A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

11.6K views

DOI:

10.3791/50779

September 5th, 2013

In This Article

Erratum Notice

Important: There has been an erratum issued for this article. View Erratum Notice

Summary

We demonstrate a simple multiplex PCR assay for quick-screening and typing of Staphylococcal Cassette Chromosome mec (SCCmec) types I-V for methicillin-resistant Staphylococcus aureus, and provide some of the vital steps and procedural nuances that make it successful for adapting this assay to individual laboratories.

Abstract

Staphylococcal Cassette Chromosome mec (SCCmec) typing is a very important molecular tool for understanding the epidemiology and clonal strain relatedness of methicillin-resistant Staphylococcus aureus (MRSA), particularly with the emerging outbreaks of community-associated MRSA (CA-MRSA) occurring on a worldwide basis. Traditional PCR typing schemes classify SCCmec by targeting and identifying the individual mec and ccr gene complex types, but require the use of many primer sets and multiple individual PCR experiments. We designed and published a simple multiplex PCR assay for quick-screening of major SCCmec types and subtypes I to V, and later updated it as new sequence information became available. This simple assay targets individual SCCmec types in a single reaction, is easy to interpret and has been extensively used worldwide. However, due to the sophisticated nature of the assay and the large number of primers present in the reaction, there is the potential for difficulties while adapting this assay to individual laboratories. To facilitate the process of establishing a MRSA SCCmec assay, here we demonstrate how to set up our multiplex PCR assay, and discuss some of the vital steps and procedural nuances that make it successful.

Introduction

Methicillin-resistant Staphylococcus aureus (MRSA) has acquired and integrated into its genome a 21-67-kb mobile genetic element, termed the staphylococcal cassette chromosome mec (SCCmec) that harbors the methicillin resistance (mecA) gene and other antibiotic resistance determinants 1. SCCmec is characterized by the presence of terminal direct and inverted repeats, two essential genetic components (the mec gene complex and the ccr gene complex), and the J-regions (Figure 1). The mec gene complex is composed of IS431mec, mecA, and intact or truncated sets of regulator....

Access restricted. Please log in or start a trial to view this content.

Protocol

These procedures should be conducted in a certified biosafety level 2 laboratory. Appropriate personal protective equipment such as gloves and lab coats should be used at all times.

1. Sample Preparation

  1. Fresh overnight plate cultures of MRSA are required. On the day before PCR is to be done, select a single colony of MRSA with a sterile culture stick and prepare a heavy streak of the bacteria on a Tryptic Soy Agar (TSA) plate. Multiple samples can be streaked onto a single plate. Incubate overnight at 37 °C.
  2. Add 75 μl of sterile distilled water to a 1.5 ml microcentrifuge tube. Using a sterile culture stick ....

Access restricted. Please log in or start a trial to view this content.

Results

This updated M-PCR is able to determine (classify) SCCmec types I-V, as well major subtypes of SCCmec IV. The assay targets unique and specific loci of SCCmec I, II, III, IVa, IVb, IVc, IVd, IVE and V, with concomitant mecA gene detection. Tentative identification of SCCmec VI and VIII is also possible, but would require further testing to confirm. Figure 3 illustrates representative SCCmec I-VI and VIII and the locations of each target within the ele.......

Access restricted. Please log in or start a trial to view this content.

Discussion

The multiplex PCR assay described here provides a simple, reliable method for classifying types and major subtypes of SCCmec I-V in Staphylococci, with simultaneous discrimination of MRSA from MSSA. The assay is robust, conveniently done in a single PCR reaction and results are easy to interpret. The assay does have limitations in that it targets individual loci within each SCCmec type, but does not offer comprehensive ccr and mec complex typing, and therefore cannot be considered a go.......

Access restricted. Please log in or start a trial to view this content.

Disclosures

No conflicts of interest declared.

Acknowledgements

We thank T. Ito, K. Hiramatsu, R. Daum, H. de Lencastre, and D. Coleman for the kind gift of some reference strains used in this study. This work was in part supported financially by the Centre for Antimicrobial Resistance (CAR), Alberta Health Services-Calgary/Calgary Laboratory Services/University of Calgary.

....

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Tryptic Soy AgarFisher (BD)CA90002-700 (236920)
Sterile distilled waterLife Technologies10977-015
Platinum Taq: including 10x PCR buffer and 50 mM MgCl2Life Technologies10966-034
100 mM dNTPLife Technologies10297-018
Tris baseSigma-AldrichT6066
Boric acidSigma-AldrichB7901
EDTALife Technologies15576-028
AgaroseLife Technologies16500-500
GlycerolLife Technologies15514-011
Bromophenol blueSigma-AldrichB8026
1Kb+ DNA ladderLife Technologies10787-026
Ethidium bromideSigma-AldrichE7637
1.5ml Microcentrifuge tubes VWR (Axygen Scientific)10011-700
Culture sticksVWRCA10805-018
PCR tubesDiamedAD0210-FCN (new #: DIATEC420-1250)
CentrifugeEppendorf5417c
Heat blockVWR13259-030 / 13259-286
ThermalcyclerApplied Biosystems (2720)4359659
Horizontal, submersible gel electrophoresis chamber with gel moldBioRad170-4469
Power supplyBioRad164-5050
Rocker shakerVWR40000-300
Molecular Imager Gel Doc SystemBioRad1708170

References

  1. IWG-SCC. Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrobial Agents and Chemotherapy. 53 (12), 4961-4967 (2009).
  2. Ito, T., Hiramatsu, K., Tomasz, A., de Lencastre, H., Perreten, V., Holden, M., et al.

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Erratum


Formal Correction: Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus
Posted by JoVE Editors on 3/19/2019. Citeable Link.

An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus.  There was a typo in Table 1.

In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:

TTCTCATTGATGCTGAAGCC

To:

GAAACTAGTTATTTCCAACGG

Tags

SCCmec TypingMRSA DetectionDNA ExtractionGel ElectrophoresisPrimer DesignPCR OptimizationAntibiotic Resistance