Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Biology

Affinitetsbaserade Isolering av Tagged Kärnor från doi: 10.3791/51418 Published: March 25, 2014

Summary

Drosophila vävnader innehåller ofta en heterogen blandning av celltyper. För att undersöka genuttryck i specifika celltyper från en viss vävnad, kan kärnan vara genetiskt taggade och därefter isoleras med hjälp av en affinitetsbaserad metod. Enstaka kärnor kan användas för tillämpningar efter exempelvis genuttryck analys och kromatin immunoprecipitation.

Abstract

Drosophila melanogaster embryon och larver vävnader innehåller ofta en mycket heterogen blandning av celltyper, som kan komplicera analysen av genuttryck i dessa vävnader. Således, för att analysera cellspecifika genuttrycksprofilerna från Drosophila vävnader, kan det vara nödvändigt att isolera specifika celltyper med hög renhet och i tillräckliga halter för tillämpningar i senare led, t.ex. transkriptionsprofilering och kromatin immunoprecipitation. Däremot kan den oregelbundna cellulär morfologi i vävnader såsom det centrala nervsystemet, i kombination med den sällsynta populationen av specifika celltyper i dessa vävnader, utgöra utmaningar för traditionella metoder för cellisolering såsom laser microdissection och fluorescens-aktiverad cell sortering (FACS) . Här visas ett alternativt tillvägagångssätt för att karakterisera cellspecifika genuttrycksprofilerna använder affinitetsbaserad isolering av märkta kärnor, snarare än hela celler, beskrivs. Kärnor i den specifika c.ell typ av intresse är genetiskt märkta med en kärnhöljet-lokaliserad EGFP tag hjälp av Gal4/UAS binära expressionssystem. Dessa EGFP-märkta kärnorna kan isoleras med användning av antikroppar mot GFP som är kopplade till magnetiska pärlor. Det tillvägagångssätt som beskrivs i detta protokoll möjliggör konsekvent isolering av kärnor från specifika celltyper i Drosophila larver centrala nervsystemet vid hög renhet och kan i tillräckliga nivåer för expressionsanalys, även när dessa celltyper omfattar mindre än 2% av den totala cellpopulationen i vävnad. Kan användas för detta tillvägagångssätt för att isolera kärnor från ett brett utbud av Drosophila embryonala och larvcelltyper med specifika Gal4 drivrutiner, och kan vara användbara för att isolera kärnor från celltyper som inte är lämpliga för FACS eller laser mikrodissektion.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Drosophila vävnader såsom det centrala nervsystemet innehåller en komplex blandning av celltyper. Således, för att analysera cellspecifika genuttrycksprofilerna från Drosophila vävnader, är det först nödvändigt att isolera en homogen population av specifika celler i tillräcklig mängd för att möjliggöra tillämpningar i efterföljande led. Metoder för att isolera celler från intakta vävnader inkluderar laser mikrodissektion, och fluorescensaktiverad cellsortering (FACS) av hela celler. Medan FACS har använts för att isolera celler och kärnor från Drosophila embryon och från Caenorhabditis elegans för genexpression och kromatin profilering 1-3 kan FACS och laser mikrodissektion vara svår att utföra framgångsrikt i vävnader som innehåller starkt blandade celltyper eller som innehåller celler med oregelbunden morfologi, såsom neuroner. För att övervinna denna svårighet kan kärnor hellre än celler isoleras från specifika celltyper och användes för efterföljande allme uttrycksprofilering. Viktigt är microarray-baserad mRNA-expressionsanalys med hjälp av nukleära RNA-prover visar generellt jämförbara resultat som har den utförs med hjälp av total RNA 4, 5. Dessutom har genuttryck analys med användning av nukleära RNA med framgång använts för att studera genuttryck i flera organismer, inklusive C. elegans, Arabidopsis thaliana, Drosophila och människa 4, 5 2, 3.

Flera metoder har nyligen beskrivits för isolering av specifika populationer av märkta kärnor från Drosophila vävnader som är lämpliga för genuttryck analys och / eller kromatin immunoprecipitation. Sats isolera vävnadsspecifika kromatin för immunoprecipitation (BITS-chip) metod utnyttjar FACS för att isolera fasta kärnor på basis av celltyp specifika uttryck av kärn-lokaliserad GFP 2. Denna strategi har varit successfully användas för att analysera fördelningen av histon modifieringar och transkriptionsfaktorer som använder kromatin immunoprecipitation av isolerade kärnor från mesoderm av Drosophila embryon 2. Dock kan FACS-baserade metoder vara mindre lämpad för isolering märkta kärnor som utgör endast en liten del av en blandad befolkning på grund av den ökade sorterings tid som behövs för att få lämpliga siffror för tillämpningar i senare led. För att övervinna dessa begränsningar har flera grupper utnyttjade affinitetsbaserade isoleringstekniker för att rena cellkärnor som är märkta med en specifik epitop i en speciell celltyp. Isoleringen av kärnor etikette i specifika celltyper metoden (intakt) utvecklats för användning i Arabidopsis thaliana 6, 7 har nyligen anpassats för användning i Drosophila 8. I denna metod är en kärnhöljet fusionsprotein som är ett substrat för in vivo-biotinylering coexpresSED med Escherichia coli biotin ligas BirA i specifika celltyper. Biotin-märkta kärnor kan därefter renas från blandade populationer med hjälp av streptavidin-baserade affinitet isolering. Med användning av detta tillvägagångssätt har kärnor framgångsrikt märkta och isoleras från mesoderm av Drosophila embryon, i vilken en kärnhöljet fusionsprotein som uttrycks under kontroll av en mesoderm-specifik enhancer 8. Författarna genereras också kärnhöljet fusionsproteiner som kan uttryckas i vilken celltyp som helst under kontroll av den Gal4-regulatorisk sekvens, UAS 9. Detta tillvägagångssätt är i stånd att snabbt isolera delmängder av märkta kärnor från blandade populationer, men kräver tre separata transgena konstrukt och kan därför vara olämplig för vissa genetiska tillämpningar. Nyligen har en metod beskrivits i vilken sön (S AD1-och FN-C-84)-domän-innehållande proteiner som lokaliseras till det inre membranet i kärnhöljet var märkta medfluorescerande proteiner och uttrycktes under kontroll av den Gal4/UAS systemet 10. Kärnor isolerades i närvaro av icke-jonisk detergent för avlägsnande av det yttre membranet av kärnhöljet, och affinitetsrenades med användning av magnetiska pärlor kopplade till anti-GFP-antikroppar. Detta tillvägagångssätt har framgångsrikt använts för att isolera små populationer av märkta kärnor från specifika neuronala subtyper i den vuxna hjärnan i Drosophila 10.

