Method Article

In Vivo Biosensor Tracks Non-apoptotic Caspase Activity in Drosophila

DOI:

10.3791/53992

⸱

November 27th, 2016

In This Article

Summary

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

To detect healthy cells in whole animals that contain low levels of caspase activity, the highly sensitive biosensor designated CaspaseTracker was generated for Drosophila. Caspase-dependent biosensor activity is detected in long-lived healthy cells throughout the internal organs of adult animals reared under optimized conditions in the absence of death stimuli.

Abstract

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Caspases are the key mediators of apoptotic cell death via their proteolytic activity. When caspases are activated in cells to levels detectable by available technologies, apoptosis is generally assumed to occur shortly thereafter. Caspases can cleave many functional and structural components to cause rapid and complete cell destruction within a few minutes. However, accumulating evidence indicates that in normal healthy cells the same caspases have other functions, presumably at lower enzymatic levels. Studies of non-apoptotic caspase activity have been hampered by difficulties with detecting low levels of caspase activity and with tracking ultimate cell fate in vivo. Here, we illustrate the use of an ultrasensitive caspase reporter, CaspaseTracker, which permanently labels cells that have experienced caspase activity in whole animals. This in vivo dual color CaspaseTracker biosensor for Drosophila melanogaster transiently expresses red fluorescent protein (RFP) to indicate recent or on-going caspase activity, and permanently expresses green fluorescent protein (GFP) in cells that have experienced caspase activity at any time in the past yet did not die. Importantly, this caspase-dependent in vivo biosensor readily reveals the presence of non-apoptotic caspase activity in the tissues of organ systems throughout the adult fly. This is demonstrated using whole mount dissections of individual flies to detect biosensor activity in healthy cells throughout the brain, gut, malpighian tubules, cardia, ovary ducts and other tissues. CaspaseTracker detects non-apoptotic caspase activity in long-lived cells, as biosensor activity is detected in adult neurons and in other tissues at least 10 days after caspase activation. This biosensor serves as an important tool to uncover the roles and molecular mechanisms of non-apoptotic caspase activity in live animals.

Introduction

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Caspases are cysteine proteases that mediate apoptotic cell death by cleaving many intracellular proteins after key aspartate residues. For example, initiator caspases activate effector caspases, derepress DNA nucleases, cleave cytoskeletal components and alter the lipid composition of cell membranes to rapidly dismantle cells and stimulate their recognition and engulfment by neighboring cells that dispose of the cell corpses.1-4 It is estimated that billions of cells die per day in the human body, and apoptosis is an important mechanism of chemotherapy-induced tumor cell death.5 A different set of caspases can cause cell death by distinct non-apoptotic processes to stimulate innate immunity.6 Therefore, most research on caspases has focused on their pro-death functions.

Interestingly, early evidence in the field revealed that the same caspases responsible for promoting cell death also have non-death functions. Pioneering studies have demonstrated that caspases are involved in diverse cellular functions in healthy cells, including the regulation of cell proliferation and migration during embryogenesis.7-9 Caspases are required for spermatid individualization in Drosophila10,11, for blocking an alternative necroptotic cell death pathway in mice12,13, and for microRNA processing in C. elegans.14,15 In perhaps the longest-lived cells, neurons, caspases and other apoptotic machinery are implicated in the regulation of neuronal activity by pruning synaptic endings, a process believed to be essential to strengthen other synapses for learning and memory.16-18 It is possible that caspases facilitate synaptic pruning by a type of mini-apoptosis of tiny neuronal projections without whole cell death.19 However, caspases may have alternative functions unrelated to apoptosis-like events.20,21 Dual roles in life and death are not unique to caspases; BCL-2 family proteins and cytochrome c have roles in cellular energetics in healthy cells but are also part of the core apoptotic pathway that is activated by many types of cell stress.22-25 Although not proven, it seems logical that evolution has linked day-jobs to death-jobs within the same molecules to ensure timely elimination of unfit or undesirable cells.

