4 DNA ligase buffer, 50 ng of the gel-purified vector (from step 1.5.2), 1 µL of the hybridized DNA oligonucleotides (from step 1.2), water to make up the volume to 19 µL, and 1 µL of T4 DNA ligase. Incubate the reaction at 25 °C for 10 min.
    1. Transform the ligation product into competent bacteria (see the Table of Materials). Plate the transformed bacteria on an ampicillin Luria Bertani agar plate and incubate overnight at 37 °C.
    2. Select several isolated colonies on the agar plate to perform DNA minipreparation (see the Table of Materials), and perform Sanger sequencing using a U6 forward primer (5' GACTATCATATGCTTACCGT 3') to check for correct ligation of the sgRNA variable sequence.
      NOTE: Other sgRNA expression plasmids can be used if they do not code for the Cas9 protein, which could interfere with Nanoblade production.

2. Plasmid preparation

  1. Perform maxipreparation (see the Table of Materials) of all required plasmids, and prepare 10 µg aliquots at 1 µg/mL to store at -20 °C. Avoid repeated freeze/thawing cycles of the plasmids; use aliquots twice before discarding them.

3. Nanoblade preparation

  1. On Day 1, seed between 3.5 and 4 × 106 HEK293T cells (see the Table of Materials) in 10 mL of Dulbecco's modified Eagle medium (DMEM) containing high glucose, sodium pyruvate, L-glutamine, 10% fetal bovine serum (FBS), and penicillin/streptomycin in a 10 cm cell culture dish. Move the 10 cm plate gently backward and forward, then from right to left (repeat this sequence 5x) to distribute cells homogeneously over the culture dish. Incubate cells at 37 °C in a cell incubator with 5% CO2.
    NOTE: All procedures related to the handling of cultured cells and Nanoblades should be performed under a cell culture laminar flow hood to avoid their contamination.
  2. Day 2: Plasmid transfection
    1. Cells should be 70-80% confluent 24 h after plating (Figure 1A). Replace the medium with 10 mL of fresh DMEM containing high glucose, sodium pyruvate, L-glutamine, 10% FBS (penicillin and streptomycin can be omitted although it is not mandatory) before transfection.
      NOTE: At this step, it is important that the cells are not confluent. Otherwise, transfection efficiency as well as particle production could be reduced.
    2. For each 10 cm plate, prepare the following quantities of plasmids in a 1.5 mL tube: 0.3 µg pCMV-VSV-G, 0.7 µg pBaEVRless, 2.7 µg MLV Gag/Pol, 1.7 µg BIC-Gag-Cas9, 4.4 µg of BLADES or SUPERBLADES plasmid encoding the cloned sgRNA (or 2.2 µg each if using two sgRNAs).
    3. Add 500 µL of transfection buffer (see the Table of Materials), vortex for 10 s, and then centrifuge for 1 s. Add 20 µL of the transfection reagent (see the Table of Materials), vortex the tube for 1 s, and then centrifuge for 1 s.
    4. Incubate for 10 min at room temperature, and add the entire solution dropwise to the cells in DMEM medium using a P1000 pipettor. Move the 10 cm plate gently backward and forward, then from right to left (repeat this sequence 5x) to uniformly distribute the transfection reagent over the cells. Incubate cells at 37 °C for at least 40 h in a cell incubator with 5% CO2.
      NOTE: If desired, medium can be changed 4 h after transfection.
  3. On Day 3, check the morphology of the transfected cells under the microscope.
    NOTE: Producer cells will begin to fuse. This is a normal occurrence due to the expression of fusogenic viral envelopes (Figure 1B,C).
  4. Day 4: Harvesting Nanoblades
    NOTE: At least 40 h after transfection, the cells would have fused together because of expression of the fusogenic viral envelopes, and sometimes, the cells are completely detached from the plate support (Figure 1D).
    1. Collect 9 mL of the culture medium supernatant using a 10 mL pipette.
      NOTE: Nanoblades are VLPs capable of delivering the Cas9 protein and its associated sgRNA into primary cells and in vivo. Although they are not considered genetically modified organisms as they are devoid of genetic material, they can induce genetic changes. Therefore, they must be manipulated with caution to avoid any contact with users (especially if they are programmed to target tumor suppressor genes). Users are advised to follow their local safety guidelines for the manipulation of retroviral vectors and work in a BSL-2 level laboratory when preparing VLPs and performing transduction experiments. Nanoblades can be inactivated with 70% ethanol or 0.5% of sodium hypochlorite. It is also advisable to treat all plastic waste (pipette tips, tissue culture plates, centrifugation tubes) with 0.5% sodium hypochlorite for at least 10 min to inactivate the Nanoblades.
    2. Centrifuge the collected supernatant at 500 × g for 5 min to remove cellular debris and recover the supernatant without disturbing the cell pellet.
      NOTE: If Nanoblades are meant to be used on primary cells, filter the supernatant using a 0.45 µm or 0.8 µm filter. Be aware that this step drastically reduces the Nanoblade titer as a significant fraction will be blocked in the filter membrane.
    3. Pellet the Nanoblades overnight (12-16 h) in a swinging bucket rotor at 4,300 × g or at 209,490 × g in an ultracentrifuge for 75 min at 4 °C (see the Table of Materials).
      NOTE: If target cells can grow in DMEM, it is possible to incubate them directly with the supernatant obtained after step 3.4.2 without concentrating the Nanoblades.
  5. Day 5: Resuspension and storage of Nanoblades
    1. After centrifugation, slowly aspirate the medium and resuspend the white pellet with 100 µL of cold 1x phosphate-buffered saline (PBS). Cover the tube with parafilm, and incubate for 1 h at 4 °C with gentle agitation before resuspending the pellet by pipetting up and down.
      NOTE: A white viscous material may appear upon resuspension; this is normal and does not significantly affect the efficiency of transduction.
    2. Store the Nanoblades at 4 °C if planning on using them within four weeks. Otherwise, snap-freeze the Nanoblades in liquid nitrogen and store them at -80 °C.
      NOTE: Wear protection goggles and cryogenic gloves when manipulating liquid nitrogen. Snap-freezing and storage at -80 °C leads to a significant decrease in Nanoblade efficiency. Moreover, thawed Nanoblades should not be frozen again. The protocol can be paused here.

