Method Article

A Simple Chelex Protocol for DNA Extraction from Anopheles spp.

56K views

DOI:

10.3791/3281

January 9th, 2013

In This Article

Summary

A rapid and affordable way to extract quality malaria parasite and vector DNA from mosquito specimens is described. Capitalizing on chelating properties of Chelex resin, the simple method enables genotyping of malaria parasites in mosquito mid-gut and salivary gland phases, as well as molecular identification of the Anopheles sibling species by PCR.

Abstract

Endemic countries are increasingly adopting molecular tools for efficient typing, identification and surveillance against malaria parasites and vector mosquitoes, as an integral part of their control programs1,2,3,4,5. For sustainable establishment of these accurate approaches in operations research to strengthen malaria control and elimination efforts, simple and affordable methods, with parsimonious reagent and equipment requirements are essential6,7,8. Here we present a simple Chelex-based technique for extracting malaria parasite and vector DNA from field collected mosquito specimens.

We morphologically identified 72 Anopheles gambiae sl. from 156 mosquitoes captured by pyrethrum spray catches in sleeping rooms of households within a 2,000 km2 vicinity of the Malaria Institute at Macha. After dissection to separate the head and thorax from the abdomen for all 72 Anopheles gambiae sl. mosquitoes, the two sections were individually placed in 1.5 ml microcentrifuge tubes and submerged in 20 μl of deionized water. Using a sterile pipette tip, each mosquito section was separately homogenized to a uniform suspension in the deionized water. Of the ensuing homogenate from each mosquito section, 10 μl was retained while the other 10 μl was transferred to a separate autoclaved 1.5 ml tube. The separate aliquots were subjected to DNA extraction by either the simplified Chelex or the standard salting out extraction protocol9,10. The salting out protocol is so-called and widely used because it employs high salt concentrations in lieu of hazardous organic solvents (such as phenol and chloroform) for the protein precipitation step during DNA extraction9.

Extracts were used as templates for PCR amplification using primers targeting arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 gene (ND4) to check DNA quality11, a PCR for identification of Anopheles gambiae sibling species10 and a nested PCR for typing of Plasmodium falciparum infection12. Comparison using DNA quality (ND4) PCR showed 93% sensitivity and 82% specificity for the Chelex approach relative to the established salting out protocol. Corresponding values of sensitivity and specificity were 100% and 78%, respectively, using sibling species identification PCR and 92% and 80%, respectively for P. falciparum detection PCR. There were no significant differences in proportion of samples giving amplicon signal with the Chelex or the regular salting out protocol across all three PCR applications. The Chelex approach required three simple reagents and 37 min to complete, while the salting out protocol entailed 10 different reagents and 2 hr and 47 min' processing time, including an overnight step. Our results show that the Chelex method is comparable to the existing salting out extraction and can be substituted as a simple and sustainable approach in resource-limited settings where a constant reagent supply chain is often difficult to maintain.

Protocol

1. Preparatory Dissection of Mosquito Specimens

  1. Place mosquito on a small cutting of parafilm and mount on dissecting microscope.
  2. Cover in drop of deionized water to soften tissue.
  3. Incise the mosquito carcass precisely at the joint between the thorax and abdomen, thus nicking off the head and thorax from the abdominal section.
  4. Transfer each dissected mosquito section into a clean autoclaved 1.5 ml microcentrifuge tube prelabeled with mosquito ID number details and appropriately marked to denote body section (e.g. "m" for mid-gut section; "ht" for head and thorax section).
  5. Discard parafilm and carefully wipe microscope stage with 70% alcohol-moistened Kimwipe before processing the next mosquito.

