Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Summary

Astrocytes are one of the most important key players in the central nervous system (CNS). Here, we are reporting a practical method of sexed hippocampal astrocyte culture protocol in order to study the mechanisms underlying the astrocyte function in male and female neonate pups after in-vitro ischemia.

Abstract

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies indicate that the severity of brain injury appear to be sex dependent, and that the male neonates are more susceptible to the effects of HI-related brain injury, resulting in more severe neurological outcomes as compared to females with comparable brain injuries. The development of reliable methods to isolate and maintain highly enriched populations of sexed hippocampal astrocytes is essential to understand the cellular basis of sex differences in the pathological consequences of neonatal HI. In this study, we describe a method for creating sex specific hippocampal astrocyte cultures that are subjected to a model of in-vitro ischemia, oxygen-glucose deprivation, followed by reoxygenation. Subsequent reactive astrogliosis was examined by immunostaining for the Glial Fibrillary Acidic Protein (GFAP) and S100B. This method provides a useful tool to study the role of male and female hippocampal astrocytes following neonatal HI, separately.

Introduction

Astrocytes are one of the most important key players in the central nervous system (CNS). Growing body of evidence indicates that the roles of astrocytes are more than providing neuronal support. In fact, the roles of astrocytes under physiological conditions can be very complex, such as guiding the migration of the developing axons¹, regulating CNS blood flow², maintaining the pH homeostasis of the synaptic interstitial fluid³, and participating in the blood brain barrier⁴ and synaptic transmission⁵. Under pathological conditions, astrocytes respond to injury with a process called reactive astrogliosis in which the morphology, number, location, topography (with respect to distance from insult) and function of the astrocytes may change in a heterogeneous way^6,7. Astrogliosis seen following neonatal hypoxic ischemic encephalopathy maybe contributing to the morbidity and mortality of neonates⁸.

Recent clinical and experimental studies indicate that the severity of brain injury appears to be sex-dependent and that the male neonates are more susceptible to the effects of hypoxia/ischemia (HI)-related brain injury, resulting in more severe neurological outcomes as compared to females with comparable brain injuries^9-11. Although the localization of the injury depends on the gestational age and the duration and the severity of the insult, hippocampus is one of the most commonly effected regions in the CNS after term neonatal HI, and increased hippocampal astrogliosis has been confirmed by up-regulation of the Glial Fibrillary Acidic Protein (GFAP) 3 d after the neonatal HI^7,10,12,13. Sex differences in astrocyte function were shown in both neonates and adult rodents after cerebral ischemia^14,15. In addition, male astrocytic susceptibility to in-vitro ischemia was shown by increased cell death compared to female cortical astrocytes in culture¹⁶.

Sex differences start in-utero and continue until death¹⁷. Over the last decade, the importance of including the sexes in experimental conditions in cell culture and in-vivo studies have been the emphasis of the Institute of Medicine and NIH to seek fundamental knowledge in the sex differences seen in physiological and pathological conditions^17,18. Development of reliable methods to isolate and maintain populations of sexed hippocampal astrocytes is essential to understand the cellular basis of sex differences in the pathological consequences of neonatal HI. The present study was designed to provide the techniques to prepare enriched sex-specific hippocampal astrocyte cultures from newborn mice in order to assess the roles of GFAP-immunoreactive astrocytes following Oxygen/Glucose Deprivation (OGD) and reoxygenation (REOX), inducing HI in cell culture environment. This technique can be used to test any hypothesis pertaining to hippocampal astrocytes in neonatal males and females under normoxic and ischemic conditions.

Protocol

NOTE: This study was conducted in accordance with the recommendation of the Guide for the Care and Use of Laboratory Animals of the National Institute of Health. The animal protocol was approved by the University of Wisconsin-Madison, Institutional Animal Care and Use Committee. Primary Astrocyte Culture protocol that is presented here is adopted from the protocols presented by Zhang Y¹⁹ et al. and Cengiz P²⁰ et al. with some modifications.

1. Hippocampal Dissection and Astrocyte Culture

1. Prepare all necessary reagents and materials including surgical scissors, smooth fine forceps, flat tip forceps, paper towels, waste bag, 70% ethanol and 2 dissecting dishes (3.5 cm diameter) on ice filled with 2 mL Hank's Balanced Salt Solution (HBSS) each. Make sure the surgical equipment's are sterile (autoclave) prior to procedure and use all other materials (Astrocyte plating medium: DMEM + 5% horse serum + 1% penicillin-streptomycin, horse serum, HBSS, 0.25% trypsin, glass coverslips, Petri dishes, 15/50 mL tubes, T25 flasks, etc.) as pre-sterile.
2. Gently hold and spray the head and neck of mouse pup with 70% ethanol and decapitate using sharp sterile scissors [Figure 1 (1)].
3. Perform a midline incision from posterior to anterior skull with small scissors along the scalp to expose the brain [Figure 1 (2-3)].
4. Cut the cranium carefully from the neck to the nose with small scissors. Then cut cranium anterior to the olfactory bulbs and inferior to the cerebellum to disconnect the cranium from the skull base.
5. Make a small incision at the base of the skull and cut along the midline. Use sterile flat-tip forceps to peel away the skull. Remove the brain stem with the help of a curved forceps. Remove brain from the cranium and place into the first dissecting dish [Figure 1 (4-9)]²¹.
6. Using a curved forceps, flip the brain so that the ventral surface of the brain is facing up and then separate both hemispheres with a sharp sterile surgical blade [Figure 1 (10,11)]
7. Peel back the cerebral hemispheres and carefully remove the bulging midbrain and thalamic tissue with a sterile flat curved forceps to reveal the hippocampus, a small, seahorse-shaped structure in the medial temporal lobe [Figure 1 (12-14)].
8. Remove both the hippocampal lobes [Figure 1 (15,16)] and carefully dissect the meninges from the lobes by pulling with the fine forceps. This step avoids contamination of the final astrocyte culture by meningeal cells and fibroblasts.
9. Transfer the prepared hippocampal lobes into the second dish filled with HBSS and return it onto ice [Figure 1 (17,18)]. Pool both hippocampal lobes from a single mouse (P0 - P2) for preparation of hippocampal astrocyte cultures. This gives the astrocyte proper density. Mince hippocampal lobes using a sharp sterile surgical blade (approximately 4 times).
10. Aspirate HBSS from dish using a sterile tip attached to a 1 mL pipette and add 3 mL of 0.25% trypsin, mix, transfer to a 15 mL sterile conical tube and incubate the tissue at 37 °C for 20 min with gentle shaking.
11. Centrifuge tube at 300 x g for 5 min. Aspirate supernatant carefully using a sterile glass pipette attached to a vacuum line. Add 10 mL astrocyte plating medium and triturate (20 - 30 times) using a fire polished glass pipette until tissue pieces homogenize.
12. Centrifuge tube at 300 x g for 5 min. Aspirate supernatant and add 2 mL of fresh prewarmed astrocyte plating media. Pass cells through a 70 μm mesh filter (cell strainer) into a new 50 mL conical tube.
13. Plate entire cell suspension on a Poly-D-Lysine/Laminin coated sterile T25 culture flask containing 3 mL of astrocyte plating media, then incubate the flask at 37 °C in a 5% CO₂ incubator.
14. Aspirate entire media at day-in-vitro (DIV) 1, DIV 3 and DIV 7, and replace with 2 mL of fresh astrocyte plating media. Observe the progression and astrocytic confluence under light microscope each time while replacing the astrocyte plating media.
    NOTE: At DIV 1, all the viable astrocytes are attached to the surface of the culture flask and the dead or dying cells that include neurons are floating in the supernatant. At DIV 3, the attached cells start to divide to form astrocytic cell layer. In the absence of the supportive conditions, culture is almost devoid of any neuronal growth. At DIV 7, astrocyte layer is about 80 - 90% confluent and a few microglia as well as oligodendrocyte precursor cells are present on top of the astrocytic layer.
15. Aspirate the plating medium from the flask, add 2 mL of fresh prewarmed astrocyte plating medium, rinse and remove again at DIV 11, when astrocytes are confluent and ready for sub culturing.
16. Add 2 mL of 0.25% trypsin, gently rotate the flask a few times and aspirate trypsin using a sterile glass pipet.
17. Add 2 mL of 0.25% trypsin and let the flask sit in the tissue culture hood for 4 - 5 min at RT.
18. Remove the trypsin and keep the flask at 37 °C in a 5% CO₂ incubator for 10 min. Add 5 mL prewarmed astrocyte plating medium and detach the astrocytic layer by tapping the flask against the palm of your hand (3 - 4 times) followed by gentle trituration to achieve complete detachment and collect the astrocytes in a 15 mL conical tube.
19. Centrifuge tube at 300 x g for 5 min, aspirate the supernatant, and add 1 mL fresh astrocyte plating medium.
20. Add 10 μL of the cell suspension to a hemocytometer and count the cells in the large central gridded area (1 mm²) using an inverted phase contrast microscope (10X objective). Multiply by 10⁴ to estimate the number of cells per mL. One T25 flask will yield ~1 x 10⁶ total dissociated cells. Seed ~1 x 10⁵ cells in 2 mL astrocyte plating medium on a 12 mm diameter Poly-D-Lysine precoated glass coverslip in the well of a 24-well culture dish.
21. Incubate at 37 °C in a 5% CO₂ incubator. Perform OGD/REOX at DIV 12 - 14 (section 2).
22. Treat the astrocyte cultures at DIV 3 with 5 mM L-leucine Methyl Ester (LME) hydrochloride until DIV 11 if hippocampal cultures devoid of microglia are desired. After LME incubation, subject cultures to shaking (300 rpm for 1 h) to remove contaminating microglia.
    NOTE: LME is a microglial cytotoxic agent that has been used extensively as a method to eliminate proliferating microglia²².

2. OGD/REOX Treatment

1. Aspirate media from coverslip containing adherent astrocyte culture (DIV 12 - 14) and rinse 3 times by gently rotating the 24-well culture dish holding the coverslip a couple times with 1 mL isotonic OGD solution (pH 7.4) containing (in mM): 0 glucose, 21 NaHCO₃, 120 NaCl, 5.36 KCl, 0.33 Na₂HPO₄, 0.44 KH₂PO₄, 1.27 CaCl₂, and 0.81 MgSO₄.
2. Add 0.2 mL OGD solution to well to cover the coverslip and incubate for 2 h in a hypoxic incubator containing 94% N₂, 1% O₂, and 5% CO₂. Gently mix with an orbital shaker (50 rpm) for the first 30 min of hypoxia to facilitate gas exchange.
3. Incubate normoxic control cells for 2 h in 5% CO₂ and atmospheric air in a buffer identical to the OGD solution except for the addition of 5.5 mM glucose.
4. For REOX, aspirate OGD solution and add 2 mL of astrocyte plating medium. Incubate in 5% CO₂ and atmospheric air at 37°C for 5 h.

3. Immunocytochemical Staining

1. Aspirate the culture media using a sterile glass pipette attached to a vacuum line and quickly rinse coverslip once by adding 1mL of 0.1 M Tris Buffered Saline (TBS) (154 mM NaCl, 16 mM Trizma Base, 84 mM Tris-HCl, pH 7.4) to the well. Aspirate and add 2 mL of 4% paraformaldehyde (PFA) in 1x Phosphate Buffered Saline (PBS). Incubate for 15 min at RT.
2. Aspirate and add 1 mL of 0.1 M TBS, then place on a rocking shaker for 2 min. Repeat 3 times. Add 1 mL blocking solution (10% goat serum, 10 mg/mL BSA, 0.025% Triton X-100 in 0.1 M TBS) and incubate for 30 min at 37 °C on a rocking shaker.
3. Aspirate blocking solution and add primary mouse monoclonal anti-GFAP antibody (0.2 mL of a 1:500 dilution in blocking solution) and rabbit polyclonal anti-S100B (1:500) or rabbit polyclonal anti-HIF1α (1:200) for 60 min at 37 °C on a rocking shaker.
4. Alternately, some astrocytes are incubated with rabbit polyclonal anti-IBA1 (1:200) and mouse monoclonal anti-MAP2 to access culture purity.
5. Aspirate primary antibody and rinse coverslip by adding 1 mL of 0.1 M TBS and placing on a rocking shaker for 2 min and then aspirate. Repeat twice.
6. Add 0.2 mL of a 1:200 dilution of the secondary goat anti-rabbit 488-conjugated and anti-mouse 568-conjugated antibodies in blocking solution for 60 min at 37 °C on a rocking shaker.
7. Aspirate secondary antibody and rinse coverslip by adding 1 mL of 0.1 M TBS and place on a rocking shaker for 2 min and then aspirate. Repeat twice.
8. Remove coverslip from well and dry by placing on a slide positioned on a slide-drier. Mount coverslip on a new slide by inverting on a single drop of VECTASHIELD hardset mounting medium with DAPI (1.5 ng/μL).
9. Image coverslips on a confocal microscope using either 20X dry or 60X oil objective. Acquire images (512 x 512) for DAPI (405 nm ex / 450 nm em) and fluorochrome 488 tagged GFAP antibody (488 nm ex / 515 nm em). Keep acquisition parameters constant within the 20X and 60X groups.

4. Sex Determination Using PCR

1. Heat pup toe or finger clippings at 95 °C for 45 min in 50 mM NaOH and neutralize with equal volume of 1 M Tris, pH 6.8.
2. Add 1 μL of the extracted DNA solution to 19 μL of the following mixture: 5 pmoles of primers for the Myog and Sry genes, 1x reaction buffer, 0.2 mM each deoxynucleotide and 8 U Taq polymerase.
3. Use primers sequences; Sry 5'TCATGAGACTGCCAACCACAG3', 5'CATGACCACCACCACCACCAA3' and Myog 5'TTACGTCCATCGTGGACAGC3', 5'TGGGCTGGGTGTTAGTCTTA3'²³.
4. Perform the following PCR protocol: 95 °C for 3 min then 30 cycles of denaturation at 95 °C for 15 s, annealing at 58 °C for 15 s, and elongation at 72 °C for 1 min. Following this 30 cycles, the reaction concludes with a final 72 °C elongation for 1 min.
5. Separate PCR products electrophoretically on an ethidium bromide-containing 2% agarose gel and visualize under UV illumination. (Figure 2A.) CAUTION! Ethidium bromide is a potential carcinogen and must be handled carefully and disposed of properly as per institution's regulations.

Results

Understanding the roles of sexed astrocyte functions under physiologic or pathophysiological conditions have been immensely elucidated by culturing these cells under in vitro conditions. The important aspect of performing sexed culturing is to determine the sex of the mouse pup prior to its use. We determined the sex of the mouse genetically by PCR and by visual assessment (Figure 2)¹⁶. The methodology of sex determination using PCR was adopted with mo...

Discussion

In order to study the sex differences in the properties and function of astrocytes under physiological and pathological conditions, preparation of sexed primary astrocytes in cell culture is an important tool to utilize. In the present study we report a highly efficient and a reproducible method to culture a highly enriched homogeneous population of sexed hippocampal astrocytes from newborn (P0-P2) C57Bl/6 (wild type) or K19F (GFAP null) mouse pups in-vitro. Establishing this methodology helps the investigators ...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Astrocyte culture media
DMEM, high glucose	cellgro	10-013-CV
Horse Serum	Gibco	26050-070	Final Concentration: 10%
Penicillin-Streptomycin	Cellgro	30-002-CI	Final Concentration: 1%
L-Leucine methyl ester hydrochloride	Aldrich	L1002-25G	Final Concentration: 5 mM
Solution for brain tissue digestion
HBSS	Life Technologies	14170-088
Trypsin	cellgro	25-050-CI	Final Concentration: 0.25%
Other
70% (vol/vol) ethanol	Roth	9065.2
Poly-D-Lysine (PDL) 12 mm round coverslips	Corning	354087
Water	Sigma	W3500	Cell-culture grade
PBS	cellgro	21-040-CV	Cell-culture grade
0.05% Trypsin-EDTA	Life Technologies	25300-062
70 μm Sterile cell strainer	Fisher scientific	22363548
3.5 cm Petri dish	BD Falcon	353001
15 mL Falcon tube	BD Falcon	352096
50 mL Falcon tube	BD Falcon	352070
Forceps, fine	Dumont	2-1032; 2-1033	# 3c; # 5
Forceps, flat tip	KLS Martin	12-120-11
13 cm surgical scissors	Aesculap	BC-140-R
Confocal Microscope	Nikon	A1RSi
Centrifuge	Eppendorf	5805000.017	5804R
Orbital Shaker	Thermo Scientific	SHKE 4450-1CE	MaxQ 4450
Anti-IBA1	Wako	019-19741	Rabbit monoclonal
Anti-MAP2	Sigma	M2320	Mouse monoclonal
Anti-HIF1alpha	abcam	ab179483	Rabbit monoclonal
Anti-S100B	Sigma	HPA015768	Rabbit polyclonal
Anti-GFAP (cocktail)	Biolegend	837602
VECTASTAIN Elite ABC Kit (Rabbit IgG)	Vector Labs	PK-6101	Contains 4 Reagents
Goat Anti Rabbit Alexa-Fluor 488	Invitrogen	A11070
Goat Anti Mouse Alexa-Fluor 568	Invitrogen	A11004