Here, we describe a method for the purification of differentiated human embryonic stem cells that are committed towards the definitive endoderm for the improvement of downstream applications and further differentiations.
Method Article
Here, we describe a method for the purification of differentiated human embryonic stem cells that are committed towards the definitive endoderm for the improvement of downstream applications and further differentiations.
The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell replacement therapies. Terminally differentiated cell types could be used for the treatment of various degenerative diseases. In vitro differentiation of these cells towards tissues of the lung, liver and pancreas requires as a first step the generation of definitive endodermal cells. This step is rate-limiting for further differentiation towards terminally matured cell types such as insulin-producing beta cells, hepatocytes or other endoderm-derived cell types. Cells that are committed towards the endoderm lineage highly express a multitude of transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family, and the surface receptor CXCR4. However, differentiation protocols are rarely 100% efficient. Here, we describe a method for the purification of a CXCR4+ cell population after differentiation into the DE by using magnetic microbeads. This purification additionally removes cells of unwanted lineages. The gentle purification method is quick and reliable and might be used to improve downstream applications and differentiations.
Pluripotent stem cells such as embryonic stem cells (ESCs) have the capability to differentiate into virtually any cell type of the human body. Thus, in vitro differentiation protocols can be used to generate numerous adult cell types such as cardiomyocytes1, hepatocytes2, beta cells3, lung epithelial4 or neuronal cells5. This makes ESCs a valuable tool for the potential treatment of various degenerative diseases3.
The in vitro differentiation of ESCs towards adult tissues of the lung, liver and pancreas requires a pseudo-gastrulation into cells reminiscent of the definitive endoderm (DE)6. Since downstream differentiation towards the aforementioned somatic cell types is significantly less efficient, an optimal endoderm differentiation is regarded as rate-limiting7. Cells that are committed towards the endoderm lineage undergo characteristic changes in their gene expression profile. Pluripotency master regulator genes are down regulated, whereas the expression of other transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family and the surface receptor CXCR4 is highly upregulated6, 8, 9. CXCR4 is known to be transactivated by SMAD2/3, downstream of Nodal/TGF-β signaling and SOX17 due to specific binding sites in its promoter region10. Thus it is a very suitable marker used in a number of reports6, 8, 11-13. These expression changes reflects a pseudo-gastrulation event, in which ESCs first acquire characteristics of a primitive streak-like cell population and subsequently commit into the endoderm germ layer6.
However, differentiation protocols are rarely 100% efficient as a few cells may resist the differentiation process or differentiate towards other unintended lineages14. These cells may negatively influence further differentiation. Furthermore, residual undifferentiated cells harbor great risks for later transplantation experiments and may give rise to teratomas15-17.
To remove these unwanted cells early-on the surface marker CXCR4 can be used for the purification of cells that are committed towards the DE18. Here, we describe a method for the positive selection of CXCR4+ cells from DE differentiation cultures. For this, the surface marker CXCR4 is bound by an antibody which then in turn binds to magnetic microbeads. Unlike the harsh conditions during FACS sorting, the magnetically labeled DE-like cells can then easily be purified in a benchtop format using a gentle purification method. This protocol provides a straightforward method for the removal of cell populations that resisted the DE differentiation process.
Access restricted. Please log in or start a trial to view this content.
1. Differentiation of Human ESC towards the Definitive Endoderm
2. Staining of CXCR4+ Definitive Endoderm Cells for Flow Cytometry Analysis
3. Magnetic Separation of CXCR4+ Cells
4. Optional: Analysis of Purified Definitive Endoderm Population
Access restricted. Please log in or start a trial to view this content.
Upon differentiation ESCs undergo drastic changes in gene and protein expression. Figure 1 depicts typical marker genes that can be used to verify a successful endoderm differentiation. Prime targets for a gene expression analysis are GSC, FOXA2, and SOX17. In a relative gene expression analysis especially FOXA2 and SOX17 are increased by > 2,000 fold when compared to undifferentiated ESCs. GSC is a...
