Mapping RNA-RNA Interactions Globally Using Biotinylated Psoralen

Summary

Here, we detail the method of Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH), which enables genome-wide mapping of intramolecular and intermolecular RNA-RNA interactions in vivo. SPLASH can be applied to study RNA interactomes of organisms including yeast, bacteria and humans.

Abstract

Knowing how RNAs interact with themselves and with others is key to understanding RNA based gene regulation in the cell. While examples of RNA-RNA interactions such as microRNA-mRNA interactions have been shown to regulate gene expression, the full extent to which RNA interactions occur in the cell is still unknown. Previous methods to study RNA interactions have primarily focused on subsets of RNAs that are interacting with a particular protein or RNA species. Here, we detail a method named Sequencing of Psoralen crosslinked, Ligated, and Selected Hybrids (SPLASH) that allows genome-wide capture of RNA interactions in vivo in an unbiased manner. SPLASH utilizes in vivo crosslinking, proximity ligation, and high throughput sequencing to identify intramolecular and intermolecular RNA base-pairing partners globally. SPLASH can be applied to different organisms including bacteria, yeast and human cells, as well as diverse cellular conditions to facilitate the understanding of the dynamics of RNA organization under diverse cellular contexts. The entire experimental SPLASH protocol takes about 5 days to complete and the computational workflow takes about 7 days to complete.

Introduction

Studying how macromolecules fold and interact with each other is the key to understanding gene regulation in the cell. While much effort has been focused in the past decade on understanding how DNA and proteins contribute to gene regulation, relatively less is known about post-transcriptional regulation of gene expression. RNA carries information in both its linear sequence and in its secondary and tertiary structure¹. Its ability to base pair with itself and with others is important for its function in vivo. Recent advances in high throughput RNA secondary structure probing has provided valuable insights into the locations of double a....

Protocol

1. Treatment of HeLa Cells with Biotinylated Psoralen and RNA Extraction

1. Culture HeLa cells in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin streptomycin (PS) in a 10 cm plate.
2. Wash the HeLa cells twice with 5 mL of 1x PBS. Drain excess PBS completely from the dish by placing the dish vertically for 1 min.
3. Add 1 mL of PBS containing 200 µM of biotinylated psoralen and 0.01% w/v digitonin, to the cells uniformly and incubate at 37 °C for 5 min. While biotinylated psoralen can enter the cell, its permeability is much higher when the cells are exposed to low amounts o....

Results

Figure 1 depicts the schematic of the SPLASH workflow. Upon the addition of biotinylated psoralen in the presence of 0.01% digitonin, and UV crosslinking, total RNA is extracted from the cells and a dot blot is performed to ensure that crosslinking of biotinylated to the RNA has happened efficiently (Figure 2). We use biotinylated 20 base oligos as positive controls to titrate the amount of biotinylated psoralen to be added to th.......

