Method Article

Chromatin Immunoprecipitation to Identify Target Protein Binding Sites on Genomic DNA

1.3K views

July 8th, 2025

In This Article

Abstract

Source: Dong, X., et.al., Identifying Transcription Factor Olig2 Genomic Binding Sites in Acutely Purified PDGFRα+ Cells by Low-cell Chromatin Immunoprecipitation Sequencing Analysis. J. Vis. Exp. (2018)

In this video, we demonstrate the chromatin immunoprecipitation technique to identify protein binding sites on specific regions of the genomic DNA of oligodendrocyte precursor cells via the selective immunoprecipitation of protein-bound chromatin fragments. This method helps to study the interaction of several regulatory proteins, including transcription factors involved in gene regulation.

Protocol

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.

1. Purification of PDGFRα Positive Oligodendrocyte Lineage Cells from Mouse Brain (modified from previously described immunopanning protocols)

  1. Preparation of an immunopanning plate for PDGFRα positive cell selection and 2 plates for the depletion of endothelial cells and microglia.
    NOTE: Please note that Petri dishes but not cell culture dishes work for immunopanning experiment; if the purified cells will be used for cu....

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest declared.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Reagent/ Equipment
Banderiaea simplicifolia lectin 1Vector Laboratories# L-1100
Rat anti-PDGFRa antibodyBD Bioscience# 558774
Neural tissue dissociation Kit (P)MACS Miltenyi Biotec# 130-092-628
AccutaseSTEMCELL technologies# 07920
TRIzolThermo Fisher# 15596026
Anti-NG2 Chondroitin Sulfate Proteoglycan AntibodyMillipore# AB5320
Bioruptor Pico sonication deviceDiagenode# B01060001
True MicroChIP kitDiagenode# C01010130
Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v)Thermo Fisher# 15593031
NucleoSpin Gel and PCR Clean-Up kitMACHEREY-NAGEL# 740609
Quant-iT PicoGreen dsDNA Assay KitThermo Fisher# P11496
DNA SMART ChIP-Seq kitClontech Laboratories# 634865
Agencourt AMPure XPBeckman Voulter# A63880
GlycoBlueThermo Fisher# AM9516
Pico-greenThermo Fisher# P11496
D-PBSThermo Fisher# 14190-144
SYBR Green master mixBio-Rad Laboratories# 1725124
DMEM/F12Fisher Scientific# 11-320-033
Penicillin-Streptomycin (P/S)Fisher Scientific# 15140122
N-2 SupplementFisher Scientific# 17502048
B-27 SupplementFisher Scientific# 17504044
InsulinSigma# I6634Prepare 0.5 mg/ml insulin solution by dissolving 5 mg insulin in 10 ml water and 50 μl of 1 N HCl.
Bovine Serum Albumin, suitable for cell culture (BSA)Sigma# A4161Prepare 4% BSA solution by dissolving 4 g BSA in 100 ml D-PBS and adjust the pH to 7.4
Fibroblast Growth Factor basic Protein, Human recombinant (bFGF)EMD Millipore# GF003
HUMAN PDGF-AAVWR# 102061-188
Poly-D-lysineVWR# IC15017510Prepare 1 mg/ml poly-D-lysine solution by dissolving 10 mg poly-D-lysine in 10 ml water and dilute 100 times when using.
Falcon Disposable Petri Dishes, Sterile, Corning, 100x15mmVWR# 25373-100
Falcon Disposable Petri Dishes, Sterile, Corning, 150x15mmVWR# 25373-187
HBSS, 10X, no Calcium, no Magnesium, no Phenol RedFisher Scientific# 14185-052
Trypan BlueStemcell Technologies# 07050
Protease inhibitor cocktailSigma# 11697498001
Primer names used for qPCRPrimer sequences used for qPCR
Mbp-F:CTATAAATCGGCTCACAAGG
Mbp-R:AGGCGGTTATATTAAGAAGC
Iba1-F:ACTGCCAGCCTAAGACAACC
Iba1-R:GCTTTTCCTCCCTGCAAATCC
Mog-F:GGCTTCTTGGAGGAAGGGAC
Mog-R:TGAATTGTCCTGCATAGCTGC
GAPDH-FATGACATCAAGAAGGTGGTG
GAPDH-RCATACCAGGAAATGAGCTTG
Tuj1-FTTTTCGTCTCTAGCCGCGTG
Tuj1-RGATGACCTCCCAGAACTTGGC
PDGFRα-FAGAGTTACACGTTTGAGCTGTC
PDGFRα-RGTCCCTCCACGGTACTCCT

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Oligodendrocyte Precursor CellsProtein DNA BindingTranscription Factor Olig2Chromatin ShearingAntibody ImmunoprecipitationMagnetic Bead SeparationDNA Fragment AmplificationGenomic Sequence AnalysisLow cell ChIP

Related Articles