Access restricted. Please log in or start a trial to view this content.
Currently used differentiation protocols rarely result in 100% differentiated cells. For reasons that still have to be addressed some cells resist the differentiation process. Depending on the efficiency of the used differentiation protocol and the propensity of the ESC line a certain number of residual pluripotent cells are commonly observed even after differentiation into the definitive endoderm. These residual cells may impair downstream differentiations or further analysis such as transcriptomics, proteomics, and miR...
Access restricted. Please log in or start a trial to view this content.
The authors declare that they have no competing financial interests.
The skillful technical assistance of Jasmin Kresse is gratefully acknowledged.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Hues8 human embryonic stem cell line | Harvard Department of stem cell & regenerative biology | Suitable cell line for endoderm generation | |
| Hes3 human embryonic stem cell line | ES Cell International | Suitable and robust cell line for endoderm generation | |
| mTeSR1 | Stemcell Technologies | 5850 | ESC culture medium |
| FCS | Biowest | S1860 | |
| Advanced RPMI 1640 | Life Technologies | 12633012 | |
| CD184 (CXCR4)-APC, human | Miltenyi Biotec | 130-098-357 | |
| anti-APC MicroBeads | Miltenyi Biotec | 130-090-855 | |
| OctoMACS Separator | Miltenyi Biotec | 130-042-109 | magnetic field |
| Y-27632 | Selleck Chemicals | S1049 | ROCK inhibitor |
| CHIR-99021 | Tocris Bioscience | 4423 | |
| Activin A | Peprotech | 120-14 | |
| Gentle Cell Dissociation Reagent | Stemcell Technologies | 7174 | Enzyme-free passaging solution, alternative: Trypsin/EDTA |
| Matrigel* | Corning | 354277 | basement membrane matrix * solve and store in aliquots at -80 °C as outlined in the suppliers manual. Upon use, thaw on ice, dilute in 25 ml ice-cold knockout DMEM/F-12. Add 1 ml to each well of a 6-well plate and incubate for 45 min at room temperature. Remove the matrigel and use immediately. |
| MS Columns | Miltenyi Biotec | 30-042-201 | |
| MACS Separator | Miltenyi Biotec | 130-042-302 | |
| Human FOXA2 FW gggagcggtgaagatgga | Life Technologies | NA | |
| Human FOXA2 REV tcatgttgctcacggaggagta | Life Technologies | ||
| Human GSC FW gaggagaaagtggaggtctggtt | Life Technologies | ||
| Human GSC REV ctctgatgaggaccgcttctg | Life Technologies | ||
| SOX17 TaqMan assay | Applied Biosystems | Hs00751752_s1 | |
| Human SOX7 FW gatgctgggaaagtcgtggaagg | Life Technologies | ||
| Human SOX7 REV tgcgcggccggtacttgtag | Life Technologies | ||
| Human POU5F1 FW cttgctgcagaagtgggtggagg | Life Technologies | ||
| Human POU5F1 REV ctgcagtgtgggtttcgggca | Life Technologies | ||
| Human Nanog FW ccgagggcagacatcatcc | Life Technologies | ||
| Human Nanog REV ccatccactgccacatcttct | Life Technologies | ||
| Human TBP FW caa cag cct gcc acc tta cgc tc | Life Technologies | ||
| Human TBP REV agg ctg tgg ggt cag tcc agt g | Life Technologies | ||
| Human TUBA1A FW ggc agt gtt tgt aga ctt gga acc c | Life Technologies | ||
| Human TUBA1A REV tgt gat aag ttg ctc agg gtg gaa g | Life Technologies | ||
| Human G6PD FW agg ccg tca cca aga aca ttc a | Life Technologies | ||
| Human G6PD REV cga tga tgc ggt tcc agc cta t | Life Technologies | ||
| Anti-SOX2 | Santa Cruz Biotechnology | sc-17320 | |
| Anti-FOXA2 | MerckMillipore | 07-633 | |
| Anti-SOX17 | R&D Systems | AF1924 |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission