In Vitro Assay to Evaluate the Impact of Immunoregulatory Pathways on HIV-specific CD4 T Cell Effector Function

Summary

We developed an in vitro assay to investigate the role of immunoregulatory pathways in the regulation of cytokine secretion by HIV-specific CD4 T cells.

Abstract

T cell exhaustion is a major factor in failed pathogen clearance during chronic viral infections. Immunoregulatory pathways, such as PD-1 and IL-10, are upregulated upon this ongoing antigen exposure and contribute to loss of proliferation, reduced cytolytic function, and impaired cytokine production by CD4 and CD8 T cells. In the murine model of LCMV infection, administration of blocking antibodies against these two pathways augmented T cell responses. However, there is currently no in vitro assay to measure the impact of such blockade on cytokine secretion in cells from human samples. Our protocol and experimental approach enable us to accurately and efficiently quantify the restoration of cytokine production by HIV-specific CD4 T cells from HIV infected subjects.

Here, we depict an in vitro experimental design that enables measurements of cytokine secretion by HIV-specific CD4 T cells and their impact on other cell subsets. CD8 T cells were depleted from whole blood and remaining PBMCs were isolated via Ficoll separation method. CD8-depleted PBMCs were then incubated with blocking antibodies against PD-L1 and/or IL-10Rα and, after stimulation with an HIV-1 Gag peptide pool, cells were incubated at 37 °C, 5% CO₂. After 48 hr, supernatant was collected for cytokine analysis by beads arrays and cell pellets were collected for either phenotypic analysis using flow cytometry or transcriptional analysis using qRT-PCR. For more detailed analysis, different cell populations were obtained by selective subset depletion from PBMCs or by sorting using flow cytometry before being assessed in the same assays. These methods provide a highly sensitive and specific approach to determine the modulation of cytokine production by antigen-specific T-helper cells and to determine functional interactions between different populations of immune cells.

Introduction

During persistent viral infections, virus specific-T cells acquire functional defects in a process known as T cell exhaustion. Early in vivo studies in the murine LCMV model of chronic viral infection indicated that exhausted virus-specific T cells have reduced cytolytic function against virally infected cells, lose their ability to proliferate and have reduced capacity to produce cytokines such as IL-2, TNF-α and IFN-γ^1,2. A complex network of immunoregulatory pathways, such as PD-1 and IL-10, are upregulated during chronic infections and contribute to T cell dysfunction (reviewed in^3,4). In vivo administration of blo....

Protocol

1. Depletion and Isolation of PBMCs via Ficoll Separation

1. Deplete CD8+ T cells by adding Human CD8+ Depletion Cocktail at 50 μl/ml of whole blood.
2. Mix well and incubate for 20 min at room temperature (18-25 °C).
3. After incubation, mix whole blood with HBSS (Hank's Balanced Salt Solution without Ca²⁺ or Mg²⁺) and layer over Histopaque. Spin at 340 rcf for 30 min (no brake, slow acceleration).
4. Collect PBMCs and transfer to a new 50ml conical. Wash 2x with 45 ml RPMI 1640 supplemented with 50 IU Penicillin, 50 μg/ml Streptomycin, 2 mM L-glutamine, and 1% HEPES by spinning for 10 min at 340 ....

Results

When performing cytokine measurements using this in vitro system, it is essential to be able to distinguish the antigen-specific responses compared to the no stimulation control. In general, we considered positive responses as any values of the antigenic stimulation that give at least three-fold increase in cytokine levels compared to the no stimulation control and which were within the linear range of the assay. We are using high sensitivity bead array assays that can detect concentrations of cytokines as low a.......

Discussion

Supernatant collection is an imperative part of this experimental design. When harvesting supernatants for the Luminex assay, aliquots were made and kept at -80 °C to prevent protein degradation due to freeze-thaw cycles. Freezing and thawing can be harsh processes for proteins, and by minimizing freeze-thaws, signal will be maximized in assays. Therefore, it is easier to obtain repeatable and more accurate data when working from aliquots that have been freeze-thawed the same number of times.

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Hanks Balanced Salt Solution without Ca2+ or Mg2+	Sigma	H9394
RPMI 1640	Sigma	R0883
Histopaque-1077	Sigma	10771
Human Serum AB	Gemini BioProducts	100-512
Penicillin/Streptomycin	Mediatech	30 001 CI
L-glutamine	Mediatech	25 005 CI
HEPES buffer	Mediatech	25060CI
FcR blocking reagent, human	Miltenyi	130-059-901
RosetteSep Human CD8+ Depletion Cocktail	Stem Cell	15663
LIVE/DEAD Fixable Dead Cell Stain Kit, for UV excitation	Invitrogen	L23105
Rneasy Mini Kit	Qiagen	74104
Improm-II Reverse Transcription System	Promega	A3800
Brilliant II SYBR qPCR Low Rox Master Mix	Agilent	600830
BD Cytofix/Cytoperm Fixation/Permeabilization Solution Kit	BD	554714
Tween-20	Fisher	BP337100
IFN-γ primer	Invitrogen		FOR: CGAGATGACTTCGAAAAGCTGA REV: TCTTCGACCTCGAAACAGCA
GAPDH primer	Invitrogen		FOR: TCATCATCTCTGCCCCCTCT REV: AGTGATGGCATGGACTGTGG