2. DNA Extraction from Mosquito Specimens

  1. Pipette 20 μl of deionized water into sample tube and use pipette tip to grind the submerged mosquito section into a uniform suspension.
  2. Add 100 μl of autoclaved 1X PBS/1% saponin solution to sample homogenate and mix by gentle momentary vortexing.
  3. Incubate at room temperature for 20 min.
  4. Centrifuge at 20,000 x g for 2 min and discard supernatant.
  5. Resuspend pellet in 100 μl 1X PBS.
  6. Centrifuge again at 20,000 x g for 2 min and discard supernatant.
  7. By gentle vortexing (5 sec), resuspend pellet in 75 μl sterile deionized water and 25 μl of 20% w/v Chelex-100 resin suspension in deionized water.
  8. Pierce hole in lid of sample tube using sterile 23G hypodermic needle flamed in Bunsen burner.
  9. Boil sample suspension in water bath on floating rack (or in heating block) for 10 min.
  10. Centrifuge at 20,000 x g, for 1 min and transfer ensuing DNA solution into prelabeled storage vial for use as template in PCR applications.

3. Plasmodium falciparum Genotyping and Anopheles spp. Molecular Identification

  1. Add 2.5 μl of the Chelex DNA extract in 25 μl PCR reactions to check DNA quality11, identify Anopheles species10 and to genotype P. falciparum12mid-gut and salivary gland infections.
  2. To maximize amplicon yield, especially for P. falciparum detection, include 1.5X bovine serum albumin (BSA) in the PCR assay. The following reaction composition is recommended: (2.5 μl template, 0.25 μM primers, 1.5 μM magnesium chloride, 200 μM dNTPs, 1X PCR Buffer, 1.5X BSA and 1.0U Taq DNA polymerase, in 25 μl volumes).
  3. To check for DNA quality in extract, amplify region of the arthropod mitochondrial nicotinamide adenine dinucleotide dehydrogenase (NADH) subunit 4 (ND4) gene (primers ND4FW [5'-GTD YAT TTA TGA TTR CCT AA-3'] and ND4RV [5'-CTT CGD CTT CCW ADW CGT TC-3']; expect product 400bp)11,13.
  4. To differentiate Anopheles gambiae sl. sibling species (An. gambiae ss and An. arabiensis only), amplify region flanking SNPs in the intergenic spacer (IGS) region, (primers UN [5'-GTGTGCCCCTTCCTCGATGT-3'], GA [5'-CTGGTTTGGTCGGCACGTTT-3'], AR [5'-AAGTGTCCTTCTCCATCCTA-3']; expect product 390bp An gambiae ss, 315bp An arabiensis)10,11.
  5. For typing P. falciparum antifolate drug resistance polymorphisms, perform nested PCR to amplify region flanking amino acid codons 108, 51, 59, 16 and 164 in the parasite dihydrofolate reductase (DHFR) gene:
    Primary round primers: M1 [5'-TTTATGATGGAACAAGTCTGC-3'] and M5 [5'-AGTATATACATCGCTAACAGA-3']
    Secondary round primers: M3 [5'-TTTATGATGGAACAAGTCTGCGACGTT-3'] with F/ [5'-AAATTCTTGATAAACAACGGAAACCTTTTA-3']
    Or
    F [5'-GAAATGTAATTCCCTAGATATGGAATATT-3] with M4 [5'-TTAATTTCCCAAGTAAAACTATTAGAGCTTC-3']).
    Also amplify region containing amino acid codons 436, 437, 540, 581 and 613 in the P. falciparum dihydropteroate synthetase (DHPS) gene:
    Primary round primers R2 [5'- AACCTAAACGTGCTGTTCAA-3'] with R/ [5'- AATTGTGTGATTTGTCCACAA3'];
    Secondary round primers
    J: [5'-'TGCTAGTGTTATAGATATAGGTGGAGAAAGC-3'] with K/ [5'-CTATAACGAGGTATTGCATTTATTGCAAGAA-3']
    Or
    K: [5'-TGCTAGTGTTATAGATATAGGATGAGCATC-3'] with K/,
    Or
    L [5'- ATAGGATACTATTTGATATTGATATTGGACCAGGATTCG-3'] with L/ [5'-5TATTACAACATTTTGATCATTCGCGCAACCGG-3']12.
  6. Subject 4 μl amplicon to allele-specific restriction enzyme digestions in 30 μl reactions following the manufacturer's instructions, to detect antifolate drug resistance-associated polymorphisms12.
  7. Subject 5 μl of PCR amplicon (or 15 μl of restriction digest) per lane of ethidium bromide-stained 2% agarose gel to electrophoresis (100 - 120V) and visualize bands under UV transillumination.

