Method Article

Using Quantitative Real-time PCR to Determine Donor Cell Engraftment in a Competitive Murine Bone Marrow Transplantation Model

14.7K views

DOI:

10.3791/50193

March 7th, 2013

In This Article

Summary

Determining donor cell engraftment presents a challenge in mouse bone marrow transplant models that lack well-defined phenotypical markers. We described a methodology to quantify male donor cell engraftment in female transplant recipient mice. This method can be used in all mouse strains for the study of HSC functions.

Abstract

Murine bone marrow transplantation models provide an important tool in measuring hematopoietic stem cell (HSC) functions and determining genes/molecules that regulate HSCs. In these transplant model systems, the function of HSCs is determined by the ability of these cells to engraft and reconstitute lethally irradiated recipient mice. Commonly, the donor cell contribution/engraftment is measured by antibodies to donor- specific cell surface proteins using flow cytometry. However, this method heavily depends on the specificity and the ability of the cell surface marker to differentiate donor-derived cells from recipient-originated cells, which may not be available for all mouse strains. Considering the various backgrounds of genetically modified mouse strains in the market, this cell surface/ flow cytometry-based method has significant limitations especially in mouse strains that lack well-defined surface markers to separate donor cells from congenic recipient cells. Here, we reported a PCR-based technique to determine donor cell engraftment/contribution in transplant recipient mice. We transplanted male donor bone marrow HSCs to lethally irradiated congenic female mice. Peripheral blood samples were collected at different time points post transplantation. Bone marrow samples were obtained at the end of the experiments. Genomic DNA was isolated and the Y chromosome specific gene, Zfy1, was amplified using quantitative Real time PCR. The engraftment of male donor-derived cells in the female recipient mice was calculated against standard curve with known percentage of male vs. female DNAs. Bcl2 was used as a reference gene to normalize the total DNA amount. Our data suggested that this approach reliably determines donor cell engraftment and provides a useful, yet simple method in measuring hematopoietic cell reconstitution in murine bone marrow transplantation models. Our method can be routinely performed in most laboratories because no costly equipment such as flow cytometry is required.

Introduction

Murine bone marrow (BM) transplantation model was first developed in 1960s1. This model has been extensively used for the study of donor hematopoietic stem cell (HSC) biology in a host recipient mouse. Murine bone marrow transplant model has provided us with valuable knowledge on HSC functions and their regulation and is indispensable in HSC research. Allogeneic bone marrow transplant model like C57Bl/6JH2b-Balb/CH2d or congenic transplant model like C56Bl/6JCD45.2-B6.SJLCD45.1 are used in many laboratories to study the gene function on HSC activity2, effect of drug treatment on HSC function3 or transplantation related diseases such as graft-versus-host disease (GvHD)4.

Cell surface markers such as MHC haplotype or CD45.1 are commonly used for distinguishing donor-derived cells from recipient-originated cells. C57Bl/6JH2b, CD45.2, Balb/CH2d and B6.SJLCD45.1 are the most commonly used mouse strains in bone marrow transplantation because the donor cell contribution can be easily assessed by flow cytometry measuring CD45.1 vs. CD45.2 or H2b vs. H2d. However, many other strains such as FVB/NJ5 and C3H are also often used to generate genetically engineered transgenic or knockout mice. These mice may be backcrossed to an inbred line and maintained in a mixed genetic/MHC background. In these cases, determining donor cell engraftment and HSC function could be difficult as donor specific- cell surface markers may not be available.

Using Y-chromosome-specific DNA probe to detect the donor male cells by southern blot in sex-mismatched bone marrow transplantation was first developed by Dr. Miwa's group 6. Then, a real-time PCR for the sex-determining region Y was found to be an accurate and highly specific method to quantitate male fetal cells in the maternal blood system7. This concept was adapted by Dr. Schwarzenberger's group for the development of a real-time PCR technique in a murine bone marrow transplantation model to determine donor cell engraftment 8. We further modified this method for the measurement of donor cell engraftment in FVB/NJ mouse bone marrow transplant model. This method is currently extensively utilized in our group for studying the role of Pim1 kinase in HSC biology.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Bone Marrow Cell Isolation