Här används ett protokoll för isolering av märkta kärnor från en blandad population av celler från Drosophila larv vävnad beskrivas. Denna metod har utvecklats oberoende av varandra, men liknar den metod som beskrivs av Henry et al. 10 Först var kärnor märkta med en fluorescerande etikett som uttrycks endast i specifika celltyper i Drosophila melanogaster för att underlätta efterföljande isolering av taggade kärnor från blandade populationer med hjälp av en affinitetsbaserad metod. För att märka kärnor,den KASH (K larsicht / A nc-1 / S yn h omology) domän utnyttjades. Den KASH domän är en transmembrandomän som lokaliserar till det yttre membranet av kärnhöljet, dels genom interaktioner med SUN domän som innehåller proteiner inom det perinukleära utrymmet 11. Den C-terminala KASH domänen av proteiner såsom Drosophila Msp-300 och Klarsicht förankrar dessa proteiner till den yttre nukleära membranet, medan deras N-terminala domäner interagerar med cytoskelettet proteiner såsom aktin eller mikrotubuli i cytoplasman 12-14. Konstruktioner som genererades i vilka KASH domänen av Drosophila Msp-300 fuserades till C-terminalen av EGFP, under styrning av Gal4-regulatorisk sekvens, UAS i pUAST-attB-vektor 15, 16. Använda phiC31 sätesspecifik integration, var transgena flugor genereras där UAS-EGFP :: Mspl-300 KASH transgen infördes i attP2 loci på kromosom3L 17. Yrkeshögskolan-EGFP :: Msp-300 KASH flugor kan korsas med flugor som uttrycker Gal4 föraren i en viss celltyp, vilket resulterar i den riktade uttrycket av EGFP på den yttre nukleära membranet i celltypen av intresse. Märkta kärnor kan sedan renas från blandade cellpopulationer med användning av antikroppar mot GFP kopplade till magnetiska pärlor. I detta tillvägagångssätt är användningen av nonjonisk detergent inte krävs eftersom EGFP taggen är lokaliserad till den cytoplasmiska sidan av det yttre kärnmembranet, och är därför tillgängliga för antikroppar.

Protokollet som beskrivs nedan kan användas för att isolera / berika EGFP-märkta kärnor från specifika celltyper i Drosophila larver vävnader, för att kvantifiera renhet och utbyte av isolerade kärnor, och att utvinna kärn RNA lämplig för kvantitativ omvänd transkriptionspolymeraskedjereaktion (QRT -PCR) genuttrycksanalys. Isoleringen och affinitetsrening av kärnor (exklusive tissue dissektion) kan utföras på mindre än en timme. Resultaten presenteras som visar att glial kärnor kan framgångsrikt isoleras från larvoptiska globen och ögon imaginal skiva, och användes för efterföljande analys av genuttryck. Man räknar med att denna strategi kommer att vara användbart för isolering / anrikning av märkta kärnor från embryonala och larv vävnader i vilka målceller utgör mindre än 5% av den totala befolkningen. Alla Drosophila lager och plasmider från denna studie finns tillgängliga från författarna på begäran.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Generation och karakterisering av EGFP :: KASH Drosophila

  1. Cross Gal4 förare flyger till UAS-EGFP :: Msp-300 KASH flugor. Alternativt kan rekombinanta flugor som bär både Gal4 förare och UAS-EGFP :: Msp-300 KASH transgen genereras med hjälp av vanliga genetiska tekniker. Det andra är en fördel om ett stort antal avkomma krävs.
  2. Karaktärisera uttryck av EGFP :: KASH markör med användning av standard mikroskopi tekniker. OBS: EGFP uttryck kan observeras med standard mikroskopitekniker i dissekerade, fasta Drosophila vävnader, eller helt larver, och inte kräver användning av en antikropp.
    1. Bestäm expressionsmönstret av EGFP :: KASH markör i hela organismen under ett fluorescens dissektionsmikroskop (se Material PDF). Obs! Många Gal4 förare, inklusive repo-GAL4 föraren visad i figur 1, uppvisar nonspecific uttrycksmönster i andra larv vävnader såsom spottkörteln (se resultat).
    2. Analysera EGFP :: KASH uttrycksmönster i den dissekerade vävnaden av intresse med hjälp av konfokalmikroskopi.
      1. Fixa vävnaden av intresse med användning av formaldehyd vid en slutkoncentration av 4%, och fläck DNA med användning av DAPI vid en slutlig koncentration av 0,1 | ig / ml för att visualisera lokalisering av EGFP :: KASH etiketten i förhållande till DNA.
      2. Förvärva bilder med hjälp av antingen en 40X / 1.30 oljeimmersionsobjektiv eller en 20X / 0,75 oljeimmersionsobjektiv, beroende på storleken av vävnaden av intresse. Följande villkor excitation / emissions kan användas för bildtagning: 408 nm/425-475 nm (DAPI), 488 nm / 525 till 550 nm (GFP).

