This report describes an in vitro assay for measuring the human immunodeficiency virus type 1 (HIV-1) preintegration complex (PIC)-associated integration activity in the cytoplasmic extracts of acutely infected cells. The integration of PIC-associated HIV-1 DNA into heterologous target DNA is quantified by using a nested real-time polymerase chain reaction strategy.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Measurement of In Vitro Integration Activity of HIV-1 Preintegration Complexes
In This Article
Summary
Abstract
HIV-1 envelope proteins engage cognate receptors on the target cell surface, which leads to viral-cell membrane fusion followed by the release of the viral capsid (CA) core into the cytoplasm. Subsequently, the viral Reverse Transcriptase (RT), as part of a namesake nucleoprotein complex termed the Reverse Transcription Complex (RTC), converts the viral single-stranded RNA genome into a double-stranded DNA copy (vDNA). This leads to the biogenesis of another nucleoprotein complex, termed the pre-integration complex (PIC), composed of the vDNA and associated virus proteins and host factors. The PIC-associated viral integrase (IN) orchestrates the integration of the vDNA into the host chromosomal DNA in a temporally and spatially regulated two-step process. First, the IN processes the 3' ends of the vDNA in the cytoplasm and, second, after the PIC traffics to the nucleus, it mediates integration of the processed vDNA into the chromosomal DNA. The PICs isolated from target cells acutely infected with HIV-1 are functional in vitro, as they are competent to integrate the associated vDNA into an exogenously added heterologous target DNA. Such PIC-based in vitro integration assays have significantly contributed to delineating the mechanistic details of retroviral integration and to discovering IN inhibitors. In this report, we elaborate upon an updated HIV-1 PIC assay that employs a nested real-time quantitative Polymerase Chain Reaction (qPCR)-based strategy for measuring the in vitro integration activity of isolated native PICs.
Introduction
HIV-1 replication in the target cell involves multiple steps, broadly grouped into two phases: early and late events. The early events begin when HIV-1 sequentially binds to the target cell surface receptor CD4 and one of the two co-receptors (CCR5 or CXCR4)1. Consequently, the virus-cell membranes fuse, and the viral capsid (CA) core is released into the cytoplasm2. The CA core contains the viral genomic single-stranded RNA (ssRNA) and several proteins, both viral and cellular in origin. The CA-associated viral proteins include Reverse Transcriptase (RT) and integrase (IN), two enzymes that mediate critical steps during....
Access restricted. Please log in or start a trial to view this content.
Protocol
1. Virus Production
NOTE: To generate high titers of infectious HIV-1, transfect the Human Embryonic Kidney (HEK) cell line 293T with an infectious HIV-1 molecular clone using an activated dendrimer-based transfection reagent. It has been observed that the calcium phosphate transfection method yields comparable results.
- In a Biosafety Level 2 (BSL2) lab, seed 3 x 106 293T cells per 10 cm dish in 8 mL of Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% Fetal Bovine Serum (FBS), penicillin, and streptomycin. Culture the cells in an incubator set at 37 °C and 5% CO2 O/N.
- The nex....
Access restricted. Please log in or start a trial to view this content.
Results
Isolation of HIV-1 PICs
A schematic of the protocol used for the isolation of HIV-1 PICs from acutely infected Sup-T1 cells is depicted in Figure 1. This protocol is derived from the methods described by Engelman et al.19,20. HIV-1 PICs are nucleoprotein complexes that are assembled in infected cells and are comprised of the rev.......
Access restricted. Please log in or start a trial to view this content.
Discussion
Biochemical analyses of retroviral PICs have provided critical insights into the mechanism of retroviral DNA integration. Measurement of the integration activity of retroviral PICs can be achieved by plaque formation assay, Southern blot analysis, and nested qPCR. The experimental strategy of plaque assay is laborious and utilizes an indirect method to measure integration6,7,18. Southern blot-based assays measure integration dir.......
Access restricted. Please log in or start a trial to view this content.
Disclosures
The authors declare no competing financial and nonfinancial interests.
Acknowledgements
This work is partly supported by grants DA024558, DA30896, DA033892, and DA021471 from the NIDA/NIH to CD. We also acknowledge the RCMI grant G12MD007586, the Vanderbilt CTSA grant UL1RR024975, the Meharry Translational Research Center (MeTRC) CTSA grant U54 RR026140 from the NCRR/NIH, the U54 grant MD007593 from the NIMHD/NIH, and the Tennessee CFAR grant P30 AI110527.