4. Concentration of Nanoblades on a sucrose-cushion

NOTE: As an alternative to overnight centrifugation or ultracentrifugation (step 3.4.3), the Nanoblades can be concentrated on a sucrose cushion. This yields a purer fraction of Nanoblades, although the total amount recovered will be lower.

  1. Prepare a 10% sucrose solution (weight to volume) in 1x PBS, and filter it through a 0.2 µm syringe filter (see the Table of Materials).
  2. Begin the process of concentrating the Nanoblades on the sucrose cushion.
    1. Place 9 mL of VLP-containing sample (from step 3.4.3) into an ultracentrifuge tube (see the Table of Materials). Using a 3 mL syringe and cannula, slowly layer 2.5 mL of the 10% sucrose under the sample, trying not to mix the VLP-containing sample and the sucrose solution.
    2. Alternatively, place 2.5 mL of 10% sucrose into an ultracentrifuge tube (see the Table of Materials). Tilt the tube and slowly add the 9 mL of VLP-containing sample (from step 3.4.3) with a low-speed pipettor. During this operation, progressively raise the tube to a vertical position.
  3. Centrifuge the samples at 209,490 × g in an ultracentrifuge for 90 min at 4 °C.
    NOTE: This technique can be adapted for low-speed centrifugation (4,300 × g) overnight.
  4. After centrifugation, remove the supernatant carefully and place the tube upside down on tissue paper to remove any remaining liquid. After 1 min, add 100 µL of 1x PBS and place the tube at 4 °C with a parafilm cover in a tube holder on an agitation table for 1 h (see the Table of Materials) before resuspending the pellet by pipetting up and down.
    NOTE: The protocol can be paused here.

5. Monitoring Cas9 loading within Nanoblades by dot-blot

  1. Prepare the dilution buffer by adding 1 volume of lysis buffer containing a non-ionic surfactant (see the Table of Materials) in 4 volumes of 1x PBS. Dilute 2 µL of concentrated Nanoblades in 50 µL of dilution buffer, vortex briefly, and transfer 25 µL of this mixture into a new tube containing 25 µL of dilution buffer. Repeat this operation to have 4 tubes of Nanoblade dilutions (2-fold dilution steps).
  2. For the standard controls, dilute 2 µL of recombinant Cas9 nuclease (see the Table of Materials) into 50 µL of dilution buffer, vortex briefly, and proceed to make eight serial dilutions (2-fold dilution for each step).
  3. Carefully spot 2.5 µL of each VLP dilution and 2.5 µL of each standard onto a nitrocellulose membrane with a multichannel pipet (a larger volume may result in overlapping spots).
    NOTE: A methanol-treated polyvinyldifluoride membrane may also be used.
  4. Once the particles are absorbed onto the membrane, block the membrane with 1x Tris-buffered saline containing a non-ionic surfactant (TBS-T) supplemented with non-fat dry-milk (5% w/v) for 45 min at room temperature.
    NOTE: The protocol can be paused here, and the membrane stored at 4 °C in 1x TBS-T.
  5. Discard the 1x TBST supplemented with non-fat dry-milk, and incubate the membrane overnight at 4 °C with the Cas9-horseradish peroxidase antibody (1/1000 dilution in 1x TBST, 5% milk). Wash the membrane 3x with TBS-T, and visualize the signal using an enhanced chemiluminescent substrate kit.
  6. Quantify the dot intensity for the Nanoblades and recombinant Cas9 standard dilutions using the proprietary software provided with the gel imaging station or imageJ. Define a linear curve linking dot intensity to the Cas9 concentration. Using the function of the obtained curve, extrapolate the Cas9 content in each preparation.
    NOTE: The amount of recombinant Cas9 protein control can saturate the reading for the most concentrated samples of the standard dilution set (Figure 2). It is therefore advised, when defining the linear curve, to remove the reading from the undiluted samples (and sometimes that of the first dilution steps) if they are not in the linear range with respect to the known concentration of Cas9 that was spotted. Similarly, when extrapolating the amount of Cas9 within the Nanoblade samples, only use the readings that are within the linear range of the standard curve.

