The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.
Method Article
The present work illustrates the convenience of using sublingual immunotherapy to boost the innate immune response in the lungs and confer protection against acute pneumococcal pneumonia in mouse.
Sublingual route has been widely used to deliver small molecules into the bloodstream and to modulate the immune response at different sites. It has been shown to effectively induce humoral and cellular responses at systemic and mucosal sites, namely the lungs and urogenital tract. Sublingual vaccination can promote protection against infections at the lower and upper respiratory tract; it can also promote tolerance to allergens and ameliorate asthma symptoms. Modulation of lung’s immune response by sublingual immunotherapy (SLIT) is safer than direct administration of formulations by intranasal route because it does not require delivery of potentially harmful molecules directly into the airways. In contrast to intranasal delivery, side effects involving brain toxicity or facial paralysis are not promoted by SLIT. The immune mechanisms underlying SLIT remain elusive and its use for the treatment of acute lung infections has not yet been explored. Thus, development of appropriate animal models of SLIT is needed to further explore its potential advantages.
This work shows how to perform sublingual administration of therapeutic agents in mice to evaluate their ability to protect against acute pneumococcal pneumonia. Technical aspects of mouse handling during sublingual inoculation, precise identification of sublingual mucosa, draining lymph nodes and isolation of tissues, bronchoalveolar lavage and lungs are illustrated. Protocols for single cell suspension preparation for FACS analysis are described in detail. Other downstream applications for the analysis of the immune response are discussed. Technical aspects of the preparation of Streptococcus pneumoniae inoculum and intranasal challenge of mice are also explained.
SLIT is a simple technique that allows screening of candidate molecules to modulate lungs’ immune response. Parameters affecting the success of SLIT are related to molecular size, susceptibility to degradation and stability of highly concentrated formulations.
The overall goal of this work is to illustrate the benefits of sublingual immunotherapy for the treatment of acute respiratory infections (ARI) and present the advantages of this delivery route compared to other routes of administration, namely intranasal.
ARI cause millions of deaths every year especially in children under five. Streptococcus pneumoniae remains as one of the major etiological agents of bacterial pneumonia in infants and the elderly1,2. To present, the main available treatment relies on the use of antibiotics but resistant strains are continuously arising3,4.
SLIT induces broad responses at systemic and also mucosal level, particularly at the respiratory tract5. It has proven effectiveness against influenza infection, promoting long term protection with production of humoral and cellular responses6,7. Besides, it has been shown that prophylactic treatment with bacterial lysates delivered by sublingual route reduced exacerbations of chronic obstructive bronchitis in the elderly8 and prevented recurrent respiratory infections in children9. SLIT has been widely used for the treatment of allergies and asthma. Clinical studies had not only demonstrated its efficacy to modulate the immune response in the respiratory tract but also its safety10. Despite the growing interest of pharmaceutical companies and researchers in SLIT, the mechanisms involved in the induction of mucosal immune responses after sublingual delivery of compounds remain obscure. Recently, attention has been focused on the mechanisms promoting tolerance associated with allergen desensitization. It has been proposed that resident and recruited cells at the sublingual mucosa, like dendritic cells and macrophages, can promote tolerance after SLIT11-13. Dendritic cells of the oral mucosa can promote IFN-gamma and IL-10 producing T helper cells11 as well as recirculate to the distal genital mucosa and promote CD8+ T cells14. However, little is known about the impact of SLIT on innate cells or its capacity to improve pathogen clearance during acute respiratory infections.
The natural control of pneumococcal infection in the lungs greatly depends on the efficient and swift activation of local innate defences. We previously showed that enhancement of lungs’ innate immunity by a single intranasal dose of flagellin (FliC), a TLR5 and NLRC4 agonist, protects 75-100% of mice challenged with a lethal dose of a clinical isolate of Streptococcus pneumoniae serotype 1. This protection was shown to be dependent on local recruitment of GR1+ cells (likely polymorphonuclear neutrophils, PMNs) and not dependent on antibodies, B or T cells15.
Flagellin is the structural component of the bacterial flagellum. In its monomeric form it is recognized by two Pathogen Recognition Receptors (PRRs), TLR5 that senses extracellular FliC16 and NLRC4/NAIP5 inflammasome that detects intracellular flagellin17,18. When FliC is sensed by the PRRs an important inflammatory response is triggered. We and others have demonstrated that instillation of purified FliC from Salmonella enterica serovar Typhimurium into the lungs drives swift production of chemokines and cytokines specially when recognized by the lungs’ epithelium that in turn orchestrate the recruitment of immune cells into the airways, mainly PMNs15,19-21. Although transient, the substantial neutrophil infiltration that takes place into the airways after nasal delivery of FliC could be a concern if moving towards clinical therapies for human use. Excessive inflammation could be detrimental for the lungs’ function. Moreover, it has been shown that intranasal delivery of immunostimulatory molecules may cause facial paralysis and/or brain toxicity22-24.
Sublingual immunotherapy offers a safer alternative to modulate the immune response in the respiratory tract compared to the intranasal route. It is non-invasive, painless, simple and has good patient compliance25. Furthermore, as mentioned before, it can induce protective responses in the respiratory mucosa without the risks associated to direct intranasal or intrapulmonary delivery of formulations. Sublingual route could be alternatively used to deliver molecules that have great effects onto the lung’s immune system but that have been proven to be toxic or to elicit great inflammation when administered intranasally. Besides these advantages, formulations for sublingual immunotherapy have lower cost of manufacture since non-sterile products can be delivered by this route and endotoxic shock is not a concern for SLIT. On the other hand, it is worth noticing that higher doses of the immunostimulatory compounds compared to those used by intranasal or parenteral routes are necessary to induce an immune response in the lungs; also highly concentrated solutions are needed when using the mouse model of SLIT since the anatomical site where the formulations are deposited is small.
Based on our previous published data, we developed a model of protection using sublingual immunotherapy with flagellin as model immunostimulant. We demonstrated that a single dose of flagellin induced 60% survival against invasive pneumococcal pneumonia caused by the serotype 1 strain while all mice in the control group died of infection within 5 days. Flow cytometry analysis showed that higher numbers of PMN are recruited into the airways of protected animals after sublingual treatment with flagellin suggesting that these cells might be involved in the mechanism of protection induced by sublingual immunotherapy.
This video shows in detail how to perform sublingual immunotherapy and also how to recover relevant tissue from the sublingual mucosa, draining lymph nodes as well as lungs and airways to perform further analysis. Additionally, it illustrates the general technique of cell preparation for FACS analysis and briefly shows how to prepare Streptococcus pneumoniae suspensions and how to perform intranasal infections in mouse to set up the acute infection model.
Procedures involving animals were performed in accordance with the protocols N° 071140-000821-12 and 08052010 approved by the Honorary Commission for Animal Experimentation and the Directive Board of the School of Medicine, Universidad de la República – Uruguay.
1. Sublingual Administration of the Therapeutic Agent
2. Preparation of the Bacterial Suspension and Intranasal Challenge with Streptococcus pneumoniae
NOTE: S. pneumoniae is a natural human pathogen that can cause life threatening diseases like invasive pneumonia, sepsis and meningitis. Transmission may occur when inhaled or in contact with mucosa. Therefore, all samples that may have been in contact with S. pneumoniae must be handled in an appropriate Biosecurity Level II facility using a class II biosafety cabinet. Check the Standard Operating Procedures of your institution regarding handling of Type II pathogens for protective clothing, waste disposal and additional security measures that may apply. Infected animals should be kept in individually ventilated cages in isolators equipped with HEPA filters. Anti-pneumococcal vaccines and antibiotic therapy are available. For more information see references27 and 1.
3. Tissue Collection and Sample Preparation for Flow Cytometry (FACS) Analysis
3.1) Tissue collection
3.2) Sample preparation for FACS analysis.
4. Total RNA Extraction, cDNA Synthesis and Real Time PCR.
4.1) RNA extraction and cDNA synthesis.
4.2) Real time PCR (qPCR).
Sublingual immunotherapy can be successfully used to modulate lungs’ immune response. We showed that a single dose of flagellin, the TLR5 and NLRC4 agonist, can induce significant upregulation of the mRNA encoding the chemokines CXCL1, CCL20 and the cytokine IL-6 compared to saline treated controls. Fold induction of mRNA levels peaked at 8 h after SLIT and return to basal levels after 20 hr (Figure 1). However, when SLIT was performed 2 hr prior intranasal infection with S. pneumoniae, levels of Cxcl1 and Il6 mRNA remained significantly upregulated even 24 hr after SLIT compared to non-treated animals (Figure 2).
Analysis of the cell populations in BAL and lung tissue by FACS revealed that animals treated with FliC by sublingual route had increased number of neutrophils in the airways but not in the lungs’ tissue (Figure 3).
Finally, survival after pneumococcal challenge was compared in animals previously treated with FliC by sublingual route or with saline as a control. As shown in Figure 4, SLIT with flagellin promoted protection and increased survival against acute pneumococcal pneumonia.

