A Fluorescence-based Exonuclease Assay to Characterize DmWRNexo, Orthologue of Human Progeroid WRN Exonuclease, and Its Application to Other Nucleases

Summary

Exonucleases play critical roles in ensuring genome stability. Loss of WRN exonuclease function results in premature aging. Studying substrates and other requirements of the nuclease in vitro can help elucidate its role in vivo. Here we demonstrate a rapid and reproducible fluorescence-based assay to measure its nuclease activity.

Abstract

WRN exonuclease is involved in resolving DNA damage that occurs either during DNA replication or following exposure to endogenous or exogenous genotoxins. It is likely to play a role in preventing accumulation of recombinogenic intermediates that would otherwise accumulate at transiently stalled replication forks, consistent with a hyper-recombinant phenotype of cells lacking WRN. In humans, the exonuclease domain comprises an N-terminal portion of a much larger protein that also possesses helicase activity, together with additional sites important for DNA and protein interaction. By contrast, in Drosophila, the exonuclease activity of WRN (DmWRNexo) is encoded by a distinct genetic locus from the presumptive helicase, allowing biochemical (and genetic) dissection of the role of the exonuclease activity in genome stability mechanisms. Here, we demonstrate a fluorescent method to determine WRN exonuclease activity using purified recombinant DmWRNexo and end-labeled fluorescent oligonucleotides. This system allows greater reproducibility than radioactive assays as the substrate oligonucleotides remain stable for months, and provides a safer and relatively rapid method for detailed analysis of nuclease activity, permitting determination of nuclease polarity, processivity, and substrate preferences.

Introduction

Nucleases serve a vital role in cells in removing damaged DNA, resolving nonduplex structures such as Holliday junctions and providing proof-reading capacity during DNA replication, both intrinsic within DNA polymerases and extrinsic to them¹. Nucleases can act either by sequentially degrading DNA from free ends (exonucleases) or by cleaving internal phosphodiester bonds within a longer DNA molecule (endonucleases). Loss of nuclease activity can result in highly specific genome instability phenotypes. While mutation of the RecQ helicase family member BLM result in excessively high rates of sister chromatid exchange and globally elevated cancer rates (review....

Protocol

1. Preparation of Substrate Oligonucleotides

1. Synthesize custom oligonucleotides.
   1. Design one single-stranded oligonucleotide with a 5'-conjugated fluorescein molecule; this will be the backbone for every substrate. (Note that this is for a 3'-5' exonuclease; for a 5'-3' polarity exonuclease use a 3'-conjugated backbone strand). If polarity is not known, both 3' and 5' should be tested.
   2. Design complementary strands such that when annealed to the fluorescently labeled oligonucleotide, the duplex substrate(s) of choice are formed. Note that the complementary strand is not conjugated to a f....

Results

Performing in vitro analysis of exonuclease activity requires a number of preparatory steps in addition to the actual analysis. An overview of the procedures is shown in Figure 1.

Prior to conducting fluorescence-based exonuclease assays, it is critical to optimize detection of the fluorescently labeled oligonucleotide substrate following separation on urea-acrylamide gels using a suitable fluorescence imaging system. Filter choice is extremely important as this can .......

Discussion

Determination of exonuclease activity of purified proteins requires the analysis of DNA cleavage products. Sequential cleavage of DNA by exonucleases can be visualized by separation of labeled cleavage products on acrylamide gels. Historically this involved end-labeling of the DNA substrate with a radiolabel (e.g. ³²P or ³⁵S), but with the disadvantages inherent in use of radiolabel (cost, safety issues, and instability over time). To overcome these problems, we have developed an exonucleas.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Reagent/Material
Custom oligonucleotides	Eurogentec		It is necessary to obtain these at high purity e.g. with PAGE purification.
		5'FLO	fluoresescein-5' GAACTATGGCTCTC GAGTGCTAGGACATGTCTGA CTACGTACAAGTCACC - 3'
		bubble	5'- GGTGACTTGTACGT AGTCAGACATGTCCTAGCAC TCGAGAGCCATAGTTC-3'
40% 19:1 Acrylamide solution	Severn Biotech	20-2400-05	CAUTION: potent neurotoxin so gloves should be worn at all times
His-Trap columns (1 ml)	GE Healthcare	17-5247-01
All other reagents	any reputable supplier		Molecular biology grade is necessary (DNase-free); microfuge tubes similarly should be DNase- and RNase-free
Equipment
Hoefer SE400 gel apparatus	Hoefer	SE400-15-1.5
FLA-3000 (phosphor and fluorescence imager)	Fuji
Image Reader V2.02	FujiFilm
Image Gauge V3.3	FujiFilm