Results

Examples of results from PCR assays for mosquito DNA extract quality (Figure 1), Anopheles arabiensis molecular identification (Figure 2) and P. falciparum detection (Figure 3) show that the simplified Chelex method yields similar results to the standard salting out protocol10, despite much fewer steps (Table 1). With comparable DNA quality in the respective extracts it is not surprising that sample positivity rates with respect to An. gambiae sibling species as well as parasite infection rates were not statistically different based on McNemar's chi-square test (Figure 3).

Sensitivity (%) was calculated as TP/(TP+FN)*100, where TP denotes true positives and FN denotes false negatives. Specificity (%) was determined as TN/(TN+FP)*100, where TN denotes true negatives and FP denotes false positives. The DNA quality (ND4) PCR showed 93% sensitivity and 82% specificity for the Chelex approach compared to the established salting out protocol as gold standard. Corresponding values of sensitivity and specificity were 100% and 78%, respectively, using sibling species identification PCR and 92% and 80%, respectively for P. falciparum detection PCR.

The addition of BSA to reaction mixtures resulted in a general increase of PCR positives (Figure 3) due to relief of PCR inhibitors14, for both the simplified Chelex and regular salting out protocol. However, this increase was not statistically significant except for DNA quality (ND4 PCR) on Chelex extracts (p = 0.039). Allele-specific restriction enzyme digestion on P. falciparum DHFR (or other target gene) amplicon enables the genotyping of mid-gut and salivary gland malaria infections for drug resistance alleles (Figure 4; salivary gland data not shown).

Simple Chelex ProcedureStandard Salting out Procedure
StepsReagentsStepsReagents
  1. Add specimen to 1.5 ml microfuge tube and homogenize in 100 μl of 1X PBS/1% Saponin solution (2 min).
  2. Leave at room temperature for 20 min.
  3. Spin at 20,000 x g for 2 min and discard supernatant.
  4. Add 100 μl of 1X PBS and mix gently by momentarily vortexing (3 sec).
  5. Spin at 20,000 x g for 2 min and discard supernatant.
  6. Add 25 μl of 20% w/v Chelex in deionized water and 75 μl sterile deionized water.
  7. Pierce hole in lid of sample tube using hot, sterile 23G hypodermic needle and boil tube contents for 10 min.
  8. Spin microfuge tube at 20,000 x g for 1 min.
  9. Transfer supernatant into sterile prelabeled vial and store DNA solution at -20 °C until use (2.5 μl in 25 μl PCR reaction).
PBS

Saponin
Chelex-100 beads
  1. Add specimen to 1.5 ml microfuge tube and homogenize in 100 μl Bender buffer* with 1% DEPC (2 min).
  2. Incubate at 65 °C for 1 hr.
  3. Add 15 μl cold 8 M potassium acetate. Mix gently and incubate on ice for 45 min.
  4. Spin sample in microfuge tubes at 20,000 x g for 10 min and transfer supernatant to a new 1.5 ml tube.
  5. Add 250 μl of 100% ethanol and mix well by inverting the tube.
  6. Incubate sample at RT for 5 min.
  7. Spin samples at 20,000 x g for 15 min.
  8. Aspirate and discard supernatant, leaving the pellet to dry completely in the tube (30 min).
  9. Resuspend pellet in 20 μl of 0.1X SSC + RNAse (10 μg/ml) overnight at 4 °C.
  10. Add 80 μl DEPC water and store at -20 °C until use.
Diethylpyrocarbonate (DEPC)
*Bender Buffer:
0.1 M NaCl
0.2 M Sucrose
0.1 M Tris-HCL

0.05 M EDTA, pH 9.1

0.5% SDS in DEPC water

8 M Potassium acetate

Ethanol

0.1X Saline sodium citrate (SSC) buffer

RNAse (10 μg/ml)
TOTAL TIME: 37 minTOTAL TIME: 2 hr 47 min, plus overnight

Table 1. Step by step comparison of the reagents and time requirements for simple Chelex protocol and standard salting out method for DNA extraction from mosquito specimens.