Figure 1. Kinetics of the lungs’ transcriptional profile after sublingual immunotherapy with flagellin. Eight to 10 weeks old BALB/c mice (n=4) were treated with 10 µg of flagellin or saline by sublingual route under anaesthesia. Lungs were collected at different time points and placed in nucleic acid preservative. Total RNA extraction was performed and cDNA was synthesized. mRNA levels were evaluated by real time PCR using specific primers listed in Table 1. Relative quantification was performed according ΔCt method using Actb mRNA levels for normalization. Results are shown as fold increase compared to saline treated group as median±SEM. Asterisks indicate statistically significant differences (p < 0.05) calculated according to Mann-Whitney test. Results are representative of 2 independent experiments.

Figure 2. Lungs’ transcriptional profile during pneumococcal pneumonia after sublingual immunotherapy with flagellin. Eight to 10 weeks old BALB/c mice (n=4 for control group and n=7 for treated group) were treated with 10 µg of flagellin or saline by sublingual route under anaesthesia. 2 hr later mice were challenged by intranasal route with the minimal lethal dose (MLD) causing 100% mortality of a clinical isolate of S. pneumoniae serotype 1 E1585, corresponding to 4x105 CFU/50 µl. Lungs were collected 24 hr after challenge and stored in nucleic acid preservative until RNA extraction and cDNA synthesis were carried out. Real time PCR was carried out (See primer list in Table 1) and relative quantification was performed according ΔCt method using Actb mRNA levels for normalization. Results are shown as fold increase compared to saline treated group as median±SEM. Asterisks indicate statistically significant differences (p < 0.05) calculated according to Mann-Whitney test.

Figure 3. Analysis of polymorphonuclear neutrophil (PMN) recruitment in lungs’ tissue and airways after SLIT. Eight to 10 weeks old BALB/c mice (n=4) were treated with 10 µg of flagellin or saline by sublingual route under anaesthesia. 2 hr later mice were challenged by intranasal route with the MLD of S. pneumoniae serotype 1 E1585. 24 hr after challenge, BAL was performed and lungs were processed for FACS analysis. PMN were identified as Ly6Ghigh/CD11bhigh/CD11cnegative cells and based on the FCS-SSC profile. Results are expressed as percentage of PMN with respect of total cell numbers in BAL or lungs. Bars represent median±SEM. Asterisks indicate statistically significant differences (p < 0.05) calculated according to one-way Mann-Whitney test.

Figure 4. SLIT with flagellin protects mice against acute pneumococcal pneumonia. Eight to 10 weeks old BALB/c mice (n = 8) were treated with 10 µg of flagellin or saline by sublingual route under anaesthesia. 2 hr later mice were challenged by intranasal route with the MLD of S. pneumoniae serotype 1 E1585. Survival was assessed on a daily basis. Kaplan-Meier curves were compared according Log-rank (Mantel-Cox) test. Asterisks indicate statistically significant differences (p < 0.05).Results are representative of 2 independent experiments.
| Name | Sequence 5’-3’ | PCR Product lenght (bp) |
| mB-actin_F | GCTTCTTTGCAGCTCCTTCGT | 68 |
| mB-actin_R | CGTCATCCATGGCGAACTG | |
| mCCL20_F | TTTTGGGATGGAATTGGACAC | 69 |
| mCCL20_R | TGCAGGTGAAGCCTTCAACC | |
| mCXCL1_F | CTTGGTTCAGAAAATTGTCCAAAA | 84 |
| mCXCL1_R | ACGGTGCCATCAGAGCAGTCT | |
| mIL-6_F | GTTCTCTGGGAAATCGTGGAAA | 78 |
| mIL-6_R | AAGTGCATCATCGTTGTTCATACA | |
| mTNFalpha_F | CATCTTCTCAAAATTCGAGTGACAA | 63 |
| mTNFalpha_R | CCTCCACTTGGTGGTTTGCT | |
| mCxcl2_F | CCCTCAACGGAAGAACCAAA | 72 |
| mCxcl2_R | CACATCAGGTACGATCCAGGC |
Table 1. Primer list used for real time PCR analysis. Specific primer sequences used for qPCR analysis. Forward and reverse primers for mouse actb, Cccl20, Cxcl1, Il6, Tnfa and Cxcl1 are presented as 5’-3’ sequences and expected product length is indicated in base pairs (bp).
Sublingual administration of therapeutic agents has been proven as a useful means to modulate the immune response in the respiratory tract. The main advantage of SLIT for the treatment of respiratory conditions is that it does not involve direct delivery of compounds into the lungs or nostrils, being safer than treatments based on intranasal administration31.
Sublingual immunotherapy can be used to modulate the immune response in different ways, either for induction of regulatory responses that can ameliorate the symptoms of allergic inflammation and asthma32 or to induce transient activation of innate immune mechanisms to treat acute lung infections as shown here.
The mouse model presented in this video is a convenient method for screening of different compounds as therapeutic agents for SLIT.
This animal model offers a useful means to determine the impact of SLIT in the lungs’ immune response as well as in other organs (e.g., draining lymph nodes or distal mucosal sites) that cannot be mimicked by the use of in vitro models. Although there are several papers that describe results obtained using sublingual immunotherapy, detailed methods for the procedures of sublingual administration have not been made available yet. Additionally, the model can be used for evaluation of sublingual vaccines aiming to confer systemic as well as local protection in the respiratory tract.
As shown in the accompanying video, sublingual administration of compounds is a simple procedure that can be easily performed without the need of extensive training. Typically, a person proficient in animal handling will require 1 hr to perform SLIT in a group of 10 mice using injectable anesthetics as described in this protocol. If pneumococcal challenge is performed as well, 90 additional min will be required to prepare the bacterial suspension and perform intranasal challenge of the animals.
The FACS protocols presented here allow convenient characterisation of impact of the SLIT at the local site of administration, draining lymph nodes as well as their effects on the lungs’ cell dynamics.
Separate analysis of the bronchoalveolar content and lung parenchyma is important to discriminate the airways’ immune resident and infiltrating cell types from those that remain within the tissue. Analysis of the BAL content allows the study of alveolar macrophage turnover as well as the dynamics of cells recruitment into the alveolar spaces induced by different treatments, e.g., PMNs, eosinophils, monocytes. BAL can also be used to assess presence of secreted cytokines and chemokines by Enzyme-linked Immunosorbent Assay (ELISA) or detection of secreted IgA antibodies elicited after sublingual vaccination. Study of the lungs’ tissue will allow characterisation of other cell types, classically dendritic cells, T cells and B cells.
Preparation of BAL samples and lymph nodes for FACS analysis is simple. After sample collection, normally 60 min are required to complete the staining protocol for 10-20 samples. In contrast, isolation of cells from lungs or sublingual tissue will require more time since digestion of the extracellular matrix is required. Absorption of the therapeutic agent delivered by sublingual route can be addressed by tracking of fluorescently or radioactively labelled molecules using in vivo imaging systems.
Sublingual immunotherapy is an attractive method to effectively induce immune responses in the respiratory tract as well as systemically that can be used to treat or prevent respiratory conditions. Elucidation of the mechanisms determining activation vs tolerance of the immune response in the respiratory tract after SLIT is crucial to allow rational design of new therapeutic strategies that could be used alone or in combination with available treatments against different respiratory conditions.
The authors have nothing to disclose.
We acknowledge Dr. Jean-Claude Sirard from the Center for Infection and Immunity of Lille, Institute Pasteur de Lille-France, for kindly providing the purified flagellin and Dr. Teresa Camou, Director of the National Reference Laboratory, Ministry of Health of Uruguay for kindly providing the pneumococcal strain.
The authors would like to express their acknowledgement to Mr. Diego Acosta and Mr. Ignacio Turel form BichoFeo Producciones-Uruguay for their commitment and hard work during the entire video production and edition.
This work was supported by the grants PR_FCE_2009_1_2783 and BE_POS_2010_1_2544 from the National Agency of Research and Innovation, ANII from Uruguay, the Program for Development of Basic Sciences, PEDECIBA of Uruguay and Sectoral Commission of Scientific research, CSIC-Universidad de la República, Uruguay.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Ketamine solution (50 mg/ml) | Pharma Service, Uruguay | ||
| Xilacine solution (2 %) | Portinco S.A., Uruguay | ||
| Sterile 1 ml syringe | Modern, Uruguay | ||
| Sterile 27 G needle | Modern, Uruguay | ||
| RPMI 1640 | General Electric Health Care | E15885 | |
| Fetal Bovine Serum | ATCC | 302020 | |
| Penicillin/Streptomycin Solution | SIGMA | P4333 | |
| Sterile PBS without Ca2+/Mg2+ | PAA | H21002 | |
| Type-I Collagenase | Life Technologies/Gibco | 17100017 | |
| Deoxyribonuclease I (DNAse-I) | SIGMA | D4513 | |
| Dispase | Life Technologies/Gibco | 17105041 | |
| PerCP-Cy5.5 conjugated rat anti mouse IgG2b anti CD11b | BD | 550993 | Clone M1/70 |
| APC conjugated hamster anti mouse IgG1 anti CD11c | BD | 550261 | Clone HL3 |
| APC-Cy7 conjugated rat anti mouse IgG2a anti Ly6G | BD | 560600 | Clone 1A8 |
| Sterile Saline Solution | Laboratorio Farmaco Uruguayo, Uruguay | ||
| Tryptic Soy Agar | BD Difco, France | 236950 | |
| Defibrinated Sheep Blood | Biokey, Uruguay | ||
| Sterile Petri Dishes | Greiner | 633180 | |
| p10 Pipette | Gilson | F144802 | |
| p20 Pipette | Eppendorf | 3120000097 | |
| p200 Pipette | Gilson | F123601 | |
| p200 Pipette | Capp | C200 | |
| p200 Pipette | Eppendorf | 3120000054 | |
| p1000 Pipette | Eppendorf | 3120000062 | |
| Sterile Filter Tips p10 | Greiner | 771288 | |
| Sterile Filter Tips p200 | Greiner | 739288 | |
| Sterile Filter Tips p1000 | Greiner | 750288 | |
| Vortex | BIOSAN | V1-plus | |
| Stainless steel fine tip forceps | SIGMA | Z168785/Z168777 | Curved and straight |
| Dressing tissue forceps | SIGMA | F4392 | Length 8 inches |
| Micro-dissecting forceps | SIGMA | F4017 | Straight |
| Micro-dissecting forceps | SIGMA | F4142 | Curved |
| Mayo Scissors | SIGMA | Z265993 | |
| Scalpel | SAKIRA MEDICAL | ||
| Sterile Biopsy Punch Ø 3mm | Stiefel Laboratories Ltd. | 2079D | 5 mm diameter can also be used |
| Sterile 1.5 ml Tubes | Deltalab | 200400P | |
| Sterile 15 ml Tubes | Greiner | 188271 | |
| Sterile 50 ml Tubes | Greiner | 227261 | |
| Sterile serological pipettes 5 ml | Greiner | 606160 | |
| Sterile serological pipettes 10 ml | Greiner | 607160 | |
| Sterile serological pipettes 25 ml | Greiner | 760180 | |
| Biological safety cabinet, class II | Thermo Scientific | 1300 series, type A2 | |
| Micro-Isolator Rack | RAIR IsoSystem | 76144W | Super Mouse 1800 AllerZone |
| Refrigerated Microcentrifuge | Eppendorf | Legend Micro 21R | |
| Microcentrifuge | Heraeus | Biofuge-pico | |
| Centrifuge | Thermo Scientific | Sorval ST40R | |
| CO2 Incubator | Thermo Scientific | Model 3111 | |
| Sterile Thin-tip pasteur pipettes | Deltalab | D210022 | |
| Sterile pasteur pipettes | Deltalab | 200007 | |
| Sterile 24-well plate | Greiner | 662160 | |
| Trypan Blue Solution | Life Technologies | T10282 | |
| Automatic Cell Counter - Countess | Life Technologies | C10227 | |
| Countess Cell Counting Chamber Slides | Life Technologies | C10312 | |
| Flow Cytometry Tubes | BD | 343675 | |
| Flow Cytometer - FACS Canto-II | BD | ||
| Real Time PCR Instrument - Rotor Gene Q or ABI 7900 | Qiagen / Applied Biosystems | ||
| Trizol Reagent | Life Technologies | 15596-026 | Molecular Biology Grade |
| DNAse-I | Life Technologies | 18068-015 | Molecular Biology Grade |
| DNAse-I Buffer 10X | Life Technologies | 18068015 | Molecular Biology Grade |
| EDTA 25 mM | Life Technologies | 18068015 | Molecular Biology Grade |
| Ultra-Pure Water | Life Technologies | 10977 | Molecular Biology Grade |
| RNAse Out | Life Technologies | 100000840 | Molecular Biology Grade |
| Random Hexamer Primers | Life Technologies | N8080127 | Molecular Biology Grade |
| M-MLV-RT buffer | Life Technologies | 18057-018 | Molecular Biology Grade |
| M-MLV-RT enzime | Life Technologies | 28025-021 | Molecular Biology Grade |
| QuantiTect Syber Green PCR Kit | Qiagen | 204143 | Molecular Biology Grade |
| Specific primers | Life Technologies | Molecular Biology Grade |