2. Isolera Kärnor från Drosophila Larvernas vävnader

  1. Förbered utrustningen för larv vävnad dissektion och efterföljande kärnor isolering. Observera atthela dechorionated embryon skulle också kunna användas som utgångsmaterial om så önskas. Det rekommenderas att använda delvis dissekerade larver vävnader snarare än hela larver om celltypen av intresse är närvarande i en specifik vävnad såsom imaginal skivan. Detta minskar icke-specifik bindning, och dessutom eliminerar problem som kan orsakas av uttryck av vissa Gal4 förare i nontarget celler.
    1. Bered två paren av vassa pincett (se Material PDF), en silikoniserad 9-brunnars glasplatta (se Material PDF) och PBT (1x PBS, pH 7,4, 0,1% Tween-20).
    2. Prebind GFP-antikropp till de magnetiska pärlorna. Detta steg bör påbörjas innan dissekering. Tillsätt 10 | il av de magnetiska pärlorna (Invitrogen, se Material PDF) och 2 ^ g av GFP-antikropp (Roche, se Material PDF) till 400 ^ il tvättbuffert (1x PBS, pH 7,4, 2,5 mM MgCl2) i ett 1,5 ml rör . Mängden pärlor och antikropp som används kan optimeras vid behov baserat på mängden mål i sampel och bindningsaffiniteten hos antikroppen till kulorna.
    3. Inkubera pärlor och antikropp med rotation i åtminstone 30 minuter vid rumstemperatur.
    4. Placera 1,5 ml rör innehållande pärlorna och antikroppen i den magnetiska rack (se Material PDF) och tillåta kulorna att binda till magnetiska under ca 1-2 min. Avlägsna supernatanten innehållande obunden antikropp och tvättbuffert med användning av en 1 ml pipett. Pärlorna kommer att förbli bundna till väggen i 1,5 ml rör på den sida som gränsar till magneten.
    5. Skölj pärlorna två gånger med 1 ml tvättbuffert varje gång som beskrivs i avsnitt 2.1.4. Ta ut 1,5 ml rör från den magnetiska rack och vänd snabbt att blanda pärlorna och tvätta buffert under varje tvättsteg.
    6. Förvara antikroppsbundna pärlor i tvättbuffert tills den ska fortsätta med steg 2.7. Kulorna bör inte torka ut i något skede av protokollet.
  2. Dissekera larv vävnader i PBT och överföra dissekerade vävnad tillen brunn av den 9-brunnsskål. Vanligtvis dissektion av synnerven lob och ögon imaginal skiva från 100 tredje stadiet larver ger tillräckligt material för nedströms genuttrycksanalys efter kärnor isolering.
  3. Skölj den isolerade vävnaden i nukleär extraktionsbuffert (10 mM HEPES-KOH, pH 7,5, 2,5 mM MgCl2, 10 mM KCl) i ett 1,5 ml rör. Överför enstaka larver vävnader till en 1 ml Dounce homogenisator (se Material PDF) på is som innehåller 1 ml färsk kärn extraktionsbuffert. Inkubera på is under 5 min. Det är inte nödvändigt att lägga proteashämmare om RNA skall extraheras efter kärnor isolering.
  4. Disrupt vävnaden genom 20 slag med den lösa mortelstöt och sedan inkubera provet på is under 10 min för att tillåta cellerna att svälla. Utdrag kärnorna från cellerna med hjälp av 15 slag med den snäva mortelstöt. Det antal slag med de lösa och täta pestles måste optimeras för olika vävnader och celltyper, överskotts homogenisering kan leda tillklippt kärnor, medan otillräcklig homogenisering inte kommer att packa alla kärnor från vävnaden.
  5. Filtrera homogenatet, som innehåller kärnor och cellrester genom ett 40 | im porstorlek silen (se Material PDF) som har prerinsed med nukleär homogeniseringsbuffert. Samla den filtrerade homogenatet i ett nytt rör.
  6. Samla pre-isoleringsprover för efterföljande analys för att bestämma cellkärnor utbyte nuclei integritet, och för att bestämma transkriptnivåer målgener före nuclei isolering.
    1. Överför 50 ul av det filtrerade homogenatet till en färsk 1,5 ml rör med hjälp av en pipett. Detta är den före isolering prov. Lägg till 500 l av Trizol reagens (se Material PDF, VARNING), invertera att blanda och förvara vid -20 ° C för efterföljande RNA-isolering (steg 3,1).
    2. Överför 20 ul av det filtrerade homogenatet till en färsk 1,5 ml rör.
      1. Lägg DAPI till en slutlig koncentration av 0,1 | ig / ml, och det ökasUbate provet på is under 10 min.
      2. Överför DAPI-färgade kärnor till en poly-lysin belagda täckglas, och lägg på ett objektglas. Täta täckglas med hjälp av genomskinligt nagellack.
      3. Kontrollera nuclei integritet, och närvaro av GFP-märkta kärnorna av intresse med användning av fluorescensmikroskop. OBS: Det är inte nödvändigt att fastställa kärnorna, eller att färga för GFP om dessa bilder analyseras någorlunda snabbt efter beredning (inom 24 timmar).
    3. Överför 10 ul av det filtrerade homogenatet till en färsk 1,5 ml rör och tillsätt 90 | il tvättbuffert (1x PBS, pH 7,4, 2,5 mM MgCl2). Lägg DAPI till en slutlig koncentration av 0,1 | ig / ml och inkubera på is under 10 min. Bestäm kärnor avkastningen i pre-isoleringsprov med hjälp av en hemocytometer att räkna DAPI-positiva kärnor använder epifluorescens under ett 10X luft mål.
  7. Placera 1,5 ml rör innehållande de antikroppsbundna pärlor (framställda i avsnitt 2.1.6) i en magnetställning,och låta de magnetiska pärlorna att binda till magneten under minst 2 min, såsom beskrivs i avsnitt 2.1.4. Avlägsna tvättbuffert från antikroppsbundna kulor med hjälp av en 1 ml pipett och tillsätt den filtrerade homogenatet från steg 2,5 till 1,5 ml rör med hjälp av en 1 ml pipett.
  8. Vänd försiktigt röret flera gånger för att blanda och inkubera vid 4 ° C i 30 min med end-over-end agitation. Undvik bubblor i röret om det är möjligt, eftersom dessa kan leda till klumpning av kärnor.
  9. Placera 1,5 ml rör innehållande de antikroppsbundna pärlorna och homogenatet i en magnetställning, och låta de magnetiska pärlor för att binda till magneten under minst 2 min, såsom beskrivs i avsnitt 2.1.4. Ta homogenatet innehåller den obundna kärnor fraktionen med hjälp av en 1 ml pipett.
  10. Tvätta provet 3 gånger med 1 ml tvättbuffert varje gång. Ta ut 1,5 ml rör som innehåller pärlor, bundna kärnor och tvättbuffert från racket och invertera att blanda flera gånger, sedan placera röret i den magnetiska rack som beskrivsi steg 2,9 och avlägsna supernatanten med användning av en 1 ml pipett.
  11. Addera 150 pl av tvättbuffert till pärlorna, som skall bindas till mål-kärnor. Detta är den post-isoleringsprov. Förbered prover för mikroskopi analys och efterföljande RNA-extraktion.
    1. Överför 20 ìl av post-isoleringsprov till ett nytt 1,5 ml rör och fläcken med DAPI och analysera så som beskrivs i avsnitt 2.6.2. Räkna GFP + / DAPI + och GFP-/DAPI + kärnor fångas av magnetiska pärlor för att fastställa renheten hos den anrikade GFP + kärnor i den post-isoleringsprov.
    2. Tillsätt 1 ml Trizol-reagens till återstoden av den post-isoleringsprov invertera för att blanda och lagra vid -20 ° C för efterföljande RNA-isolering (steg 3.1). Obs: Prov i Trizol kan lagras i flera veckor om det behövs vid -20 ° C. Det är inte nödvändigt att eluera kärnorna från de magnetiska pärlorna före RNA-extraktion med användning av Trizol-reagens, because pärlorna inte stör den efterföljande RNA-isolering.

3. Bestäm Avskrift Nivåer i Nuclei Isolerade från Larvernas vävnader

  1. Isolera RNA från pre-isolering och efterisolering prov som har beretts i avsnitten 2.6.1 och 2.11.2 med standardprotokollet beskrivs för Trizol-baserade RNA-extraktion (se Material PDF) med följande ändringar:
    1. Efter utfällning av RNA-pelleten, tillsätt 19,2 | il RNas-fritt vatten och 0,8 ^ il RNASecure reagens (se Material PDF) till pelleten och inkubera vid 60 ° C under 20 minuter för att inaktivera RNAs.
  2. Bestäm RNA-koncentrationen med en fluorescerande-RNA-bindande färgämne, såsom kvantbiten RNA-analyssats (se Material PDF) med användning av QubitR 2,0 Fluorometer att följa tillverkarens protokoll.
  3. Syntetisera cDNA med användning av en amplifiering av omvänt transkriptas såsom EpiScrIPT omvänt transkriptas kit och oligodT primers enligt tillverkarens anvisningar. Not: Normalt, 50 till 100 ng av RNA alstrar tillräcklig cDNA för att utföra multipel analys av genuttryck. Ekvivalenta mängder av pre-isolering och efter isolering RNA ska användas för att generera cDNA.
  4. Lägg till 180 l av nukleasfritt vatten till 20 l cDNA prov för att späda ut det här 10 gånger innan realtid kvantitativ PCR (qPCR) analys. Denna utspädning är ett viktigt steg, eftersom outspädda cDNA prover kan hämma qPCR.
  5. Förbered en qPCR Master Mix med polymeras och dNTP, 4 pmol vardera av framåt och bakåt primer, gjorde upp med sterilt vatten till den slutliga reaktionsvolym av 20 pl.
    1. Design qPCR primers att rikta gener som förväntas uttryckas i cellen typ av intresse, och i utvecklingsstadiet där vävnaden samlas. Design primers för att spänna ett intron, om möjligt, så att genomiskt ochcDNA PCR-produkter kan urskiljas. OBS: Om genuttryck profilen av typen målcellen inte är känd, primers mot EGFP, som bör uttryckas specifikt i den taggade kärnor befolkningen, kan användas för att optimera protokollet för en viss celltyp och vävnader (Tabell 1).
  6. Bestämma de relativa transkriptnivåerna varje gen av intresse i de pre-isolerings-och post-isolerings proverna genom jämförelse med en utspädningsserie av cDNA framställt från hela vävnaden. Transkriptnivåer av målgener bör normaliseras till en referens gen såsom Rpl32 (eller företrädesvis flera referensgener).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Repo-GAL4 drivrutin (Bloomington lager nummer 7415) är specifikt uttrycks i gliaceller i Drosophila nervsystemet på flera utvecklingsstadier 18. Flugor genererades som stabilt uttrycker UAS-EGFP :: Msp-300 KASH under kontroll av repo-GAL4 förare med vanliga genetiska tekniker. Att karaktärisera expressionsmönstret av EGFP :: KASH transgenen i dessa flugor var mönstret av GFP-uttryck i den dissekerade optiska globen och ögon imaginal skivan från tredje instar larvae undersöktes med användning av konfokalmikroskopi. Dissekerade vävnaderna motfärgades med DAPI för att markera DNA och med α-chaoptin 19 att märka fotoreceptor axoner (mAb24B10, se Material PDF). Figur 1A visar att repo-GAL4 driven EGFP :: är KASH transgen uttryckt i glia i de optiska loberna och öga imaginal skiva i den förväntade uttrycksmönstret. Under större förstoring,EGFP expression observeras i ett cirkulärt mönster kring DAPI-positiva DNA, förenligt med kärn-hölje lokalisering av EGFP :: KASH tagg (Figur 1B). EGFP expression kan detekteras både i fast och i ofixerade vävnader utan behov av signalförstärkning genom att använda en antikropp mot GFP; antikroppar mot GFP har inte använts för att visualisera EGFP :: KASH expression i de bilder som visas i figurerna 1 och 2. För att bestämma om EGFP :: KASH transgenen uttrycks icke-specifikt i några andra vävnader i Drosophila larver, var GFP-uttryck undersöktes i hela tredje instar-larver med hjälp av en fluorescens dissektionsmikroskop. Noterbart är ospecifik uttryck för EGFP :: KASH transgen observerades vid höga nivåer i spottkörtlarna i tredje stadiet larver. Detta tyder på att repo-GAL4 föraren har aktivitet i vissa celltyper än glia i larvstadiet av utvecklingen. Således, för att specifikt isolera glial kärnor, var den optiska loben och öga imaginal skiva från tredje stadiet larver isoleras med hjälp av dissektion före homogenisering och affinitet-isolering.