Gel electrophoresis results showing DNA extraction comparison; lanes indicate salting out, Chelex method.
Figure 1. ND4 mitochondrial PCR comparison of DNA quality from simplified Chelex "C" and standard salting out "M" extracts on Anopheles arabiensis field samples. NC, negative control; M1 and C1, M2 and C2, M3 and C3, and M4 and C4 are paired salting out and Chelex extracts from same An. arabiensis mosquito specimens. L, 100 bp DNA ladder.

Gel electrophoresis results; DNA extraction, salting out, Chelex method, 315bp marker band.
Figure 2. Molecular identification PCR for Anopheles arabiensis. C1 and M1, C2 and M2, C3 and M3, C4 and M4 denote respective amplicon from salting out "M" and simplified Chelex "C" DNA extracts for same mosquito specimens; AR, Anopheles arabiensis positive control; L, 100 bp DNA ladder.

PCR assay results bar chart; Salt vs Chelex treatment effect on positivity with and without BSA.
Figure 3. Detection of positives on Chelex and salting out DNA extracts for mosquito field samples, with PCR assays for molecular identification of Anopheles arabiensis (AR)10, arthropod NADH dehydrogenase gene 4 (ND4) DNA quality test11, and antifolate drug resistance P. falciparum DHFR genotyping12 (F-M4). Results shown for assays run with or without BSA in the reaction mix. McNemar's chi-square test was used to determine if the differences between percent of positive PCRs from DNA extracted from the simplified Chelex and the standard salting out protocols were statistically significant.

DNA gel electrophoresis result, mosquito mid-gut, 522bp, 326bp, 196bp separation, analysis method.
Figure 4. Application of simplified Chelex protocol in genotyping P. falciparum infections in mosquitoes (mid-gut data shown) for drug resistance alleles. BstN I digestion on amplicon flanking codon 108 of the P. falciparum DHFR gene12 shows cycloguanil-resistant S108T mutants in mosquito samples (M1-M5; mid-gut data shown). U, undigested 522 bp amplicon; FCR3, laboratory standard P. falciparum positive control clone carrying S108T; K1, P. falciparum laboratory standard clone negative control carrying cycloguanil-sensitive S108N; L, 100 bp DNA ladder.

Discussion

The simplified Chelex method presented here enables extraction of quality Anopheles spp and P. falciparum DNA from mosquito specimens amenable to diverse PCR applications. This technique can be employed for molecular identification of malaria vector mosquitoes and surveillance of drug-resistant P. falciparum alleles in mosquitoes for national malaria control programs. The advantages of the simplified Chelex technique include simplicity, fewer reagents and hence cost, safety and shorter processing time (37 min) than standard protocols such as the salting out method10 (2 hr 47 min and an overnight step, Table 1). The aforementioned advantages and minimal reagent requirements (3 reagents) compared to the current standard protocol (10 reagents, Table 1)11,15, make the simplified Chelex protocol particularly friendly to endemic country laboratories where a constant reagent supply chain is often difficult to maintain. A limitation of the method is that like the standard protocol, it was also subject to PCR inhibitors known to occur in the mosquito integument16. However, this is readily relieved by inclusion of BSA in the assays. BSA has also been successfully employed as an amplification enhancer against inhibitors in other PCR applications17,18.

Disclosures

No conflicts of interest declared.

Acknowledgements

The authors are indebted to the chiefs, headmen and communities of Macha for their unwaveing cooperating during mosquito field sample collections. Dr Doug Norris and Rebekah Kent offered invaluable expertise on the salting out protocol. This work was funded by the Johns Hopkins Malaria Research Institute pilot grant system. Mosquito and parasite DNA laboratory standards were kindly donated by MR4, American Type & Culture Collection.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Chelex-100, 50-100 dry meshBioRad#143-2832
SaponinSIGMA142-7425
BSANew England BiolabsB9001S