At present, the molecular mechanisms of non-apoptotic caspase activity are not understood, and the extent of non-apoptotic caspase activity during embryonic development and in adult tissues is also not known. A major challenge is the difficulty in distinguishing day-jobs from death-jobs of caspases. In contrast to apoptosis and pyroptosis, when caspase activity is amplified by a proteolytic cascade, the day-jobs of caspases are expected to occur at much lower levels of enzymatic activity, likely below detection by many available technologies.

Prior to the work presented here, others developed a variety of caspase biosensors for different purposes. The SCAT biosensors (e.g., ECFP-DEVD-Venus) rapidly detect real-time caspase activity in cultured cells and animal tissues using FRET.26,27 Upon caspase cleavage, the nuclear-targeted GFP moiety of Apoliner (mCD8-RFP-DQVD-nucGFP) undergoes subcellular relocalization within minutes when its plasma membrane-tether is cleaved by caspases.28 Similarly, ApoAlert-pCaspase3-Sensor (NES-DEVD-YFP-NLS) relocalizes from the cytosol to the nucleus upon caspase cleavage.29,30 More recently, the chromophore in iCasper was cleverly engineered to fluoresce when cleaved by caspases, permitting detection of biosensor activity in real time in neurons of Drosophila embryos, but primarily in association with developmental cell death.31 Caspase-dependent death of olfactory neurons during aging was demonstrated by immuno-detection of the caspase-cleaved form of CPV biosensors (e.g., mCD8-PARP-Venus).32,33 Importantly, the activated form of caspase-3 was detected in the absence of cell death by sensitive immunostain in spines of cultured neurons, and in the soma using the caspase-dependent fluorescence of the nuclear CellEvent reporter dye, but difficulties were encountered due to photo-toxicity, although cell death was delayed until after spine elimination.19 Thus, new caspase biosensors are needed to detect and track cells with basal caspase activity in vivo.

To overcome these difficulties, we generated a novel dual color caspase biosensor, designated CaspaseTracker. This strategy combines a modified version of the Drosophila caspase-sensitive Apoliner biosensor28 with the Drosophila G-TRACE FRT recombinase system34 to permanently label and track cells in vivo.35 The Gal4-activated G-TRACE system allows very low levels of caspases to activate CaspaseTracker, resulting in RFP expression in the cytoplasm and permanent nuclear-targeted GFP expression in any cell that has ever experienced caspase activity.35 This system can label cells throughout life in whole animals using Drosophila melanogaster, a tractable and widely used model system for the study of caspases and cell death.36-38

Access restricted. Please log in or start a trial to view this content.

Protocol

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

1. Preparation of CaspaseTracker Flies

  1. To prepare CaspaseTracker (DQVD) flies for experiments, perform this cross: UBI-CaspaseTracker x G-TRACE (UAS-RFP; UAS-FLP; Ubi>Stop>GFP-nls), by transferring 7-10 virgin female (or male) flies carrying the caspase biosensor substrate mCD8-DIAP1-Gal4 driven by the ubiquitin promoter35 together with the same number of male (or female) G-TRACE flies, which have the second chromosome CyO balancer to avoid lethality of the homozygous combination of G-TRACE (UAS-RFP, UAS-FLP, and Ubi>Stop>GFP-nls)34. Place flies in a fresh food vial with fresh yeast paste as a protein source.
  2. Incubate files at 18 °C for 5 to 7 days (maximum 2 weeks) and then remove the parent flies from the vial to avoid overcrowding with new progeny, and to set up new breeding vials.
  3. Continue incubation at 18 °C until progeny flies eclose. Select the non-CyO [non-curly wing] progeny of the correct genotype of CaspaseTracker, which are transgenic for CaspaseTracker and G-TRACE elements35.
  4. Simultaneously, generate control parental non-transgenic w118 flies and caspase-insensitive (DQVA) flies in parallel to verify specific CaspaseTracker RFP and GFP fluorescence.
  5. Perform PCR genotyping to confirm files with CaspaseTracker using the primers: 5'-TCCCCCGGGCTGCAGGAATTC, 3'-TGGAATTGGGGTACGTCTAGA, producing a 3,897 bp product. For genotyping the G-Trace loci, use the following primers for GFP (474 bp), 5'-CAC GAC TTC TTC AAG TCC GCC ATG CCC G, 3'-CTT GTA CAG CTC GTC CAT GCC GAG AGT GAT C; for RFP (258 bp), 5'-GGC TGC TTC ATC TAC AAG GTG AAG TTC ATC GG, 3'-GAT GTC CAG CTT GGA GTC CAC GTA GTA GTA GC; and for Flpase (655 bp), 5'- CCACCTAAGGTGCTTGTTCGTCAGTTTGTGG, 3'-GCC TAC TAA CGC TTG TCT TTG TCT CTG TCA C. For genotyping Gal4 in the pUWR vector (554 bp), 5'-GAA GCA CAC CTT CGC ATC GCT CAG TCA CGC, 3'-TGG AAT TGG GGT ACG TCT AGA.

