Cell Aggregation Assay to Detect Trans Interactions between Cell Adhesion Molecules

Abstract

Source: Restrepo, S., et al., Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System. J. Vis. Exp. (2020)

In this video, we demonstrate the technique to measure transcellular interactions between synaptic cell adhesion molecules through the HEK cell aggregation assay. In this assay, an equal number of HEK cells expressing a desired presynaptic cell adhesion molecule and a fluorescent protein are mixed with HEK cells expressing a post-synaptic cell adhesion molecule and another fluorescent protein. The interaction between the cell adhesion molecules forces the cells to aggregate, which can be measured by fluorescence microscopy.

Protocol

1. Cell culture and transfection

1. Make HEK cell media with DMEM, 1x (Dulbecco's Modification of Eagle's Medium) supplemented with 4.5 g/L glucose, L-glutamine & sodium pyruvate, and 10% FBS. Sterile filter.
2. Predetermine suitable ligands and receptors for aggregation assay.
   NOTE: Neurexin3α SS4+/- and one of its known ligands, LRRTM2, were used in this study. Ligands and receptors of interest were expressed from cDNAs in pcDNA3.1. A Gibson assembly was used to insert Neurexin3α into pcDNA3.1. Neurexin3α F/R:
   TTTAAACTTAAGCTTGGTACCGAGCTCGGATCCGCCACCATGAGCTTTACCCTCCACTC/
   GAGCGGCCGCCACTGTGCTGGATATCTGCAGAATTCTTACACATAATACTCCTTGTCCTT.
3. Prepare HEK293T cells.
   1. Grow HEK293T cells to confluency in one T-75 flask.
   2. Once confluent, use 2 mL of trypsin and place in a 37 °C incubator for 2 min. Add 6 mL of HEK media to the flask to resuspend cells and transfer all 8 mL to a 15 mL conical tube.
   3. Pellet at 500 x g for 5 min and resuspend in HEK cell media for a total of 8 mL.
   4. Count cells and add 735,000 cells into each well of a 6-well plate. Adjust the final volume to 2 mL for each well using HEK cell media.
   5. Place in a 37 °C incubator and allow cells to grow overnight or until they reach 50-60% confluency.
4. Transfect HEK293T cells using the calcium phosphate method.
   1. Transfect well-1 with 3 µg of the protein of interest and co-transfect with 1 µg of fluorescent protein (3 µg of pcDNA3.1-Neurexin3α^WT SS4- and 1 µg of mCherry).
   2. Transfect well-2 as in step 1.4.1. but with the mutated protein of interest (pcDNA3.1-Neurexin3α^A687T SS4-).
   3. Transfect well-3 with 3 µg of the ligand of interest and co-transfect with 1 µg of another fluorescent protein (3 µg of pcDNA3.1 LRRTM2 and 1 µg of GFP).
   4. Transfect well-4 and well-5 to serve as negative controls: well-4 with 1 µg of GFP and well-5 with 1 µg of mCherry.
   5. Prepare another plate (as in steps 1.4.1-1.4.4) if requiring additional conditions or controls (Neurexin3α^WT/A687T SS4+).
      NOTE: Transfection efficiency is analyzed 24 h after transfection under an epifluorescence microscope and quantified as the number of cells expressing the fluorescent protein they were transfected with. A more streamlined approach would include the transfection of HEK cells with a bicistronic vector coding for a fluorescent protein and the ligand of interest and is highly recommended above co-transfection. In the case of this study, alpha Neurexins are ~4.3 kb and low fluorescence intensity was observed using a bicistronic system necessitating co-transfection.
5. 48 hours after transfection, harvest cells for aggregation.
   1. Wash each well twice with PBS.
   2. Add 1 mL of 10 mM EDTA in PBS into each well to gently dissociate cell-to-cell interactions and incubate the plate at 37 °C for 5 min.
      NOTE: Trypsin is not recommended for step 1.5.b due to the potential proteolytic cleavage of adhesion molecules in the study. Additionally, after EDTA addition the protocol may not be stopped until completion as cells will now be exposed to ambient conditions.
   3. Gently tap the plate to detach the cells, and harvest each well into separate 15 mL conical tubes.
   4. Centrifuge conical tubes at 500 x g and room temperature for 5 min.
6. While cells are pelleting, prepare 6 incubation tubes by labeling the top of each microcentrifuge tube with each condition.
   NOTE: Each permutation of GFP and mCherry conditions should be used to encompass all experimental conditions and proper controls. For example: 1. GFP/mCherry, 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3α^WT SS4-—mCherry, 4. GFP/Neurexin3α^A687T SS4- –mCherry, 5. Neurexin3α^WT SS4-—mCherry/LRRTM2—GFP, 6. Neurexin3α^A687T SS4- –mCherry/LRRTM2—GFP. Make additional tubes to accommodate further conditions and controls.
7. Remove the supernatant and resuspend cells in 500 µL of HEK media with 10 mM CaCl₂ and 10 mM MgCl₂ warmed to 37 °C.
   NOTE: The addition of CaCl₂ and MgCl₂ allows adhesion molecules to reestablish binding and is only required if the transcellular interaction partners in question require divalent cations for adhesion.
8. Count the cells in each 15 mL conical tube using a hemocytometer and aliquot 200,000 cells of each condition into an appropriate tube from step 1.6 for a 1:1 mix in a total volume of 500 µL.
   NOTE: It should only take 5 min per condition to count and aliquot amounts.
9. Incubate tubes at room temperature in a slow tube rotator.