References

  1. Bonnet, M., et al. Efficacy of antimalarial treatment in Guinea: in vivo study of two artemisinin combination therapies in Dabola and molecular markers of resistance to sulphadoxine-pyrimethamine in N'Zerekore. Malar. J. 6, 54(2007).
  2. Nsimba, B., et al. Sulphadoxine/pyrimethamine versus amodiaquine for treating uncomplicated childhood malaria in Gabon: a randomized trial to guide national policy. Malar. J. 7, 31(2008).
  3. Oyewole, I. O., et al. Behaviour and population dynamics of the major anopheline vectors in a malaria endemic area in southern Nigeria. J. Vector Borne Dis. 44, 56-64 (2007).
  4. Harris, I., et al. A large proportion of asymptomatic Plasmodium infections with low and sub-microscopic parasite densities in the low transmission setting of Temotu Province, Solomon Islands: challenges for malaria diagnostics in an elimination setting. Malar. J. . 9, 254(2010).
  5. Ouedraogo, A. L., et al. Substantial contribution of submicroscopical Plasmodium falciparum gametocyte carriage to the infectious reservoir in an area of seasonal transmission. PLoS ONE. 4, e8410(2009).
  6. Birx, D., de Souza, M., Nkengasong, J. N. Laboratory challenges in the scaling up of HIV, TB, and malaria programs: The interaction of health and laboratory systems, clinical research, and service delivery. Am. J. Clin. Pathol. 131, 849-851 (2009).
  7. Ishengoma, D. R., et al. Health laboratories in the Tanga region of Tanzania: the quality of diagnostic services for malaria and other communicable diseases. Ann. Trop. Med. Parasitol. 103, 441-453 (2009).
  8. Alonso, P. L., et al. A research agenda for malaria eradication: vector control. PLoS Med. 8, e1000401(2011).
  9. Grimberg, J., et al. A simple and efficient non-organic procedure for the isolation of genomic DNA from blood. Nucleic Acids Res. 17, 8390(1989).
  10. Scott, J. A., Brogdon, W. G., Collins, F. H. Indentification of single specimens of the Anopheles gambiae complex by polymerase chain reaction. American Journal of Tropical Medicine and Hygiene. 49, 520-529 (1993).
  11. Kent, R. J., Norris, D. E. Identification of mammalian blood meals in mosquitoes by a multiplexed polymerase chain reaction targeting cytochrome B. Am. J. Trop. Med. Hyg. 73, 336-342 (2005).
  12. Duraisingh, M. T., Curtis, J., Warhurst, D. C. Plasmodium falciparum: detection of polymorphisms in the dihydrofolate reductase and dihydropteroate synthetase genes by PCR and restriction digestion. Exp. Parasitol. 89, 1-8 (1998).
  13. Gorrochotegui-Escalante, N., Munoz, M. L., Fernandez-Salas, I., Beaty, B. J., Black, W. C. T. Genetic isolation by distance among Aedes aegypti populations along the northeastern coast of Mexico. Am. J. Trop. Med. Hyg. 62, 200-209 (2000).
  14. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  15. Norris, D. E., Shurtleff, A. C., Toure, Y. T., Lanzaro, G. C. Microsatellite DNA polymorphism and heterozygosity among field and laboratory populations of Anopheles gambiae ss (Diptera Culicidae). J. Med. Entomol. 38, 336-340 (2001).
  16. Schriefer, M. E., Sacci, J. B., Wirtz, R. A., Azad, A. F. Detection of polymerase chain reaction-amplified malarial DNA in infected blood and individual mosquitoes. Exp. Parasitol. 73 (91), 311-316 (1991).
  17. Al-Soud, W. A., Radstrom, P. Purification and characterization of PCR-inhibitory components in blood cells. J. Clin. Microbiol. 39, 485-493 (2001).
  18. Hyun, C., Filippich, L. J., Hughes, I. The inhibitory effect of pentobarbitone on reverse transcription-PCR. J. Biochem. Biophys. Methods. 62, 63-68 (2005).

Reprints and Permissions

Tags

Chelex DNA ExtractionAnopheles MosquitoDNA Extraction ProtocolMosquito DissectionDeionized Water HomogenizationSaponin TreatmentCentrifugation ProtocolChelex ResinBoiling ExtractionPCR Amplification