Reverse Yeast Two-hybrid System to Identify Mammalian Nuclear Receptor Residues that Interact with Ligands and/or Antagonists

Summary

Ketoconazole binds to and antagonizes Pregnane X Receptor (PXR) activation. Yeast high throughput screens of PXR mutants define a unique region for ketoconazole binding. This yeast-based genetic method discovers novel nuclear receptor interactions with ligands that associate with surface binding sites.

Abstract

As a critical regulator of drug metabolism and inflammation, Pregnane X Receptor (PXR), plays an important role in disease pathophysiology linking metabolism and inflammation (e.g. hepatic steatosis)^1,2. There has been much progress in the identification of agonist ligands for PXR, however, there are limited descriptions of drug-like antagonists and their binding sites on PXR^3,4,5. A critical barrier has been the inability to efficiently purify full-length protein for structural studies with antagonists despite the fact that PXR was cloned and characterized in 1998. Our laboratory developed a novel high throughput yeast based two-hybrid assay to define an antagonist, ketoconazole's, binding residues on PXR⁶. Our method involves creating mutational libraries that would rescue the effect of single mutations on the AF-2 surface of PXR expected to interact with ketoconazole. Rescue or "gain-of-function" second mutations can be made such that conclusions regarding the genetic interaction of ketoconazole and the surface residue(s) on PXR are feasible. Thus, we developed a high throughput two-hybrid yeast screen of PXR mutants interacting with its coactivator, SRC-1. Using this approach, in which the yeast was modified to accommodate the study of the antifungal drug, ketoconazole, we could demonstrate specific mutations on PXR enriched in clones unable to bind to ketoconazole. By reverse logic, we conclude that the original residues are direct interaction residues with ketoconazole. This assay represents a novel, tractable genetic assay to screen for antagonist binding sites on nuclear receptor surfaces. This assay could be applied to any drug regardless of its cytotoxic potential to yeast as well as to cellular protein(s) that cannot be studied using standard structural biology or proteomic based methods. Potential pitfalls include interpretation of data (complementary methods useful), reliance on single Y2H method, expertise in handling yeast or performing yeast two-hybrid assays, and assay optimization.

Introduction

The yeast two-hybrid (Y2H) assay is widely used to discover protein-protein interactions and more recently for discovery of novel small molecules that disrupt protein-protein interaction complexes ^{7, 8, 9, 10, 11}. However, the conventional approaches of this assay, used for drug discovery or "hits", do not allow for detection of allosteric interaction residues of chemicals compounds within protein-protein surfaces, that when altered still interact and allow for interrogation of the altered residues¹¹. Indeed, such a method(s), if feasible to develop, would enable a tractable yeast system for high throughput assessment of allosteric intera....

Protocol

1. Construction of PXR and SRC-1 Fusions in Yeast Vectors

1. PCR amplification of Human PXR LBD (107-434 amino acids) and Human SRC-1 full length (1-1401 amino acids).
   1. Use pSG5-hPXR plasmid⁸ as PXR LBD template, use pCMX-SRC1 plasmid as SRC-1 templates.
   2. Thaw PCR SuperMix, DNA templates and primers (see Materials), keep them on ice.
   3. Add 0.25 μg/μl DNA template 1 μl, 10 mM primer pairs 2 μl each, PCR SuperMix 45 μl and add H₂O to bring total volume to 50 μl.
   4. Set PCR at one cycle of 94 °C for 2 min, 20 cycles of 94 °C for 30 sec, 55 °C for 30 sec ....

Results

We performed an assay to see if we could detect a colorimetric readout of the association of PXR and steroid receptor coactivator-1 (SRC-1). Since yeast has significant sterol production, it has previously been shown that lacZ expression in yeast can be induced without the need for additional exogenous ligand. We found that lacZ expression (blue colonies) is also induced in the yeast strain transformed with PXR and SRC-1; however, there is no induction of LacZ expression (white colonies) in yeast transformed with empty v.......

Discussion

In our modified Y2H assay, we have identified important residues for ketoconazole interactions on PXR⁶. Since SRC-1 is a coactivator (and was cloned into the pGADNot vector), we also tested whether SRC-1 could activate lacZ expression when cloned into the pSH vector system and whether this would change the activation profile and/or affect the leakiness of the yeast two-hybrid assay. Using our redesigned plasmids we performed two-hybrid assays in erg3Δ/erg11Δ yeast. As before, we sho.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Yeast Strain CTY10-5d erg3Δ/erg11Δ	Our lab		CTY10-5d yeast was double knocked out ERG3 and ERG11 (erg3Δ/erg11Δ) genes6 .
YPD Growth Medium	BD Biosciences	630409
Difco Yeast Nitrogen Base (YNB) w/o Amino Acids and Ammonium Sulfate	BD Biosciences	233520
Bacto Agar	BD Biosciences	214010
CSM-His/-Leu Complete Supplement Mixture	MP Biomedicals	4250-412
ONPG (o-Nitrophenyl Β-D- Galactopyranoside).	Sigma-Aldrich	N1127
2-Mercaptoethanol	Sigma-Aldrich	M6250
Luria Broth (LB)	Sigma-Aldrich	L3022
X-Gal	Fisher	BP-1615
Sonicated Salmon Sperm DNA boiled (10 mg/ml)	Life Technology	156-017
Ampicillin	Acros Organics	61177
Ketoconazole	Sigma-Aldrich	K1003
N,N-Dimethylformamide	Acros Organics	326871000
Lithium Acetate	Sigma-Aldrich	L4158
50% PEG-3350 solution, filter-sterilized	Sigma-Aldrich	P-3640
Nitrocellulose Membrane	Whatman	10402091
10 cm Petri Dish	Fisher	875712
5'-ACCGGATCCCGATGAAGA AGGAGATGATCATGTCC-3'	our lab		PXR LBD forward primer for pSH2-1
5'-AGAGTCGACTCAGCTA CCTGTGATGCC -3'	our lab		PXR LBD reverse primer for pSH2-1
5'-TATAGC GGCCGCATGAGTG GCCTCGGGGACAGTTCATCC -3'	our lab		SRC-1 forward primer for pGADNOT
5'-GCGGTCGACTTATTCAGTCA GTAGCTG -3'	our lab		SRC-1 reverse primer for pGADNOT
Platinum PCR Supermix	Invitrogen	11306-016
BamHI	our lab	R0136
SalI	our lab	R0138
NotI	our lab	R0189