Differentiating Engineered Human Induced Pluripotent Stem Cells into Functional Motor Neurons

Abstract

Source: Garone, M. G., et al. Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors. J. Vis. Exp. (2019).

This video showcases the process of differentiating human iPSCs into motor neurons. The rationale involves utilizing iPSCs that have been genetically modified to express specific transcription factors. When cultured in a media containing doxycycline, this antibiotic triggers the expression of transcription factors, thereby promoting iPSC differentiation into motor neuron progenitors. Ultimately, the progenitors are cultured in a neuronal medium to yield mature and functional motor neurons.

Protocol

1. Maintenance of Human iPSCs

1. Preparation of matrix-coated plates
   1. Thaw one 5 mL vial of matrix (see Table of Materials) at 4 °C overnight. The original matrix stocks come at different stock concentrations, and aliquots are made according to the dilution factor indicated on the datasheet and are specific for the individual lot. It is crucial to keep the vial and tubes ice cold to prevent premature gelling of the matrix. Dispense matrix into aliquots in pre-chilled cryotubes on ice. Freeze unused aliquots at -20 °C.
   2. Place one aliquot on ice for about 2 h to thaw.
   3. Dilute the aliquot of the matrix with 20 mL of cold DMEM/F12 in a 50 mL conical tube.
   4. Mix well and dispense 1 mL of diluted matrix into 35 mm dishes (equivalent amounts per surface area of other dishes).
   5. Keep the dishes containing diluted matrix for 1 h at room temperature to allow coating.
      NOTE: Dishes, sealed with parafilm, can be stored at 4 °C for up to 2 weeks.
2. Preparation of the stock solution (20 mL) and 1x working aliquots of the gentle cell dissociation reagent (see Table of Materials).
   1. Dissolve powder to 10 mg/mL in PBS (Ca²⁺/Mg²⁺ free)
   2. Filter sterilize through a 0.22 μm filter membrane.
   3. Prepare 20 aliquots (1 mL each) and store them at -20 °C.
   4. Before use, dilute one aliquot in PBS (Ca²⁺/Mg²⁺ free) to 1 mg/mL (1x working aliquots).
      NOTE: 1x working aliquots can be stored at 4 °C for 2 weeks.
3. Passaging human iPSCs.
   1. Before starting: If stored at 4 °C, pre-warm matrix-coated plates in the incubator at 37 °C for 20-30 min. Pre-warm at room temperature the amount of human iPSC medium (see Table of Materials) needed. Pre-warm the DMEM/F12.
   2. Aspirate culture medium.
   3. Rinse iPSCs with PBS (Ca²⁺/Mg²⁺ free).
   4. Add 1x gentle dissociation solution (0.5 mL for a 35 mm dish). Incubate at 37 °C until the edges of the colonies begin to detach from the plate, usually 3-5 min.
   5. Aspirate the gentle dissociation solution, being careful not to detach iPSC colonies.
   6. Wash the cells with DMEM/F12 (2 mL for a 35 mm dish) and aspirate, being careful not to detach the cells. Repeat this step one more time.
   7. Add human iPSC medium (1 mL for a 35 mm dish).
   8. Gently detach the colonies with a cell lifter and transfer them to a 15 mL tube.
   9. Gently break cell clumps by pipetting up and down with a P1000 pipettor 3-4 times.
   10. Aspirate the supernatant from the matrix-coated plate(s).
   11. Seed the cells in the appropriate culture volume of the human iPSC medium. The split ratio can vary from line to line and is about 1:4-1:8. Change the medium daily.   

2. Generation of NIL and NIP Inducible iPSC Lines

1. Cell transfection
   1. Rinse the cells with PBS (Ca²⁺/Mg²⁺ free).
   2. Add cell dissociation reagent (see Table of Materials) (0.35 mL for a 35 mm dish) and incubate at 37 °C until single cells are separated (5-10 min).
   3. Gently complete cell separation by pipetting up and down with a P1000 pipettor 3-4 times.
   4. Collect in a 15 mL tube and add PBS (Ca²⁺/Mg²⁺ free) to 10 mL. Count the cells.
   5. Pellet 10⁶ cells and resuspend in 100 μl of Buffer R (included in the cell electroporation kit; see Table of Materials).
   6. Add plasmid DNA for transfection: 4.5 μg of transposable vector (epB-Bsd-TT-NIL or epB-Bsd-TT-NIP12) and 0.5 μg of the piggyBac transposase plasmid.
   7. Transfect with the cell electroporation system (see Table of Materials) according to the manufacturer's instructions and as previously described with the following parameters: 1,200 V voltage, 30 ms width, 1 pulse. Seed the cells in a human iPSC medium supplemented with 10 μM Y-27632 (ROCK inhibitor, see Table of Materials) in a 6 mm matrix-coated dish.
2. Selection with antibiotics
   1. Two days after transfection, add 5 μg/mL blasticidin to the culture medium.
   2. Most non-transfected cells will die within 48 h of blasticidin selection. Keep the cells in blasticidin for at least 7-10 days to counter-select the cells that have not integrated the transgenes in the genome.
   3. Maintain stably transfected cells as a mixed population, composed of cells with different numbers of transgenes and different integration sites, or isolate single clones.
   4. Prepare an additional dish to check for effective expression of the transgenes upon 1 μg/mL doxycycline induction by RT-PCR with transgene-specific primers for Ngn2 (Forward: TATGCACCTCACCTCCCCATAG; Reverse: GAAGGGAGGAGGGCTCGACT).
   5. At this stage, freeze stocks of the novel NIL- and NIP-iPSC lines in a freezing medium for human iPSCs (see Table of Materials).