6. Transduction of target cells with Nanoblades (procedure for transduction in a 12-well plate)

  1. In a 12-well plate, seed 100,000-200,000 cells (either primary or immortalized adherent cells) per well in 1 mL of the appropriate cell culture medium. Allow the cells to adhere to the plate surface before transduction.
  2. In a 1.5 mL microcentrifuge tube, add 5-20 µL of concentrated Nanoblades (from step 3.5.1 or 4.4) to 500 µL of cell culture medium, and mix by pipetting up and down with a P1000 pipettor. Remove the medium from cells, and replace it with the 500 µL of this Nanoblade mixture.
    NOTE: Transduction must be optimized for each cell type. It is important to use the smallest possible volume of medium (while avoiding drying of the target cells) so that the Nanoblades remain highly concentrated. Adherent cells must be transduced directly while attached to the plate (do not transduce in suspension as this will significantly decrease transduction efficiency). Some cells tolerate prolonged exposure to Nanoblades (24-48 h) while others are very sensitive and may form small syncytia. In this case, Nanoblades must be incubated with cells only for 4-6 h before replacing the medium. Spinoculation can also improve transduction for cells grown in suspension. Adjuvants such as cationic polymers (see the Table of Materials) can also improve transduction efficiency in some cell types.
  3. After 4-6 h of cell incubation in a low volume of medium containing Nanoblades, increase the volume of medium to the normal amount (1 mL if working with a 12-well plate), or replace it with fresh medium if the cells are sensitive to VLPs.
    NOTE: Cell medium containing Nanoblades must be inactivated with 0.5% sodium hypochlorite for 10 min before discarding it. Use gloves and protective goggles when manipulating sodium hypochlorite. If Nanoblades induce cell death, adapt the amount and total time of exposure to reduce cell mortality.

Access restricted. Please log in or start a trial to view this content.

Results

Cell morphology changes in microscopy images showing cellular response in experiments A to D, 400μm scale.
Figure 1: Morphology of producer cells during Nanoblade production. (A) HEK293T cells at 70-80% confluence 24 h after plating. (B and C) HEK293T cell morphology 24 h after transfection. (<...

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest declared.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
13.2 mL, Thinwall Polypropylene Tubes, 14 x 89 mm - 50PkBeckman Coulter Life Sciences331372Ultracentrifugation tubes for Nanoblades purification
Amersham Protran Premium Western blotting membranes, nitrocelluloseMerckGE10600004Nitrocellulose membrane for quantifying Cas9 levels within purified Nanoblades
BIC-Gag-CAS9Addgene119942Encodes a GAG (F-MLV)-CAS9(sp) fusion. Allows the production of GAG-CAS9 Virus like particles from producer cells in association with over expressed gRNA(s) and appropriate envelopes
BICstim-Gag-dCAS9-VPRAddgene120922Encodes a GAG-dCAS9-VPR fusion for targeted transcriptional activation
BLADEAddgene134912Empty backbone for cloning sgRNA sequence to be used in Nanoblades system
BsmBI-v2New England BiolabsR0739SRestriction enzyme to digest the BLADE and SUPERBLADES vectors for sgRNA cloning
Cas9 (7A9-3A3) Mouse mAb (HRP Conjugate) #97982Cell Signaling Technology97982SAnti-Cas9 antibody for Cas9 quantification by dot-blot
Cas9 Nuclease, S. pyogenesNew England BiolabsM0386TRecombinant Cas9 protein to be used as a reference for absolute quantification of the amount of Cas9 loaded within Nanoblades
Ethidium bromide solution (10 mg/mL in H2O)Sigma-AldrichE1510-10MLFor staining agarose gels and visualize DNA
Fisherbrand Wave Motion ShakersFisher Scientific88-861-028Agitation table to resuspend Nanoblades upon centrifugation
gelAnalyzerhttp://www.gelanalyzer.com; quantifying band intensity after digestion
Gesicle Producer 293TTakara632617Nanoblades producer cell line
Gibco DMEM, high glucose, pyruvateThermoFisher Scientific41966052Cell culture medium for Gesicle Producer 293T cells
jetPRIME Transfection Reagent kit for DNA and DNA/siRNAPolyplusPOL114-15Transfection reagent for Nanoblade production in Gesicle Producer 293T cells
Millex-AA, 0.80 &micro;m, syringe filterMilliporeSLAA033SSSyringe filter to remove cellular debris before concentration of Nanoblades
Millex-GS, 0.22 &micro;m, syringe filterMilliporeSLGS033SSSyringe filter to sterilise the sucrose cushion solution
Millex-HP, 0.45 &micro;m, polyethersulfone, syringe filterMilliporeSLHP033RSSyringe filter to remove cellular debris before Nanoblades concentration
Monarch DNA Gel Extraction KitNew England BiolabsT1020LDNA gel extraction kit for purification of the pBLADES or pSUPERBLADES plasmid fragment upon digestion with BsmBI
NEB Stable Competent E. coli (High Efficiency)New England BiolabsC3040ICompetent bacteria for plasmid transformation and amplification
NucleoBond Xtra Midi kit for transfection-grade plasmid DNAMacherey-Nagel740410.5Maxipreparation kit for purification of plasmid DNA from cultured bacteria
Nucleospin gDNA extraction kitMacherey-Nagel740952.5Extraction of genomic DNA from transduced cells
NucleoSpin Plasmid, Mini kit for plasmid DNAMacherey-Nagel740588.5Minipreparation kit for purification of plasmid DNA from cultured bacteria
NucleoSpin Tissue, Mini kit for DNA from cells and tissueMacherey-Nagel740952.5Genomic DNA extraction kit
Optima XE-90Beckman Coulter Life SciencesA94471Ultracentrifuge
pBaEVRlessEls Verhoeyen (Inserm U1111)Personnal requests have to be sent to: els.verhoyen@ens-lyon.frBaboon Endogenous retrovirus Rless glycoprotein described in Girard-Gagnepain, A. et al. Baboon envelope pseudotyped LVs outperform VSV-G-LVs for gene transfer into early-cytokine-stimulated and resting HSCs. Blood 124, 1221&ndash;1231 (2014)
pBS-CMV-gagpolAddgene35614Enocdes the Murine Leukemia Virus gag and pol genes
pCMV-VSV-GAddgene8454Envelope protein for producing lentiviral and MuLV retroviral particles
Phosphate-Buffered Saline (PBS)ThermoFisher Scientific1420009110X PBS to dilute in millipore water
Polybrene Transfection ReagentMillipore SigmaTR-1003-GCationic polymer that enhances the efficiency of retroviral transduction in specific mammalian cells. It can also allow viral-dependent entry of an Oligodeoxynucleotide (ODN) for homology-directed repair
Sucrose,for molecular biology, &ge;99.5% (GC)Sigma-AldrichS0389-5KGSucrose to prepare a cushion for Nanoblade purification through ultracentrifugation
SUPERBLADE5Addgene134913Empty backbone for cloning sgRNA sequence to be used in nanoblades system (Optimized for increased genome editing efficiency via Chen B et al., 2013)
SuperSignal West Dura Extended Duration SubstrateThermoFisher Scientific34076Enhanced chemiluminescence (ECL) HRP substrate for Cas9 dot blots
SW 41 Ti Swinging-Bucket RotorBeckman Coulter Life Sciences331362Rotor for ultracentrifugation
SYBR Safe DNA Gel StainThermoFisher ScientificS33102Alternative to ethidium bromide for staining agarose gels and visualize DNA
T4 DNA LigaseNew England BiolabsM0202SDNA ligase to ligate the BLADE or SUPERBLADES vectors with the duplexed DNA oligos corresponding to the variable region of the sgRNA
Triton-containing lysis bufferPromegaE291ALysis buffer to disrupt Nanoblades and allow Cas9 quantification
TWEEN 20Sigma-AldrichP9416For the preparation of TBST

Tags

Nanoblade DeliveryGenome Editing TechniqueRetroviral CoreLipid Bilayer MembraneTransmembrane DomainGlycoprotein Surface DomainHost Cell FusionCytoplasmic Release