2. Image acquisition

1. Optimize microscope acquisition parameters for specific samples. In this example, images were taken on a wide-field microscope. Use a 5x air objective (NA: 0.15; WD: 20000 μm) to get a large enough field for analysis.
2. Assess baseline aggregation immediately after mixing the two conditions of HEK cells in step 1.8. These are now the 'time zero' images.
   1. Pipette 40 µL of each sample mixture onto a charged microscope slide and image under fluorescence in both the 488 and 561 channels.
   2. Acquire three different fields of view at one focus plane per sample drop.
3. Acquire final images at 60 min as the 'time 60' image.
   1. To obtain the 'time 60' image of the mixture after a 60 min incubation, take another 40 µL sample of each condition from rotating tubes and pipette each sample onto a charged slide. Image as in step 2.2.
      NOTE: Cell aggregation should be checked every 15 min until saturation occurs. The timing of aggregation will depend on the proteins being tested.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
5 mL disposable microtubes with snap caps	VWR	89000-028	Incubation of mixed population of HEK cells
1000 mL Rapid—Flow Filter Unit, 0.2 um aPES membrane	Thermo Fisher	567-0020	Sterilization of HEK media
15 mL SpectraTube centrifuge tubes	Ward’s Science	470224-998	Harvesting HEK cells
6-well sterile tissue culture plates	VWR	100062-892	Culturing HEK cells
Calcium Chloride	Sigma	223506-500G	Calcium phosphate transfection, HEK cell resuspension
Centrifuge - Sorvall Legend RT	Kendro Laboratory Products	75004377	Harvesting HEK cells
CO2 cell incubator	Thermo Scientific	HERACELL 150i	Incubation of HEK cells during growth
DMEM, 1x (Dulbecco's Modification of Eagle's Medium) with 4.5 g/L glucose, L-glutamine & sodium pyruvate	Corning	10-013-CV	HEK cell maintenance
Dulbecco’s Phosphate-Buffered Saline PBS (1X)	Gibco	14190-144	Passaging/harvesting HEK cell
Ethylenediaminetetraacetic acid	Sigma	ED-500G	Harvesting HEK cells
Falcon Vented culture flasks, 75cm2 growth area	Corning	9381M26	Culturing HEK cells
Fetal Bovine Serum	Sigma	17L184	HEK cell maintenance
HEK293T cells	ATCC		Model system
ImageJ	NIH	V: 2.0.0-rc-69/1.52p	Image analysis
Magnesium Chloride hexahydrate	Sigma	M9272-500G	HEK cell resuspension
Sodium phosphate dibasic anhydrous	Fisher BioReagents	BP332-500	Calcium phosphate transfection
Tube rotator			Incubation of mixed population of HEK cells
UltraClear Microscope slides. White Frosted, Positive Charged	Denville Scientific Inc.	M1021	Image acquisition
Wide-field microscope	Zeiss	Axio Vert 200M	Image acquisition