För att bekräfta att detta protokoll är lämpligt för utvinning av kärnor från Drosophila vävnader, och att uppskatta andelen märkta kärnor som finns i en viss vävnad, pre-isoleringsprov (avsnitt 2.6.2) från homogen erhållits från den optiska globen och ögon imaginal skiva av repo-GAL4, UAS-EGFP :: Mspl-300 KASH tredje instar larvae undersöktes. Figur 2A visar en representativ bild av pre-isoleringsprov erhållet med användning av konfokalmikroskopi. I denna bild, är förekomsten av kärnor indikeras av DAPI-positiva händelser. Ett litet antal glest utspridda GFP-positiva, DAPI-positiva gliaceller kärnor observeras också. Vi uppskattar att GFP-positiva kärnor utgör mindre än 2% av den totala kärnor befolkningen i dennaprovet (Figur 2A). Den totala kärnor avkastningen från optisk lob och öga imaginal skivor som dissekerade från 100 larver bestämdes för pre-isoleringsprov som beskrivs i avsnitt 2.6.3 (tabell 2). En typisk pre-isoleringsprov från 100 dissekerade optisk lob och ögat imaginal skivor som finns mellan 0,8 och 1,2 x 10 7 kärnor, varav cirka 2% var GFP-positiva. Figur 2B visar en representativ bild av DAPI-positiva kärnor i ett definierat område av hemocytometer. Observera att kärnorna är intakta, och bibehålla en konsekvent cirkulär form under extraktionsbetingelser som används i protokollet (Figur 2A och 2B).

För att avgöra om detta protokoll kan användas för att isolera och / eller i hög grad berika specifika populationer av märkta kärnor från vävnader som innehåller blandade cellpopulationer, α-GFP antikroppsbelagda magnetiska kulor var användningd att isolera märkta kärnor från homogen erhållna från den optiska loben och öga imaginal skiva av 100 repo-GAL4, UAS-EGFP :: Msp-300 KASH tredje stadiet larver. I fig. 2C och 2D, kan det ses att den EGFP :: KASH tagged gliaceller kärnor binder till α-GFP-belagda magnetiska pärlor och observeras i provet efter isolering (avsnitt 2.11.1) efter magnetisk separation. Även om de magnetiska pärlorna uppvisa viss autofluorescens i GFP-kanal, kan dessa lätt kan särskiljas från pärlbundna kärnorna genom sin mindre storlek (2,8 ^ m för de magnetiska pärlorna kontra ungefär 5 pm för kärnorna) och avsaknad av DAPI-färgning. GFP + / DAPI + kärnor står för mer än 95% av DAPI positiva händelser i post-isoleringsprov. Således målet tagged nuclei befolkning är starkt berikad i den post-isoleringsprov i förhållande till pre-isoleringprovet. Majoriteten av kärnorna i den post-isoleringsprov visar stark kärn-kuvertet lokaliserad GFP fluorescens, och är oftast omgivna av pärlor. Det är emellertid möjligt att ett litet antal omärkta kärnor kan också vara närvarande i detta prov. Sålunda, även om resultaten i figur 2C och i genuttrycksanalys i figur 3 (se nedan) tyder på att målet tagged gliaceller kärnor populationen kraftigt anrikad, möjligheten att en del kärnor från vissa andra icke-specifika celltyper är också närvarande i provet kan inte uteslutas. Vi rekommenderar att användare optimera detta protokoll för deras särskilda celltyp och vävnader av intresse att maximera anrikning av målet kärnor befolkningen, och att eliminera ospecifika kärnor bindande. I synnerhet är sannolikt att vara viktig för optimal anrikning av mål-kärnor förhållandet av utgångsmaterial i förhållande till antikropp och pärlor. Av denna anledning är områdena för totalkärnor antalet närvarande i våra typiska pre-isoleringsproven visas i tabell 2. Baserat på det totala kärnor antalet närvarande i pre-isoleringsprov, och den beräknade andelen av gliaceller i den blandade befolkningen från den optiska loben och öga imaginal skiva, var den maximala kärnor avkastning i den post-isoleringsprov väntas bli mellan 1,6 x 10 5 och 2,4 x 10 5 kärnor. Men med hjälp av hemocytometer för bestämning av kärnor utbyte såsom beskrivs i steg 2.6.3, själva kärnorna erhållna utbytet i den post-isolering prov var mellan 1,3 x 10 4 och 2,7 x 10 4 kärnor. Dessa kärnor avkastning utgör mycket grova uppskattningar eftersom pärlorna som finns i post-isoleringsprov tycks påverka korrekt lastning av hemocytometer. Vissa GFP-positiva kärnor observeras i den obundna homogenatet, vilket tyder på att inte alla GFP-positiva kärnor i de sgott binder till pärlorna effektivt på de villkor som används i detta protokoll. Öka tiden för bindande eller utföra sekventiella isoleringssteg skulle kunna öka denna avkastning, men detta kan komma på bekostnad av både renhet och RNA integritet. Med hjälp av de villkor som beskrivs i detta protokoll, kan tillräckliga mängder RNA erhållas i den post-isoleringsprov för nedströms genuttryck analys av QRT-PCR (Tabell 2). Således är detta protokoll som kan snabbt och strikt isolering av mål-kärnor från vävnader som innehåller blandade populationer av celler. Dessutom är det möjligt att specifikt isolera mål-kärnor som utgör endast en liten del, mindre än 5%, av cellerna i en given population.