....Access restricted. Please log in or start a trial to view this content.
Materials
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
Fetal Bovine Serum (FBS) | GIBCO/Invitrogen | 10437-028 | |
Heat-inactivated Fetal Bovine Serum (Hi-FBS) | GIBCO/Invitrogen | 10438-026 | |
| Dulbecco’s modified Eagle’s medium (DMEM) | GIBCO/Invitrogen | 11995-065 | |
| Roswell Park Memorial Institute (RPMI) 1640 medium | GIBCO/Invitrogen | 11875-093 | |
Phosphate-buffered Saline (PBS) (1x) | GIBCO/Invitrogen | 20012-027 | |
| Trypsin-EDTA (0.25%) | GIBCO/Invitrogen | 25200-056 | |
| Penicillin-Streptomycin solution (100x) | Cellgro/Mediatech | 30-002-CI | |
| HEK293T cells (293T) | American Type Culture Collection (ATCC) | CRL-3216 | |
| HIV-1 proviral molecular clone pNL4-3 | NIH AIDS Research and Reference Reagent Program | 114 | |
| PolyFect transfection reagent | Qiagen | 301107 | |
DNase 1 | Calbiochem/Merckmillipore | 260913 | |
Sup-T1 cells | American Type Culture Collection (ATCC) | CRL-1942 | |
HEPES pH 7.2 - 7.5 (ready-to-use solution) | GIBCO/Invitrogen | 15630-080 | |
| Potassium chloride (KCl) solution | Sigma-Aldrich | 60142 | |
| Magnesium chloride (MgCl2) solution | Sigma-Aldrich | M1028 | |
| Dithiothreitol (DTT) | Sigma-Aldrich | 43815 | |
| Aprotinin | Sigma-Aldrich | A6106 | |
| Digitonin | Sigma-Aldrich | D141 | |
| RNase A | Invitrogen | 12091-021 | |
| Sucrose | Sigma-Aldrich | S0389 | |
| phiX174 Replicative Form 1 DNA | Promega | D1531 | |
| PhiX174-F primer: 5’-CGCTTCCATGACGCAGAAGTT-3’ PhiX174-R primer: 5’-CACTGACCCTCAGCAATCTTA-3’ | Invitrogen and/or IDT-DNA | ||
| dNTP mix | Promega | U1515 | |
| Go Taq DNA Polymerase | Promega | M3005 | |
| Qiaquick gel extraction kit | Qiagen | 28706 | |
| Ultrapure distilled water | Invitrogen | 10977-015 | |
Tris-EDTA (TE) buffer (100x) | Sigma-Aldrich | T9285 | |
Sodium Dodecyl Sulphate (SDS) | Sigma-Aldrich | L3771 | |
| Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0 | Sigma-Aldrich | E7889 | |
Proteinase K (20 mg/mL ready-to-use solution) | Qiagen | 19131 | |
| Phenol (equilibrated with 10 mM Tris HCl, pH 8.0 and 1 mM EDTA) | Sigma-Aldrich | P4557 | |
| Chloroform | Sigma-Aldrich | 288306 | |
Glycogen (5 mg/mL solution) | Ambion/Invitrogen | AM9510 | |
Sodium acetate (3 M, pH 5.2) | Sigma-Aldrich | S7899 | |
| Ethanol | Sigma-Aldrich | E7023 | |
First round LTR primer: 5’-GTGCGCGCTTCAGCAAG-3’ First round phiX174 primer: 5’-CACTGACCCTCAGCAATCTTA-3’ | Invitrogen and/or IDT-DNA | --- | |
Second round LTR-R primer: 5’-TCTGGCTAACTAGGGAACCCA-3’ Second round LTR-U primer: 5’-CTGACTAAAAGGGTCTGAGG-3’ Second round Taqman probe: 5’-6- FAM/TTAAGCCTCAATAAAGCTTGC CTTGAGTGC/6-TAMRA/-3’ | Invitrogen and/or IDT-DNA | --- | |
| iQ Supermix | Bio-Rad | 170-8862 |
References
- Sattentau, Q. J., Weiss, R. A. The CD4 antigen: physiological ligand and HIV receptor. Cell. 52 (5), 631-633 (1988).
- Wilen, C. B., Tilton, J. C., Doms, R. W. Molecular mechanisms of HIV entry. Adv Exp Med Biol. 726, 223-242 (2012).
- Bowerman, B., Brown, P. O., Bishop, J. M., Varmus, H. E.
Access restricted. Please log in or start a trial to view this content.
Reprints and Permissions