2. Tissue Preparation, Staining and Mounting

  1. For fly dissections, prevent dissected tissues from sticking to plastic pipette tips and centrifuge tubes, coat tips and tubes with 1% bovine serum albumin (BSA) dissolved in water.
  2. Dissect flies on a silicone cushion using forceps.
    1. To avoid damaging the tips of forceps on a hard surface when performing the tissue dissection, perform dissection on a silicon surface. For making silicone dissection plates, melt the silicon in the commercial kit according to manufacturer instructions (Materials List). After melting the silicone, add 3 to 4 mL to a 60 mm diameter tissue culture dish. Silicon dishes can be reused.
    2. Anesthetize a fly with CO2, and transfer it to a silicone plate with 1 mL of cold PBS. Introduce the CO2 to a vial containing the fly using a blowgun, and then transfer the anesthetized fly to a Pad that has a CO2 supply.
    3. Use a pair of forceps to hold the fly head, and a second pair of forceps to pull the thorax in the opposite direction to disconnect the fly head from the body covering without damaging the connection between the head and foregut.
    4. Use 2 pairs of forceps to remove the wings and legs from the thorax.
    5. Use a pair of forceps to hold the thorax, and another pair of forceps to pull the abdomen to separate it from the thorax again without damaging the connection between the foregut and midgut.
    6. Dissect internal organs including brain, gut, malpighian tubules and ovaries as previously demonstrated.39-41
    7. Remove all pieces of the cuticle and the fat bodies with forceps as these tissues produce strong autofluorescence. Patience and practice are required to prepare a complete organ system as shown.
  3. Transfer dissected tissues to 1.5 mL centrifuge tubes, and fix tissues with 0.5 mL of 4% paraformaldehyde in PBS (phosphate-buffered saline) at RT for 20 to 30 min with rotation in the dark to avoid bleaching RFP and GFP in the tissues. Avoid prolonged fixation that can compromise subsequent staining results.
  4. Remove the paraformaldehyde by gentle pipetting and wash 3 times with 0.5 mL PBST (PBS + 0.1% Triton X-100) at RT.
  5. Permeabilize the tissues with 0.5 mL PBST at 4 °C overnight with gentle shaking. Shorter incubations may cause incomplete permeabilization and compromise staining results.
    1. If it is necessary to reduce background staining, consider incubating tissues in 0.5 mL PBST with 1% BSA, instead of PBS.
  6. Wash the tissues 3 times with 0.5 mL PBST.
  7. To stain nuclei and filamentous actin (F-actin), apply 0.5 mL PBST with 10 µg/mL of Hoechst 33342 blue nuclear dye and 0.3 µM Alexa Fluor 633 Phalloidin F-actin stain and incubate simultaneously with tissues for 1 h at RT with gentle rotation in the dark. Avoid prolonged staining as this will increase the background.
    1. For immunostaining, incubate fixed and permeabilized tissues with 0.1% Triton X-100 in 0.5 mL PBS overnight at 4 °C, stain with 1:100 dilution of anti-ELAV antibody or with 1:200 dilution of anti-caspase-3 overnight at 4 °C (300 µL). Follow by the corresponding secondary antibody diluted 1:100 and incubate for 1 to 3 h at RT. See Materials List for specific antibody information.
  8. Wash the tissues 3 times, each for 5 min in 0.5 mL PBST with gentle rotation.
  9. With a pipet, remove all PBST, and then add 200 µL anti-bleach mounting agent (see materials) to completely cover tissues for 1-3 h at RT, or 4 °C overnight. Optimal tissues that have fully absorbed the mounting agent will sink to the bottom of the tube.
  10. Pre-clean the glass slide with water or 70% ethanol and transfer the tissues with mounting agent to the glass slide.
  11. Carefully place a glass cover slip over the tissues. Apply petroleum jelly to the glass slide and the cover slip to avoid destroying the tissue by overcompression. Remove extra mounting agent with tissue paper.
  12. Seal the cover slip by applying nail polish all along the edges of the cover slip to avoid leakage of mounting agents from the tissues.