För att ytterligare bekräfta att efter isolering prov höganrikat för vårt mål gliaceller kärnor befolkning, nivåerna av avskrifter för 4 olika gener i den pre-isolering post-isoleringsprover jämfördes med RT-qPCR. Avskriften nivåer elav, nrv2 och EGFP bestämdes i de två proven, och normaliserade till referensgenen, Rpl32, som uttrycks på motsvarande nivåer i gliaceller och i det omgivande centrala nervsystemet (Figur 3). Skillnaden vecket i den post-isolering prov visas i förhållande till pre-isoleringsprov, som är satt till ett. I fig. 3 visar den post-isoleringsprov signifikant lägre transkriptnivåer i neuronal-specifik gen elav förhållande till pre-isolering prov. Detta tyder på att kärnor från neuronala celler är underrepresenterade i den post-isoleringsprov. I motsats härtill ökade transkriptnivåer i både glia-anrikade nrv2 gen 10 och EGFP är närvarande i den post-isolation provet i förhållande till pre-isolering prov. Detta resultat indikerar att den post-isoleringsprov starkt anrikat för målet gliaceller kärnor populationen. Det är viktigt att notera att transkriptnivåer som uppmätts i detta protokoll utgör kärn avskrifter, och därför kommer sannolikt att indikera nivåerna av aktiv transkription snarare än steady state mRNA. Reproducerbart uttryck av repo detekterades inte i antingen vår pre-isolerings-eller post-isoleringsprover, vilket antyder att den Gal4-protein som uttrycks av repo-GAL4 föraren kan kvarstå efter aktiv transkription av den endogena repo-genen har upphört. Detta överensstämmer med resultat från andra studier där kärnor märkta med hjälp av twi promotorn inte visar anrikade nivåer av twi avskrifter, kanske på grund av skillnader i utvecklings tidpunkten för transkription kontra proteinstabilitet 8. Taksv tillsammans visar dessa resultat att den beskrivna protokollet kan med framgång användas för att i hög grad anrika målgrupp kärnor från vävnader som innehåller blandade populationer av celler, och att de isolerade kärnorna är lämplig för analys av genuttryck.

Figur 1
Figur 1. Uttrycksmönstret för repo-GAL4, UAS-EGFP :: Mspl-300 KASH flyga linje. (A) I tredje stadiets larver driver repo-GAL4 expression av UAS-EGFP :: Mspl-300 KASH transgen i gliaceller i optiken lob, optisk stjälk (os) och öga imaginal skiva (ed). Kärnhöljet i gliaceller är märkt med EGFP :: KASH (grön). R1 - R8 fotoreceptorcell axoner är märkta med α-chaoptin (mAB24B10, röd) för jämförelse, och DNA är stasökte med DAPI (lila). GFP-märkta gliaceller kärnor är synliga längs lamina (la) inom den optiska loben (markerad med pilar). Scale bar, 50 | im. (B) Högre förstoring bild av lamina ganglierna av synnerven lob som innehåller EGFP :: KASH märkta gliaceller cellkärnor. Scale bar, 50 | im. Konfokala bilder har förvärvats med hjälp av antingen en   40X / 1,30 olja eller en   20X / 0,75 oljeimmersionsobjektiv, och med hjälp av excitation / emissionsvåglängder av 408 nm/425-475 nm (DAPI), 488 nm/525-550 nm (GFP), 561 nm/595-620 nm (Alexa 5,6,8 ). Klicka här för att se en större version av denna siffra.

Figur 2
Figur 2. Karakterisering av kärnori "pre-isolering" och "post-isolering" prover. (A) representativ bild från en repo-GAL4, UAS-EGFP :: Msp-300 KASH pre-isoleringsprov analyseras med hjälp av ett X 20 / 0,75 oljeimmersionsobjektiv och standard konfokalmikroskop. DNA färgas med DAPI (blå), och EGFP :: KASH taggade gliaceller kärnor visas i grönt (markerad med pilar). Scale bar, 50 | im. (B) Representant bild av DAPI-färgade kärnor från en pre-isoleringsprov på en hemocytometer med hjälp av en X 10 luft mål och standard epifluorescensmikroskop. Hemocytometer nät visas i ljusgrått. Endast DAPI-positiva kärnor visas i denna bild, eftersom GFP fluorescens var inte synlig under denna målsättning på epifluorescensmikroskop. (C) Representant bild från en repo-GAL4, UAS-EGFP :: Msp-300 KASH efter isoleringsprovanalyserades såsom beskrivits för panel A. Det isolerade EGFP :: KASH tagged glial kärnor (markerade med pilar) fläck positivt för DAPI, och är omgivna av pärlorna, vilka autofluoresce vid låga nivåer i GFP-kanal. Scale bar, 50 | im. (D) Högre förstoring bild av en typisk isolerad EGFP :: KASH taggade gliaceller kärnor (markerade med pil) omgivna av pärlor. Skala bar, 5 ìm. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3. Representativa QRT-PCR-data från "pre-isolering" och "post-isolering" prover. Avskrift nivåer av målgener bestämdes av QRT-PCR av pre-isolation och efter isolering prover från repo-GAL4, UAS-EGFP :: Msp-300 Kash optiska lober och ögon imaginal skivor. Alla avskrift nivåer normaliserade till Rpl32 transkriptnivåer, och pre-isoleringsprov för varje gen målet är satt till ett. Representativa resultat från en biologisk experiment visas för följande gener: elav, nrv2 och EGFP.

