Stimulation of Cytoplasmic DNA Sensing Pathways In Vitro and In Vivo

Summary

The aim of the protocol is to use optimal methods for stimulating the cytoplasmic DNA sensing pathways in cells and in vivo. This is achieved by improving the generation of long, double-stranded DNA during blunt-end ligation. Cells or mice are then transfected using a lipid transfection reagent.

Abstract

In order to efficiently stimulate an innate immune response, DNA must be of sufficient length and purity. We present a method where double stranded DNA (dsDNA) which has the requisite characteristics to stimulate the cytoplasmic DNA sensing pathways can be generated cheaply and with ease. By the concatemerization of short, synthetic oligonucleotides (which lack CpG motifs), dsDNA can be generated to be of sufficient length to activate the cytosolic DNA sensing pathway. This protocol involves blunt end ligation of the oligonucleotides in the presence of polyethylene glycol (PEG), which provides an environment for efficient ligation to occur. The dsDNA concatemers can be used, following purification by phenol/chloroform extraction, to simulate the innate immune response in vitro by standard transfection protocols. This DNA can also be used to stimulate innate immunity in vivo by intradermal injection into the ear pinna of a mouse, for example. By standardizing the concatemerization process and the subsequent stimulation protocols, a reliable and reproducible activation of the innate immune system can be produced.

Introduction

DNA is a vital component of all organisms and cells, which eukaryotes keep in specific compartments. One function of the innate immune system is to identify when such compartmentalization breaks down or when foreign material is introduced into the organism via a breach of physical, external barriers. In the human body there are a number of proteins that exist to help degrade small amounts of DNA which may escape the correct compartmentalization; DNAse I, II, and III break down DNA in the plasma, endosome, and cytosol, respectively. However, it has been shown that mice lacking DNAse II die from severe anemia caused by excessive production of interferons^1<....

Protocol

1. Concatemerization

1. Resuspend primers Fw and Rv (see Table of Materials for primer sequences) to a concentration of 10 µg/µl in molecular biology grade H₂O. Then, mix 5 µl of Fw and 5 µl of Rv primer in a 1.5 ml microcentrifuge tube.
2. Anneal primer mix by heating to the correct annealing temperature (75 °C for the primers described here) for 15 min. Leave on bench to cool down at room temperature (RT). Prepare the 60% PEG8000 during this incubation by dissolving in ddH₂O.
3. Add 50 µl of 60% PEG8000 (to achieve a final concentration of 30%), 10 µl of 10x polynucleotide kinase (P....

Results

The results below indicate that concatemerized DNA can be generated with relative ease and is capable of stimulating a robust innate immune response in cells and in mice. With the use of PEG8000, it can be clearly seen that the length of DNA being generated is significantly longer and equally capable of inducing transcription of Cxcl10. As seen by agarose gel analysis, the standard concatemerization has lengths of DNA of up to 800 base pairs (bp), whereas for the sample with PEG8000, the length of DNA includes strands in.......

Discussion

The protocols described here are used to generate dsDNA to stimulate the cytosolic innate immune response with reproducible results in a wide range of cell types and in vivo. Since the main substrate reagent used is a synthetic oligonucleotide, there is flexibility in this system for using alternative DNA sequences or chemical modifications. It is possible, for instance, to replace the forward strand oligonucleotide described in this protocol with one that contains a fluorescent label or a biotin moiety to track.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Forward primer	Integrated DNA Technologies	n/a	TACAGATCTACTAGTGATCTATGA CTGATCTGTACATGATCTACA
Reverse primer	Integrated DNA Technologies	n/a	TGTAGATCATGTACAGATCAGT CATAGATCACTAGTAGATCTGTA
PEG8000	Sigma-Aldrich	P-4463
Molecular biology grade water	Sigma-Aldrich	W4502-1L
T4 polynucleotide kinase	Promega	M4101
T4 DNA ligase	Promega	M1801
Phenol:chloroform	Fisher Chemical	BPE1752p-400
Chloroform	Fisher Chemical	C/4960/PB08
Ethanol	Sigma-Aldrich	32221-2.5L
DNA gel loading buffer	New England Biolabs	B7021S
Agarose	Bioline	BIO-41025
Optimem	Life Technologies	11058021
TransIT-LT1	Mirus Bioscience	MIR 2300
Hamilton syringe	Hamilton	80901 Model 1705
30 G needles	BD Bioscience	304000
SYBR Safe DNA gel stain	Life Technologies	S33102
Rneasy Plus Mini Kit	Qiagen	74134
Oligo(dT) primer	Thermo Scientific	SO131
dNTP mix	Fermentas	R0192
Super Script III reverse transcriptase	Life Technologies	56575
First strand cDNA synthesis buffer	Life Technologies	y02321
SybrGreen qPCR Fast master mix	Applied Biosystems	4385612
cxcl10 murine forward primer	Integrated DNA Technologies	n/a	ACTGCATCCATATCGATGAC
cxcl10 murine reverse primer	Integrated DNA Technologies	n/a	TTCATCGTGGCAATGATCTC
il6 murine forward primer	Integrated DNA Technologies	n/a	GTAGCTATGGTACTCCAGAAGAC
il6 murine forward primer	Integrated DNA Technologies	n/a	GTAGCTATGGTACTCCAGAAGAC