3. Confocal Microscopy

  1. Use an inverted confocal epi-fluorescence microscope. However, up-right microscopes can be also used. To image tissues using tiling, maintain stable room temperature to avoid drift of focus and shift of x-y plane due to the thermal expansion and contraction of the components. Environmental control systems and focus drift compensation systems help to avoid this problem due to loss of thermo-equilibrium of the microscope system.
  2. Place the slide on the stage of the microscope. Take a few test images using low resolution (125 x 125 pixels) and determine the appropriate number of tiles needed to cover the entire region of interest (ROI).
  3. Set the microscope scanning system to capture images with scanning resolution such as 500 x 500 pixels. Select the objective such as a 20X NA 0.8 or a 63X NA 1.4 Plan-Apochromat objective for analyzing tissues through glass coverslips, so that each of the images (tiles) overlaps by 20% on all sides.
  4. Set up the image sequence from longest to shortest excitation wavelengths, as the long wavelength light causes lower photo-bleaching. The sequence from longest to shortest excitation wavelength is: (i) 633 nm for Phalloidin F-actin and for antibody to activated caspases, (ii) 561 nm for RFP, (iii) 488 nm for GFP, and (iv) 405 nm for Hoechst nuclear stain.
  5. During imaging, minimize exposure of cells to fluorescent laser excitation during imaging process to avoid photo-bleaching by reducing the laser intensity to obtain high quality images of tissues.
  6. After images are collected, merge the images using microscope software.

Access restricted. Please log in or start a trial to view this content.

Results

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

There are two key components that allow CaspaseTracker to detect caspase activity in normal healthy cells (Figure 1a). The first of these is a 146 amino acid caspase-cleavable polypeptide modeled after the caspase biosensor Apoliner (Figure 1b).28 This polypeptide is derived from DIAP1 (Drosophila inhibitor of apoptosis) containing a single naturally occurring caspase site that is cleaved during apoptosis typically by the caspase DrICE...

Access restricted. Please log in or start a trial to view this content.

Discussion

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

Here we illustrate the construction and inner workings of CaspaseTracker that facilitate detection of widespread basal caspase activity in healthy tissues. The critical steps for detecting non-apoptotic caspase activity in vivo are: 1) generating flies with the biosensor transgene, 2) verifying caspase-specific reporter function with appropriate controls, 3) practicing dissection techniques to observe all internal organ systems of adult Drosophila, and 4) distinguishing biosensor activity from autofluor...

Access restricted. Please log in or start a trial to view this content.

Disclosures

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

The authors have nothing to disclose.