Gene Primer-sekvens (5 '-3') Storlek PCR-produkten (bp)
EGFP GAGGGATACGTGCAGGAGAG 102
GATCCTGTTGACGAGGGTGT
nrv2 GGCTGGTTGTAGTCGCAGTT 125
GGCACCCAACACGAGAACTA
elav GCACCATTCGGAGCAATAAT 153
TGTGCAGCTGGATGGTGTAG
Rpl32 GCTAAGCTGTCGCACAAATG 160
CGTTGTGCACCAGGAACTT

Tabell 1. Primrar som användes för QRT-PCR-analys.

Totalt antal kärnor i pre-isoleringsprov Beräknat totalt antal kärnor i post-isolering prov RNA avkastningen från post-isoleringsprov (ng)
0,8 till 1,2 x 10 7 1,3 till 2,7 x 10 4 160-220 ng

Tabell 2. Representativa kärnor och RNA avkastning erhålls.Typiska serier av kärnor och RNA avkastning som erhållits från pre-isolering och efterisolering prover från 100 dissekeras optisk lob och ögon imaginal skivor från repo-GAL4, UAS-EGFP :: Msp-300 KASH genotyp, där gliaceller är märkta med EGFP :: KASH. Kärnor kvantifierades enligt beskrivningen i 2.6.3 och RNA kvantifieras som beskrivs i 3.1.2.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Detta protokoll kan användas för att isolera eller mycket berika specifikt taggade kärnor från blandade cellpopulationer i Drosophila embryonala eller larver vävnader. Med hjälp av detta protokoll, kan kärnor isoleras från dissekerade vävnad i ca 1 timme. Renheten och utbytet av de isolerade kärnor skall bestämmas experimentellt för varje celltyp. Det kan vara svårt att kvantifiera de pärlbundna kärnor vid den post-isolering skede av protokoll med användning av en hemocytometer grund av pärlorna som finns i provet. Således, om exakta antalet kärnor är avsedda för ett nedströms tillämpning kommer det att vara nödvändigt att uppskatta nuclei utbyte baserat på en alternativ metod, såsom DNA-innehåll. Exakta beräkningar av kärnor avkastning är inte nödvändiga för genuttryck analys om RNA framgångsrikt kan isoleras och kvantifieras. Det rekommenderas att använda en fluorescens-baserad metod för kvantifiering av RNA avkastning, eftersom vi har funnit att Spektrofotometrisk bestämning av RNA-koncentrationi dessa prover låg koncentration är mycket varierande.

Det finns två viktiga aspekter av det protokoll som kommer att påverka dess framgång: valet av magnetiska pärlor och antikropp. Magnetiska pärlor som är kopplade till GFP-eller protein G är kommersiellt tillgängliga från flera olika källor. Dock rekommenderas det starkt att använda protein G magnetiska kulor tillgängliga från Invitrogen för det förfarande som beskrivs i detta protokoll för två viktiga skäl. För det första är storleken av Invitrogen pärlor på 2,8 ^ m som är något mindre än den genomsnittliga storleken av kärnorna i de celltyper vi har undersökt, vilket är omkring 5 | im (figur 2D). Magnetiska pärlor som är mindre (t.ex. 50 nm, μMACS α-GFP, Miltenyi Biotech) inte binder snabbt till parti-wash stil magneter, och kolumnerna anges dessa pärlor kan täppa med larver vävnadsextrakt. Större magnetiska pärlor (t ex 10 um, PureProteome protein G magnetisk bEADS, Millipore) inte binder väl till kärnorna i våra preliminära tester, och dessa uppvisar också starka autofluorescens i samma kanaler som både DAPI och GFP, vilket gör det svårt att identifiera kärnor i pärlan bundna prov med standard mikroskopitekniker. Förutom valet av magnetiska kulor, är det viktigt att använda en GFP-antikropp som fungerar bra för immunoutfällning men som inte har hög icke-specifik bakgrund. För att underlätta reproducerbarheten av detta protokoll, har vi använt en monoklonal mus-antikropp mot GFP. Polyklonala kaninantikroppar mot GFP var också med framgång provat i våra förstudier, men dessa tenderade att ha högre ospecifik bakgrund. Andra monoklonala antikroppar testades också (t.ex. Utvecklingsstudier Hybridoma Bank), med varierande framgång. Således är antikroppen val är en viktig faktor i den framgångsrika isoleringen av märkta kärnor.

Även om vi i detta protokoll beskriver metoder för att DEThermelin gentranskript nivåer i enstaka kärnor, är det planerat att det tillvägagångssätt som beskrivs i steg 2,1-2,11 också kommer att vara lämpliga för att isolera kärnor som kan användas för senare kromatin immunutfällningsanalys. Om vävnaden fixeras i 1% formaldehyd före homogenisering (steg 2,3), kan sedan dissekerade vävnader samlas in under flera dagar och tillräckligt med material som isoleras för att utföra kromatin immunutfällningsanalys. Baserat på räkningar erhållna med användning av hemocytometer, som ger endast en grov uppskattning som diskuterats ovan, vi erhålles typiskt 1,3 x 10 4 och 2,7 x 10 4 glial kärnor från ögat imaginal skivan och optiken lob 100 larver (Tabell 2). Således, med hjälp av vår metod, bör det vara möjligt att få tillräckligt med material för att utföra kromatin immunutfällningsanalys, beroende på det överflöd av de riktade celltyp, och epitop av intresse.

En användbar genetisk tillämpning av denna tekque är att det kan användas för att positivt märka kärnorna i specifika celltyper i embryon eller larver som är homozygota för en recessiv letal mutant allel. För att åstadkomma detta måste två separata fluga lager genereras där den muterade allelen av intresse återförenas med en specifik Gal4 drivrutin, eller med UAS-EGFP :: Msp-300 KASH transgen på tredje kromosomen. Om flugor som bär den muterade allelen och Gal4 förare korsas för flugor som bär den muterade alleler och UAS-EGFP :: Msp-300 KASH transgen, endast avkomma som har båda kopiorna av den muterade allelen kommer att märkas med GFP i vävnaden där Gal4 föraren uttrycks. Således kan cellspecifika effekter av recessiva letala alleler undersökas i de embryonala eller larvstadier, före det skede av dödlighet. Denna genetiska teknik har tidigare använts för att positivt märka celler i embryonal muskel som var homozygota med avseende på mutationer i Saga subenheten sgf11 1 </ Sup>.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Acknowledgments

Vi tackar Janice Fischer för att tillhandahålla UAS-EGFP :: Msp-300 KASH plasmid. Den mAB24B10 antikropp erhölls från utvecklingsstudier Hybridoma Bank utvecklats under ledning av NICHDEN och underhålls av University of Iowa, Biologiska institutionen. Repo-GAL4 lager (BL7415) erhölls från Bloomington Stock Center vid Indiana University. Stöd från American Cancer Society Institutional Research Grant (IRG # 58-006-53) till Purdue University Center for Cancer Research är tacksamma. Jingqun Ma stöds av en jordbruksforskning vid Purdue assistent i livsmedel och jordbruk från Purdue University.

Materials

Name Company Catalog Number Comments
Anti-chaoptin antibody (mouse, monoclonal) Developmental Studies Hybridoma Bank mAB24B10
Anti-GFP antibody (mouse, monoclonal) Roche 11814460001 This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.
2x Bullseye EvaGreen qPCR Mastermix with ROX MidSci BEQPCR-R
DAPI (4',6-diamidino-2-phenylindole, dihydrochloride salt) Biotium 40011
Dounce Homogenizer (1 ml) VWR 62400-595
Dumont #5 Tweezers, 11 cm World Precision Instruments 14095
Dynabeads Protein G for Immunoprecipitation Invitrogen 10003D This specific brand of magnetic beads is recommended for this protocol.
EpiScript Reverse Transcriptase Epicentre ERT12910K http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf
Falcon cell strainers, 40 μm pore size VWR 21008-949 Alternative pore sizes could be used, depending on the size of the target cell nuclei.
Magnetic stand (8 x 1.5 ml tubes) Millipore LSKMAGS08 
Mini tube rotator Genemate H-6700
Qubit starter kit Life Technologies Q32871 Similar fluorescence-based methods for quantifying RNA yield could be used. http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ
RNAsecure (Ambion) Life Technologies AM7010 The use of this reagent to inactivate RNAses is optional.
RT-PCR machine Thermal Cycler BioRad CFX Connect Thermal Cycler
Siliconized 9-well glass plate Hampton Research HR3-134
Stereomicroscope Fluorescence Adapter (Royal Blue (440-460 nm) excitation + yellow barrier Nightsea This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)
StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand Nikon SMZ 745
Thermal Cycler BioRad T100
Trizol reagent Life Technologies 15596018 CAUTION; Alternative RNA extraction methods can be used. http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf
Tween 20 Amresco 0777-1L

DOWNLOAD MATERIALS LIST

References

  1. Weake, V. M., et al. Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation. Genes Dev. 25, 1499-1509 (2011).
  2. Bonn, S., et al. Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP. Nat. Protoc. 7, 978-994 (2012).
  3. Haenni, S., et al. Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq. Nucleic Acids Res. 40, 6304-6318 (2012).
  4. Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells. BMC Genom. 8, 340 (2007).
  5. Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei. Plant Physiol. 147, 30-40 (2008).
  6. Deal, R. B., Henikoff, S. The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana. Nat. Protoc. 6, 56-68 (2011).
  7. Deal, R. B., Henikoff, S. A simple method for gene expression and chromatin profiling of individual cell types within a tissue. Dev Cell. 18, 1030-1040 (2010).
  8. Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling. Genom. Res. 22, 766-777 (2012).
  9. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, 401-415 (1993).
  10. Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. Cell type-specific genomics of Drosophila neurons. Nucleic Acids res. 40, 9691-9704 (2012).
  11. Starr, D. A. KASH and SUN proteins. Curr Biol. 21, 414-415 (2011).
  12. Fischer, J. A., et al. Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye. Genetics. 168, 1385-1393 (2004).
  13. Patterson, K., et al. The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye. Mol. Biol. Cell. 15, 600-610 (2004).
  14. Yu, J., et al. The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Dev. Biol. 289, 336-345 (2006).
  15. Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases. Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).
  16. Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye. Fly. 1, 75-85 (2007).
  17. Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes. Nat. Genet. 40, 476-483 (2008).
  18. Sepp, K. J., Schulte, J., Auld, V. J. Peripheral glia direct axon guidance across the CNS/PNS transition zone. Dev. Biol. 238, 47-63 (2001).
  19. Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. Monoclonal antibodies against the Drosophila nervous system. Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).
Affinitetsbaserade Isolering av Tagged Kärnor från<em&gt; Drosophila</em&gt; Vävnader för Gene Expression Analysis
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).More

Ma, J., Weake, V. M. Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis. J. Vis. Exp. (85), e51418, doi:10.3791/51418 (2014).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter