Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

Summary

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Abstract

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

Introduction

The concept of maternal immune activation (MIA) originates from the epidemiology studies on the association of maternal infection with autism and schizophrenia¹. Due to the absence of detectable replicating viral pathogens in the placenta or the fetal brain after maternal viral infection^2,3, the effect of the infection on the offspring is hypothesized to be caused by the activation of the maternal immune system rather than the pathogens themselves.

To elucidate the cause-and-effect relationship between MIA and psychiatric disorders, injection of chemically synthesized, viral mimic double stranded RNA polyinosinic:polyc....

Protocol

All protocols were performed under the approval of the California Institute of Technology Institutional Animal Care and Use Committee (IACUC).

1. Preparation for Timed-mating Pairs

1. Use at least 6 dams for behavioral experiments and 3 for gene expression analysis.
   NOTE: Use double the number of estimated female mice, as only about 50% of the mice will be plugged from the timed-mating.
2. Use female mice with no prior pregnancy and at 8-16 weeks of age.
   NOTE: Female mice that have prior sexual exposure to male mice but have not been pregnant are acceptable.
3. House the female mice together and place th....

Results

Injection of 20 mg/kg poly(I:C) at E12.5 could evoke an acute inflammatory response in the maternal-placental-fetal axis and precipitate a chronic effect to brain development and behavioral phenotypes^12,13. Elevated levels of a proinflammatory cytokine, Interleukin (IL)-6, is a reliable indicator of acute inflammatory response after MIA. The peak time for Il6 gene expression in the placenta and fetal brain is at 3 hr post-poly(I:C) injection^12,13. We have sh.......

Discussion

MIA induction at different time windows perturbs different brain development events in rodents, and consequently leads to different behavioral abnormalities and neuropathologies in the offspring. Here, we described a protocol to induce MIA in mice with poly(I:C) injection at E12.5. This method of MIA induction leads to behavioral, neurological, immunological, and gastrointestinal abnormalities associated with autism and schizophrenia in the offspring^8,10,11,16. It is important to note that, because MIA is an e.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Polyinosinic–polycytidylic acid potassium salt	SIGMA	P9582
0.9% sodium chloride INJ. USP	HOSPIRA	NDC 0409-4888-10
MONOJECT insuline syrinage 3/10 ml 29 G x 1/2"	COVIDIEN	8881600145
50 ml conical screw cap tubes	USA SCIENTIFIC	1500-1211
Nanodrop 1000 spectrophotometer	THERMO SCIENTIFIC	1000	Optional
Stereomicroscope	Wild Heerbrugg	M5A	Optional
Dumont #5 Forceps Inox Tip Size .10 X .06 mm	Roboz	RS-5045	Optional
RNAlater RNA stabilization reagent	Qiagen	76104	Optional
TRIzol reagent	Life Technologies	15596-026	Optional
RQ1 Rnase-free DNase	Promega	M610A	Optional
iScript cDNA synthesis kit	Bio-Rad	170-8891	Optional
FastStart universal SYBR green master mix with ROX	Roche	4913922001	Optional
Real-time PCR	ABI	7300	Optional
Primer: Il6 forward	Life Technologies	TAGTCCTTCCTACCCCAATTTCC	Optional
Primer: Il6 Reverse	Life Technologies	TTGGTCCTTAGCCACTCCTTC	Optional
Primer: beta-actin forward	Life Technologies	AGAGGGAAATCGTGCGTGAC	Optional
Primer: beta-actin Reverse	Life Technologies	CAATAGTGATGACCTGGCCGT	Optional
MicroAmp optical 96-well reaction plate	Life Technologies	4306737	Optionl
MicroAmp optical adhesive film	Life Technologies	4311971	Optionl
EthoVision	Noldus	EthoVision	Optionl
SR-LAB apparatus (PPI)	San Diego Instruments	SR-LAB	Optionl
Marbles	PENN-PLAX	Blue gem stones marbles	Optionl
Dulbecco's Phosphate-Buffered Saline (DPBS)	Life Technologies	21600-069	Optionl
Paraformaldehyde	MACRON	2621-59	Optionl
Vibratome	Leica	VT1000 S	Optionl
Sodium azide	Sigma	S2002	Optionl
Triton x-100	Sigma	X100	Optionl
Hydrogen peroxide solution	Sigma	18312	Optionl
Goat serum	Vector Laboratories	S-1000	Optionl
Rabbit anti-calbindin antibody	Abcam	ab11426	Optionl
Biotinlyated goat anti-rabbit IgGantibody	Vector Laboratories	BA-1000	Optionl
VECTASTAIN ABC Kit	Vector Laboratories	PK-4000	Optionl