Acknowledgements

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,

We thank Polan Santos and Darren Obbard for Drosophila illustrations in Fig. 2a, Marcelo Jacobs-Lorena for use of the JHMRI insectary. This work was supported by the Life Science Research Foundation fellowship (H.L.T.), University Grants Committee of the Hong Kong AoE/B-07/99 (M.C.F.), and NIH grants NS096677, NS037402 and NS083373 (J.M.H.). Ho Lam Tang is a Shurl and Kay Curci Foundation Fellow of the Life Sciences Research Foundation.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Consumables and Reagents
VectashieldVector ProductsH-1000Mounting medium
ForcepsTed Pella#505 (110mm, #5)Dumont tweezer biology grade, stainless steel
Hanging Drop SlidesFisher Scientific12-565BGlass slides
Hoechst 33342Molecular ProbesH1399DNA stain
Alexa Fluor 633 PhalloidinMolecular ProbesA22284Actin stain
Rat-Elav-7E8A10 anti-elav antibodyDevelopmental Studies Hybridoma Bank (DSHB)Antibody Registry ID:  AB_528218 Stain for Drosophla pan-neuronal ELAV
Cleaved caspase-3 (Asp175) antibodyCell Signaling Technology#9661Stain for active fragment of caspase-3
ProLong Gold antifade reagentLife TechnologiesP36934to preserve fluorophores 
ProLong Diamond Antifade MountantLife TechnologiesP36961to preserve fluorophores 
SylGard 182 Silicone Elastomer KitDow Corning Product code: 0001023934for dissection plates
Equipment
LSM780 confocal microscopeCarl ZeissN/AImaging
Carl Zeiss Stereomicroscope Stemi 2000Carl ZeissN/ADrosophila dissection
AmScope Fiber Optic Dual Gooseneck Microscope Illuminator, 150 WAmScopeWBM99316Light source

References

Loading...
$$\rightleftharpoonup{xx}$$ $$\longleftharp{xx}$$, $$\longrightharp{xx}$$,
  1. Salvesen, G. S., Abrams, J. M. Caspase activation - stepping on the gas or releasing the brakes? Lessons from humans and flies. Oncogene. 23, 2774-2784 (2004).
  2. Hay, B. A., Guo, M. Caspase-dependent cell death in Drosophila. Annu Rev Cell Dev Biol. 22, 623-650 (2006).
  3. Segawa, K., et al. Caspase-mediated cleavage of phospholipid flippase for apoptotic phosphatidylserine exposure. Science. 344, 1164-1168 (2014).
  4. Akagawa, H., et al. The role of the effector caspases drICE and dcp-1 for cell death and corpse clearance in the developing optic lobe in Drosophila. Dev Biol. , (2015).
  5. Souers, A. J., et al. ABT-199, a potent and selective BCL-2 inhibitor, achieves antitumor activity while sparing platelets. Nat Med. 19, 202-208 (2013).
  6. Lamkanfi, M., Dixit, V. M. Mechanisms and functions of inflammasomes. Cell. 157, 1013-1022 (2014).
  7. Bergmann, A., Steller, H. Apoptosis, stem cells, and tissue regeneration. Sci Signal. 3, re8(2010).
  8. Hyman, B. T., Yuan, J. Apoptotic and non-apoptotic roles of caspases in neuronal physiology and pathophysiology. Nat Rev Neurosci. 13, 395-406 (2012).
  9. Juraver-Geslin, H. A., Durand, B. C. Early development of the neural plate: new roles for apoptosis and for one of its main effectors caspase-3. Genesis. 53, 203-224 (2015).
  10. Arama, E., Agapite, J., Steller, H. Caspase activity and a specific cytochrome C are required for sperm differentiation in Drosophila. Dev Cell. 4, 687-697 (2003).
  11. Kaplan, Y., Gibbs-Bar, L., Kalifa, Y., Feinstein-Rotkopf, Y., Arama, E. Gradients of a ubiquitin E3 ligase inhibitor and a caspase inhibitor determine differentiation or death in spermatids. Dev Cell. 19, 160-173 (2010).
  12. Kaiser, W. J., et al. RIP3 mediates the embryonic lethality of caspase-8-deficient mice. Nature. 471, 368-372 (2011).
  13. Gunther, C., et al. Caspase-8 regulates TNF-alpha-induced epithelial necroptosis and terminal ileitis. Nature. 477, 335-339 (2011).
  14. Weaver, B. P., et al. CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans. Elife. 3, e04265(2014).
  15. Ge, X., et al. A novel mechanism underlies caspase-dependent conversion of the dicer ribonuclease into a deoxyribonuclease during apoptosis. Cell Res. 24, 218-232 (2014).
  16. Fannjiang, Y., et al. BAK alters neuronal excitability and can switch from anti- to pro-death function during postnatal development. Dev Cell. 4, 575-585 (2003).
  17. Ofengeim, D., et al. N-terminally cleaved Bcl-xL mediates ischemia-induced neuronal death. Nat Neurosci. 15, 574-580 (2012).
  18. Li, Z., Sheng, M. Caspases in synaptic plasticity. Mol Brain. 5, 15(2012).
  19. Erturk, A., Wang, Y., Sheng, M. Local pruning of dendrites and spines by caspase-3-dependent and proteasome-limited mechanisms. J Neurosci. 34, 1672-1688 (2014).
  20. Campbell, D. S., Okamoto, H. Local caspase activation interacts with Slit-Robo signaling to restrict axonal arborization. J Cell Biol. 203, 657-672 (2013).
  21. Feinstein-Rotkopf, Y., Arama, E. Can't live without them, can live with them: roles of caspases during vital cellular processes. Apoptosis. 14, 980-995 (2009).
  22. Li, P., et al. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell. 91, 479-489 (1997).
  23. Lewis, J., et al. Inhibition of virus-induced neuronal apoptosis by Bax. Nat Med. 5, 832-835 (1999).
  24. Chen, Y. B., et al. Bcl-xL regulates mitochondrial energetics by stabilizing the inner membrane potential. J Cell Biol. 195, 263-276 (2011).
  25. Yi, C. H., et al. Metabolic regulation of protein N-alpha-acetylation by Bcl-xL promotes cell survival. Cell. 146, 607-620 (2011).
  26. Takemoto, K., Nagai, T., Miyawaki, A., Miura, M. Spatio-temporal activation of caspase revealed by indicator that is insensitive to environmental effects. J Cell Biol. 160, 235-243 (2003).
  27. Takemoto, K., et al. Local initiation of caspase activation in Drosophila salivary gland programmed cell death in vivo. Proc Natl Acad Sci U S A. 104, 13367-13372 (2007).
  28. Bardet, P. L., et al. A fluorescent reporter of caspase activity for live imaging. Proc Natl Acad Sci U S A. 105, 13901-13905 (2008).
  29. Tang, H. L., et al. Cell survival, DNA damage, and oncogenic transformation after a transient and reversible apoptotic response. Mol Biol Cell. 23, 2240-2252 (2012).