Discussion

Here, we describe in detail the experimental and computational workflow for SPLASH, a method that allows us to identify pair-wise RNA interactions in a genome-wide manner. We have successfully utilized SPLASH in bacterial, yeast and human cultures and anticipate that the strategy can be widely applied to diverse organisms under different cellular states. One of the critical steps in the protocol is to start with at least 20 µg of crosslinked RNA to have adequate material for downstream processes. The RNA is then fra.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
1 kb Plus DNA Ladder	Life Technologies Holdings Pte Ltd	10787026	DNA ladder
10 bp DNA ladder	Life Technologies Holdings Pte Ltd	10821-015	DNA ladder
20% SDS solution	First BASE	BUF-2052-1L
20x SSC	First BASE	BUF-3050-20X1L
3.0 M Sodium Acetate Solution	First BASE	BUF-1151-1L-pH5.2	Required for nucleic acid precipitation
40% Acrylamide/Bis Solution, 19:1	Bio-Rad	1610145	TBE Urea gel component
Ambion Buffer Kit	Life Technologies Holdings Pte Ltd	AM9010
Ammonium Persulfate, Molecular Grade	Promega	V3131	TBE Urea gel component
Bromophenol Blue	Sigma-Aldrich	B0126-25G
Chloroform	Merck	1.02445.1000	RNA extraction
Single strand DNA ligase	Epicentre	CL9025K	CircLigase II ssDNA Ligase
Centrifuge tube filters	Sigma-Aldrich	CLS8160-96EA	Costar Spin-X centrifuge tube filters
D5628-1G DIGITONIN CRYSTALLINE	Sigma-Aldrich	D5628-1G	For cell treatment
Dark Reader Transilluminator	Clare Chemical Research	Dark Reader DR89X Transilluminator	Blue light transilluminator
DNA Gel Loading Dye (6x)	Life Technologies Holdings Pte Ltd	R0611	Required for agarose gel electroporation
Dulbecco's Modified Eagle Medium	Pan BioTech	P04-03500	For Hela cell culture
Streptavidin magnetic beads	Life Technologies Holdings Pte Ltd	65002	Dynabeads MyOne Streptavidin C1
Magnetic stand for 15 mL tubes	Life Technologies Holdings Pte Ltd	12301D	DynaMag-15
Magnetic stand for 15 mL tubes	Life Technologies Holdings Pte Ltd	12321D	DynaMag-2
ThermoMixer	Eppendorf	5382 000.015	Eppendorf ThermoMixer C
Biotinylated psoralen	Life Technologies Holdings Pte Ltd	29986	EZ-Link Psoralen-PEG3-Biotin
F8T5/BL	Hitachi	F8T5/BL	365 nm UV bulb
Fetal Bovine Serum	Life Technologies Holdings Pte Ltd	10270106	Components of Hela medium
Formamide	Promega	H5052	Component in hybridization buffer
G8T5	Sankyo-Denki	G8T5	254 nm UV bulb
Glycogen	Life Technologies Holdings Pte Ltd	10814010	Required for nucleic acid precipitation
Nanodrop	Life Technologies Holdings Pte Ltd	Nanodrop 2000	Spectrophotometer for nucleic acidquantification
Nuclease free water	First BASE	BUF-1180-500ml
Penicillin Streptomycin	Life Technologies Holdings Pte Ltd	15140122	Components of Hela medium
High-Fidelity DNA polymerase (2x)	Life Technologies Holdings Pte Ltd	F531L	Phusion High-Fidelity PCR Master Mix with HF Buffer (2x)
Primers Set 1	New England Biolabs	E7335L	PCR primers
DNA Gel Extraction Kit	QIAgen	28106	QIAquick Gel Extraction Kit
Fluorometric Quantification kit	Life Technologies Holdings Pte Ltd	Q32854	Qubit dsDNA HS Assay Kit
RNA clean up kit	Qiagen	74106	RNeasy Mini Kit Silica-membrane column
Rnase Inhibitor	Life Technologies Holdings Pte Ltd	AM2696	SUPERase In
Reverse transcriptase	Life Technologies Holdings Pte Ltd	18080400	SuperScript III First-Strand Synthesis SuperMix
Nucleic Acid Gel Stain	Life Technologies Holdings Pte Ltd	S11494	SYBR GOLD NUCLEIC ACID 500 UL
T4 Polynucleotide Kinase	New England Biolabs	M0201L	End repair enzyme
T4 RNA Ligase 1	New England Biolabs	M0204L	Enzyme for proximity ligation
T4 RNA Ligase 2, truncated KQ	New England Biolabs	M0373L	Enzyme for adaptor ligation
Temed	Bio-Rad	1610801	TBE Urea gel component
Guanidinium thiocyanate-phenol-chloroform	Life Technologies Holdings Pte Ltd	15596018	TRIzol® Reagent for RNA extraction
Urea	First BASE	BIO-2070-5kg
UV crosslinker	Stratagene	400072	UV Stratalinker 1800
UV Transilluminator	UVP	95-0417-01	For visualizing of bands
Xylene Cyanol FF	Sigma-Aldrich	X4126-10G
DNA cleanup it	Zymo Research	D4004	Zymo DNA concentrator-5
List of software required
FastQC software	0.11.4	http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
SeqPrep software	1.0.7	https://github.com/jstjohn/SeqPrep
BWA software	0.7.12	http://bio-bwa.sourceforge.net/
SAMTOOLS software	1.2.1	http://www.htslib.org/
PULLSEQ software	1.0.2	https://github.com/bcthomas/pullseq
STAR software	2.5.0c	https://github.com/alexdobin/STAR
rem_dups.py PYTHON script	PYTHON 2.7.11	https://github.com/CSB5/splash/tree/master/src
find_chimeras.py PYTHON script	PYTHON 2.7.11	https://github.com/CSB5/splash/tree/master/src
pickJunctionReads.awk AWK script	AWK GNU 4.1.2	https://github.com/CSB5/splash/tree/master/src
Buffer composition
Elution buffer
0.3 M sodium acetate
Lysis Buffer
50 mM Tris-Cl pH 7.0
10 mM EDTA
1% SDS
Always add Superase-in fresh before use except when washing beads
Proteinase K Buffer
100 mM NaCl
10 mM Tris-Cl pH 7.0
1 mM EDTA
0.5% SDS
Hybridization Buffer
750 mM NaCl
1% SDS
50 mM Tris-Cl pH 7.0
1 mM EDTA
15% formamide (store in the dark at 4 °C)
Always add Superase-in fresh before use
2x SSC Wash Buffer
2x NaCl and Sodium citrate (SSC) (diluted from 20x SSC Invitrogen stock)
0.5% SDS
2x RNA fragmentation buffer
18 mM MgCl2
450 mM KCl
300 mM Tris-Cl pH 8.3
2x RNA loading Dye
95% Formamide
0.02% SDS
0.02% bromophenol blue
0.01% Xylene Cyanol
1 mM EDTA
3' RNA adapter sequence: 5rAppCTGTAGGCACCATCAAT/3ddC
RT primer sequence: AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGC/iSp18/CACTCA/iSp18/TTCAGACGTGTGCTCTTCCGATCTATTGATGGTGCCTACAG