3. Motor Neuron Differentiation

1. Dissociate the cells with cell dissociation reagent as described (steps 2.1.1.-2.1.3.). Collect dissociated cells in a 15 mL tube and dilute with 5 volumes of DMEM/F12. Pellet the cells and resuspend in a human iPSC medium supplemented with 10 μM ROCK inhibitor. Count the cells and seed on matrix-coated dishes at a density of 62,500 cells/cm².
2. The following day, replace the medium with DMEM/F12, supplemented with 1x stable L-glutamine analog, 1x non-essential amino acid (NEAA) cell culture supplement and 0.5x penicillin/streptomycin, containing 1 μg/mL doxycycline. This is considered as day 0 of differentiation. On day 1, refresh the medium and doxycycline.
3. On day 2, change the medium to Neurobasal/B27 medium (Neurobasal Medium supplemented with 1x B27, 1x stable L-glutamine analog, 1x NEAA and 0.5x penicillin/streptomycin), containing 5 μM DAPT, 4 μM SU5402, and 1 μg/mL doxycycline (see Table of Materials). Refresh the medium and doxycycline every day until day 5.
4. Day 5: Cells dissociation with cell dissociation reagent (see Table of Materials).
   1. Rinse the cells with PBS (Ca²⁺/Mg²⁺ free).
   2. Add cell dissociation reagent (0.35 mL for a 35 mm dish) and incubate at 37 °C until the entire cell monolayer separates from the dish.
      NOTE that single cells will not be separated during incubation.
   3. Add 1 mL of DMEM/F12 and collect the cells in a 15 mL tube.
   4. Gently complete cell separation by pipetting up and down with a P1000 pipettor 10-15 times.
   5. Add 4 mL of DMEM/F12 and count the cells.
   6. At this stage, freeze motor neuron progenitors in a cell freezing medium (see Table of Materials), according to manufacturer instructions.
   7. Pellet the cells and resuspend in Neuronal Medium (Neurobasal/B27 medium supplemented with 20 ng/mL BDNF, 10 ng/mL GDNF, and 200 ng/mL L-ascorbic acid, see Table of Materials) supplemented with 10 μM ROCK inhibitor.
   8. Seed the cells on poly-ornithine/laminin- or alternatively on matrix-coated supports at 100,000 cells/cm² density. Use μ-Slide plastic supports with polymer coverslip (see Table of Materials) for immunostaining analysis.
5. On day 6, change the medium to fresh Neuronal Medium devoid of ROCK inhibitor. In the following days, refresh half of the medium every 3 days. The culture medium must be changed very carefully to prevent detachment from the surface.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Accutase	Sigma-Aldrich	A6964-100ML	Cell dissociation reagent
B27	Miltenyi Biotec	130-093-566	Serum free supplement for neuronal cell maintenance
Bambanker	Nippon Genetics	NGE-BB02	Cell freezing medium, used here for motor neuron progenitors
BDNF	PreproTech	450-02	Brain-Derived Neurotrophic Factor
Blasticidin	Sigma-Aldrich	203350	Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSA	Sigma-Aldrich	A2153	Bovine Serum Albumin. Blocking agent to prevent non- specific binding of antibodies in immunostaining assays
CaCl2	Sigma-Aldrich	C3881	chemicals for electrophysiological solutions
Corning Matrigel hESC-qualified Matrix	Corning	354277	chemicals for electrophysiological solutions
CRYOSTEM ACF FREEZING MEDIA	Biological Industries	05-710-1E	Freezing medium for human iPSCs
D-Glucose	Sigma-Aldrich	G5146	chemicals for electrophysiological solutions
DAPT	AdipoGen	AG-CR1-0016-M005	Gamma secretase inhibitor
Dispase	Gibco	17105-041	Reagent for gentle dissociation of human iPSCs
DMEM/F12	Sigma-Aldrich	D6421-500ML	Basal medium for cell culture
Doxycycline	Sigma-Aldrich	D9891-1G	Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U	WiCell	UWWC1-DS2U	Commercial human iPSC line
GDNF	PreproTech	450-10	Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC Line	Thermo Fisher Scientific	A18945	Commercial human iPSC line
Glutamax	Thermo Fisher Scientific	35050038	An alternative to L-glutamine with increased stability. Improves cell health.
Hepes	Sigma-Aldrich	H4034	chemicals for electrophysiological solutions
L-ascorbic acid	LKT Laboratories	A7210	Used in cell culture as an antioxidant
Laminin	Sigma-Aldrich	11243217001	Promotes attachment and growth of neural cells in vitro
NEAA	Thermo Fisher Scientific	11140035	Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL Kit	Thermo Fisher Scientific	MPK10096	Cell electroporation kit
Neon Transfection System	Thermo Fisher Scientific	MPK5000	Cell electroporation system
Neurobasal Medium	Thermo Fisher Scientific	21103049	Basal medium designed for long- term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF	Biological Industries	05-100-1A	Human iPSC culture medium
PBS	Sigma-Aldrich	D8662-500ML	Dulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ free	Sigma-Aldrich	D8537-500ML	Dulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin	Sigma-Aldrich	P4333-100ML	Penicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithine	Sigma-Aldrich	P4957	Promotes attachment and growth of neural cells in vitro
SU5402	Sigma-Aldrich	SML0443-5MG	Selective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100	Sigma-Aldrich	T8787	4-(1,1,3,3-Tetramethylbutyl)phenyl- polyethylene glycol, t- Octylphenoxypolyethoxyethanol, Polyethylene glycol tert- octylphenyl ether. Used for cell permeabilization in immunostaining assays
Y-27632 (ROCK inhibitor)	Enzo Life Sciences	ALX-270-333-M005	Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well	Ibidi	80826	Support for high–end microscopic analysis of fixed cells