  30. Golbs, A., Nimmervoll, B., Sun, J. J., Sava, I. E., Luhmann, H. J. Control of programmed cell death by distinct electrical activity patterns. Cereb Cortex. 21, 1192-1202 (2011).
  31. To, T. L., et al. Rationally designed fluorogenic protease reporter visualizes spatiotemporal dynamics of apoptosis in vivo. Proc Natl Acad Sci U S A. 112, 3338-3343 (2015).
  32. Florentin, A., Arama, E. Caspase levels and execution efficiencies determine the apoptotic potential of the cell. J Cell Biol. 196, 513-527 (2012).
  33. Chihara, T., et al. Caspase inhibition in select olfactory neurons restores innate attraction behavior in aged Drosophila. PLoS Genet. 10, e1004437(2014).
  34. Evans, C. J., et al. G-TRACE: rapid Gal4-based cell lineage analysis in Drosophila. Nat Methods. 6, 603-605 (2009).
  35. Tang, H. L., Tang, H. M., Fung, M. C., Hardwick, J. M. In vivo CaspaseTracker biosensor system for detecting anastasis and non-apoptotic caspase activity. Sci Rep. 5, 9015(2015).
  36. Suzanne, M., Steller, H. Shaping organisms with apoptosis. Cell Death Differ. 20, 669-675 (2013).
  37. Jenkins, V. K., Timmons, A. K., McCall, K. Diversity of cell death pathways: insight from the fly ovary. Trends Cell Biol. 23, 567-574 (2013).
  38. Sarkissian, T., Timmons, A., Arya, R., Abdelwahid, E., White, K. Detecting apoptosis in Drosophila tissues and cells. Methods. 68, 89-96 (2014).
  39. Williamson, W. R., Hiesinger, P. R. Preparation of developing and adult Drosophila brains and retinae for live imaging. J Vis Exp. , (2010).
  40. Wong, L. C., Schedl, P. Dissection of Drosophila ovaries. J Vis Exp. , e52(2006).
  41. Tauc, H. M., Tasdogan, A., Pandur, P. Isolating intestinal stem cells from adult Drosophila midguts by FACS to study stem cell behavior during aging. J Vis Exp. , e52223(2014).
  42. Ditzel, M., et al. Degradation of DIAP1 by the N-end rule pathway is essential for regulating apoptosis. Nat Cell Biol. 5, 467-473 (2003).
  43. Li, X., Wang, J., Shi, Y. Structural mechanisms of DIAP1 auto-inhibition and DIAP1-mediated inhibition of drICE. Nat Commun. 2, 408(2011).
  44. Yi, S. X., Moore, C. W., Lee, R. E. Rapid cold-hardening protects Drosophila melanogaster from cold-induced apoptosis. Apoptosis. 12, 1183-1193 (2007).
  45. Drummond-Barbosa, D., Spradling, A. C. Stem cells and their progeny respond to nutritional changes during Drosophila oogenesis. Dev Biol. 231, 265-278 (2001).
  46. Fan, Y., Bergmann, A. The cleaved-Caspase-3 antibody is a marker of Caspase-9-like DRONC activity in Drosophila. Cell Death Differ. 17, 534-539 (2010).
  47. Fogarty, C. E., Bergmann, A. Detecting caspase activity in Drosophila larval imaginal discs. Methods Mol Biol. 1133, 109-117 (2014).
  48. Koushika, S. P., Lisbin, M. J., White, K. ELAV, a Drosophila neuron-specific protein, mediates the generation of an alternatively spliced neural protein isoform. Curr Biol. 6, 1634-1641 (1996).
  49. Albeck, J. G., et al. Quantitative analysis of pathways controlling extrinsic apoptosis in single cells. Mol Cell. 30, 11-25 (2008).
  50. Galluzzi, L., et al. Guidelines for the use and interpretation of assays for monitoring cell death in higher eukaryotes. Cell Death Differ. 16, 1093-1107 (2009).
  51. Holland, A. J., Cleveland, D. W. Chromoanagenesis and cancer: mechanisms and consequences of localized, complex chromosomal rearrangements. Nat Med. 18, 1630-1638 (2012).
  52. Green, D. R. Means to an end : apoptosis and other cell death mechanisms. , Cold Spring Harbor Laboratory Press. (2011).
  53. Chau, B. N., et al. Signal-dependent protection from apoptosis in mice expressing caspase-resistant Rb. Nat Cell Biol. 4, 757-765 (2002).
  54. Lin, Y., Devin, A., Rodriguez, Y., Liu, Z. G. Cleavage of the death domain kinase RIP by caspase-8 prompts TNF-induced apoptosis. Genes Dev. 13, 2514-2526 (1999).
  55. Han, M. H., et al. The novel caspase-3 substrate Gap43 is involved in AMPA receptor endocytosis and long-term depression. Mol Cell Proteomics. 12, 3719-3731 (2013).
  56. Nakagawa, A., Shi, Y., Kage-Nakadai, E., Mitani, S., Xue, D. Caspase-dependent conversion of Dicer ribonuclease into a death-promoting deoxyribonuclease. Science. 328, 327-334 (2010).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Caspase ActivityNon apoptotic CaspaseDrosophila MelanogasterCaspaseTracker BiosensorFluorescent ReporterConfocal MicroscopyTissue DissectionGenetic CrossRFP GFP ExpressionCaspase Cleavage

Related Articles