  1. Euthanize male donor FVB/NJ mice and female FVB/NJ mice using CO2 method followed by cervical dislocation. The female FVB/NJ bone marrow cells will be used as competitive cells.
  2. Use small scissors and forceps, dissect out femurs and tibiaes from mice and place them in a 60 mm tissue culture dish containing 6 ml ice-cold RPMI1640 with 5% heat inactivated FBS. Use kimwipe tissue to remove muscle and other tissues. Cut off both ends of each bone shaft in the dish.
  3. Connect the end of the bone with 23G needle on 3 cc syringe, flush out bone marrow with RPMI1640 with 5% heat inactivated FBS into the dish. Disaggregate bone marrow tissues by repeated aspirations using the same needle. Transfer the cell suspension to 15 ml centrifuge tube.
  4. Spin down the cells for 5 min at 400 x g, remove the supernatant, resuspend the cells in 1 ml of room temperature red blood cell lysis buffer (155 mM potassium bicarbonate, 10 mM Ammonium chloride, 0.1 mM of EDTA, PH=7.4) and incubate at room temperature for 5 min then add 5-10 ml of RPMI 1640 with 5% heat inactivated FBS.
  5. Pass the cells through a cell strainer. Collect the flow through to a new tube. Spin down for 5 min at 400 x g. Remove the supernatant; the cell pellet should not contain any red color. The absence of red color indicates a complete removal of red blood cells. Resuspend the cell pellet in 10 ml of RPMI1640 with 5% heat inactivated FBS. Gently vortex to make sure the cell suspension is completely uniform. Take an aliquot and count the cells in a hemacytometer. Calculate how much volume of cells needed for bone marrow transplantation and aliquot enough cells and mix male donor cells with competitor female cells at a ratio of 5:2. Spin down for 5 min at 400 x g, wash with PBS, resuspend in PBS with the final concentration of donor cells at 5×106/ml and competitor cells at 2×106/ml.

2. Competitive Bone Marrow Transplantation

  1. Irradiate female recipient mice (8-12 wks of age) with 137Cs gamma rays radiator at a single dose of 11Gy 4-6 hr before bone marrow transplantation.
  2. Place the irradiated female mice in a mouse restrainer. Inject the mixed donor and competitor cells via tail vein in 0.1 ml of total volume such that each mouse receives 5×105 donor cells and 2×105 competitor bone marrow cells.

3. Sample Collection

Couples weeks after bone marrow transplantation, collect peripheral blood samples (~50 μl) from female recipient mouse by retro-orbital bleeding under anesthesia condition. Samples are collected into EDTA coated tubes. BM samples can also be collected at the end of experiment, usually at least 4 months post transplantation, with same procedures as previous described (Step 1); usually 20-40% of 1 tibia BM cells are enough to make enough amount of DNA. Blood or BM samples from age matched normal female and male mice are also collected to prepare standard curve.

4. Genomic DNA Isolation

  1. Add 4× volume of room temperature RBC lysis buffer (~ 200 μl) to each blood sample. Mix well and incubate at room temperature for 5 min. Add 1 ml of PBS, then spin down to remove most of the lysed RBC.
  2. Isolate DNA using a blood DNA extraction kit (QIAmp DNA Blood extraction kit). Pre-warm the elution buffer (AE) at 37 °C to enhance the yield of eluted DNA. Male and female DNAs for standard curve are isolated similarly.
  3. (Optional) Genomic DNA can be further purified or concentrated using EtOH precipitation method in the presence of 3 M Sodium Acetate (pH=5.5). The DNA pellets are then resuspended in 40-50 μl distilled water for analysis immediately or stored at -20 °C for future use.
  4. Measure the DNA concentration with Nanodrop ND-1000 spectra photometer. Samples with OD 260/280 between 1.8-2.0 are used for further analysis.
  5. Dilute DNA with DNAase free H2O to 4ng/μl in a total volume of 50 μl.

5. Standard Curve Preparation

Dilute male DNA and female DNA to a concentration of 4 ng/μl, and make the DNA mixture according the Table1

% of male DNA in Female BackgroundVolume (μl) of 4ng/μl male DNAVolume (μl) of 4ng/μl female DNATotal volume(μl)
0.21499500
0.51199200
2.55195200
12.525175200
50100100200
87.517525200
1002000200

Table 1. Sample preparation for standard curve. Normal male and female FVB/NJ mice at the age of 8-12wks were sacrificed. Blood and BM cells were collected. DNAs from male cells and female cells were isolated and re-suspended at a concentration of 4ng/μl. The male and female DNAs were mixed at various ratios to generate the DNA standard sample mixtures.

6. Real-time PCR

  1. Set up the PCR reaction plate by mixing SYBR Green supermix reagent with primers and genomic DNA. The reaction volume (20 μl) contains 400 nM of each primer and 5 μl of blood cell genomic DNA (4ng/μl x5 μl=20 ng) in each reaction. DNA samples and standards were set up in triplicate. The sequences of primers are shown in Table 2.
Gene nameForwardReverse
Bcl25′-AAGCTGTCACAGAGGGGCTA5′- CAGGCTGGAAGGAGAAGATG
Zfy15-TGGAGAGCCACAAGCTAACCA5'- CCCAGCATGAGAAAGATTCTTC

Table 2. RT-PCR primer sequence for murine Bcl2 and Zfy1.

  1. Perform PCR reaction using Biorad iQ5 PCR machine with the following conditions: 95 °C 3 min, 42 amplification cycles of 95 °C for 10 sec, 58 °C for 25 sec and 72 °C for 15 sec, followed by a melting-curve step.
  2. Obtain Cycle threshold (Ct) values by Bio-Rad iQ5 2.1 Standard Edition Optical System. Calculate δCt (CtZfy1-CtBcl2) value, and Zfy1 expression level is calculated as the value of 2-δ Ct.
  3. Establish standard curves for each reaction series using 2-δCt reading from known male/female standard mixtures. The standard curves are generated by plotting the mean of 2-δCt value of triplicates to the known % male DNA in the mixture with linear regression fitting.

Access restricted. Please log in or start a trial to view this content.

Results

Figure 1 and 2 showed examples of standard curves plotted with mean values of 2-δCt against percentages of male DNA. Figure 1A showed specific melting temperature for Bcl2 and Zfy1 amplicons localized at 78.5 °C and 88.5 °C, respectively. Bcl2 is used as a reference gene to normalize the total amount of loaded DNA in each PCR reaction. Bcl2 amplification curves (Log view) for each standard sample merge with each other independent of male DNA concentration, indicating equal amo...

Access restricted. Please log in or start a trial to view this content.

Discussion

The objective of our current study is to provide the audiences a PCR based technique to quantify donor cell engraftment in a competitive murine bone marrow transplantation model. Several studies have been reported using RT-PCR to detect donor cells in transplantation models 9-10. Dr. Schwarzenberger's group first developed a murine bone marrow transplantation model using real-time PCR to amplify y-chromosome-specific 8. This method was used to study Gli-1 function in HSC activity 11. We t...

Access restricted. Please log in or start a trial to view this content.

Disclosures

We have no competing financial interests to disclose.

Acknowledgements

We thank Dr. Charles Greenberg for the use of his Real time PCR machine. This work is supported by MUSC Hollings Cancer Center Startup Fund, Hollings Cancer Center ACS IRG, ASCO Conquer Cancer Foundation Career Development Award, NIH 1K08HL 103780-01A1, and NIH 3P30CA138313-01S3. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health or other funding agents.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
RPMI 1640HycloneSH30255.01
FBSInvitrogen16140-017Heat inactivated
Ammonium chlorideMP Biomedicaals194806
Potassium BicarbonateFisherP184-500
QIAamp DNA Blood minikitQiagen51106
Cell strainerBD bioscience
iQ SYBR Green supermixBiorad170-8882
iQ5 real time PCR machineBiorad
Spectra photometerNanodrop ND-1000ND-1000

References

  1. McCulloch, E. A., Till, J. E. The radiation sensitivity of normal mouse bone marrow cells, determined by quantitative marrow transplantation into irradiated mice. Radiat. Res. 13, 115-125 (1960).
  2. Xiao, N., et al. Hematopoietic stem cells lacking Ott1 display aspects associated with aging and are unable to maintain quiescence during proliferative stress. Blood. 119, 4898-4907 (2012).
  3. Kang, Y., Chen, B. J., Deoliveira, D., Mito, J., Chao, N. J. Selective enhancement of donor hematopoietic cell engraftment by the CXCR4 antagonist AMD3100 in a mouse transplantation model. PLoS One. 5, e11316(2010).
  4. Sadeghi, B., et al. GVHD after chemotherapy conditioning in allogeneic transplanted mice. Bone Marrow Transplant. 42, 807-818 (2008).
  5. Taketo, M., et al. FVB/N: an inbred mouse strain preferable for transgenic analyses. Proc. Natl. Acad. Sci. U.S.A. 88, 2065-2069 (1991).
  6. Morisaki, H., et al. Genotypic analysis using a Y-chromosome-specific probe following bone marrow transplantation. Am. J. Hematol. 27, 30-33 (1988).
  7. Lo, Y. M., et al. Quantitative analysis of fetal DNA in maternal plasma and serum: implications for noninvasive prenatal diagnosis. Am. J. Hum. Genet. 62, 768-775 (1998).
  8. Byrne, P., et al. Chimerism analysis in sex-mismatched murine transplantation using quantitative real-time PCR. Biotechniques. 32, 279-280 (2002).
  9. Ma, X., et al. Contribution of recipient-derived cells in allograft neointima formation and the response to stent implantation. PLoS One. 3, e1894(2008).
  10. Bosio, E., et al. A comparison between real-time quantitative PCR and DNA hybridization for quantitation of male DNA following myoblast transplantation. Cell Transplant. 13, 817-821 (2004).
  11. Merchant, A., Joseph, G., Wang, Q., Brennan, S., Matsui, W. Gli1 regulates the proliferation and differentiation of HSCs and myeloid progenitors. Blood. 115, 2391-2396 (2010).
  12. Nagamine, C. M., Chan, K., Hake, L. E., Lau, Y. F. The two candidate testis-determining Y genes (Zfy-1 and Zfy-2) are differentially expressed in fetal and adult mouse tissues. Genes & development. 4, 63-74 (1990).
  13. Grundler, R., et al. Dissection of PIM serine/threonine kinases in FLT3-ITD-induced leukemogenesis reveals PIM1 as regulator of CXCL12-CXCR4-mediated homing and migration. J. Exp. Med. 206, 1957-1970 (2009).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Murine ModelPeripheral Blood AnalysisGenomic DNA IsolationY Chromosome GeneReference Gene NormalizationStandard Curve PreparationFlow Cytometry Alternative

Related Articles