Method Article

Development of Metarhizium anisopliae as a Mycoinsecticide: From Isolation to Field Performance

21K views

⸱

DOI:

10.3791/55272

⸱

July 30th, 2017

 ,  , 
1Biochemical Sciences Division, CSIR-National Chemical Laboratory

In This Article

Summary

Here, we report the different stages involved in the knowledge-based development of an effective mycoinsecticide, including the isolation, identification, screening, and selection of the "best-fit" entomopathogenic fungus, Metarhizium anisopliae, for the control of insect pests in agriculture.

Abstract

A major concern when developing commercial mycoinsecticides is the kill speed compared to that of chemical insecticides. Therefore, isolation and screening for the selection of a fast-acting, highly virulent entomopathogenic fungus are important steps. Entomopathogenic fungi, such as Metarhizium, Beauveria, and Nomurea, which act by contact, are better suited than Bacillus thuringiensis or nucleopolyhedrosis virus (NPV), which must be ingested by the insect pest. In the present work, we isolated 68 Metarhizium strains from infected insects using a soil dilution and bait method. The isolates were identified by the amplification and sequencing of the ITS1-5.8S-ITS2 and 26S rDNA region. The most virulent strain of Metarhizium anisopliae was selected based on the median lethal concentration (LC50) and time (LT50) obtained in insect bioassays against III-instar larvae of Helicoverpa armigera. The mass production of spores by the selected strain was carried out with solid-state fermentation (SSF) using rice as a substrate for 14 days. Spores were extracted from the sporulated biomass using 0.1% tween-80, and different formulations of the spores were prepared. Field trials of the formulations for the control of an H. armigera infestation in pigeon peas were carried out by randomized block design. The infestation control levels obtained with oil and aqueous formulations (78.0% and 70.9%, respectively) were better than the 63.4% obtained with chemical pesticide.

Introduction

From the introduction of organochlorine pesticides in the 1940s in India, the use of pesticides has increased many fold1, with crop pests still costing billions of rupees2 annually in terms of yield loss in agricultural production. The widespread and non-judicious use of synthetic pesticides is a continuous threat to the environment and human health1. The indiscriminate use of pesticides leads to residues in the soil and the depletion of natural pest predators. It also serves as a powerful selection pressure for altering the genetic makeup of a pest population, leading to the development of resistance1. Despite the enormous benefits of the green revolution, which required high inputs, like fertilizers and pesticides, pests continue to be a major biotic constraint. A general estimate of recorded annual crop losses in India and worldwide are USD 12 billion2 and USD 2,000 billion3, respectively.

When chemical pesticides have detrimental effects when used to control insect pests, it becomes imperative to search for alternative methods that are ecologically sound, reliable, economical, and sustainable. Biological control offers a suitable alternative and includes the use of parasites, predators, and microbial pathogens4. Fungi, for instance, are known to infect a broad range of insect pests, including lepidopterans, hymenopterans, coleopterans, and dipterans, often resulting in natural epizootics. Furthermore, unlike other bacterial and viral insect control agents, the mode of action of insect pathogenic fungi is by contact5. These fungi comprise a heterogenous group of over 100 genera, with approximately 750 species reported among different insects. The important fungal pathogens are: Metarhizium sp., Beauveria sp., Nomuraea rileyi, Lecanicillium lecanii, and Hirsutella sp., to name a few6. M. anisopliae (Metchnikoff) Sorokin is the second most widely used entomopathogenic fungus in biocontrol. It is known to attack over 200 species of insects7.

In this study, different stages involved in the knowledge-based development of a mycopesticide using M. anisopliae are presented. This includes: 1) the identification of a source (i.e., either soil or mycosed insects) for virulent entomopathogens, 2) entomopathogen identification and selection, 3) strategies to maintain their virulent nature and effectiveness in the laboratory bioassay and in the field, 4) the cost-effective formulation of infective propagules, 5) the development of unique quality-control parameters for virulent preparation, and 6) bioprospecting and value addition.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Isolation of Entomopathogenic Fungi

  1. Soil dilution method
    1. Collect the soil samples and mycosed insects from different crop fields (Table 1). Isolate the entomopathogenic fungi from soil samples using the soil dilution plating method8.
      Note: In this study, samples were collected from the Pune (18°31'13''N; 73°51'24''E) and Buldhana (19°58'36''N 76°30'30''E) districts, Maharashtra, India.
    2. Weigh 10 g of each soil sample and add them separately to 90 mL of sterile 0.1% (w/v) Tween-80.
    3. Thoroughly mix the samples using a magnetic stirrer for 60 min to release the spores adhered to soil particles.
    4. After mixing, spread 100- to 200-µL aliquots from each sample onto selective medium containing (g/L): peptone, 10; glucose, 20; agar, 18; streptomycin, 0.6; tetracycline, 0.05; cyclohexamide, 0.05; and dodine, 0.1 mL; pH 7.09. Incubate the plates at 28 °C for 3-7 days.
    5. Select and subculture the individual sporulating colonies on the same medium to obtain pure cultures.
  2. From mycosed insects
    1. Collect the mycosed insects from the field.
      Note: A hard larval body is likely to be infected with entomopathogenic fungus. With bacterial or viral infection, the dead insect body is soft.
    2. Collect live insects with abnormal behavior, poor coordination, and jerky movements.
    3. Keep the insects until death and then transfer them to moist chambers for further mycosis and sporulation, if any, at 28 °C and 70-80% RH.
    4. Streak the spores from the sporulating cadavers on the abovementioned selective medium and obtain pure cultures by further subculturing 2-3 times on the same medium.
  3. Bait method
    1. In a vial (3.85 x 6.0 cm) containing 60 g of soil sample, add 4 rice moth larvae (Corcyra cephalonica) and keep the vials at 25 ± 2 °C for a period of 14 days.
    2. Turn the vials upside down every day. After 14 days, screen the soil samples for the presence of mycosed rice moth larvae. Isolate the entomopathogenic fungus by streaking spores from sporulating cadavers on selective medium.
    3. After obtaining pure cultures, transfer the isolates to potato dextrose agar (PDA) slants and incubate at 28 °C and 70-80% RH for 7 days to allow sporulation. Following sporulation, maintain the mother cultures at 8 °C until use.

2. Identification of Entomopathogenic Fungi

  1. Identify entomopathogenic fungi by observing morphological characteristics, (i.e., asexual spore size and shape and the arrangement of the spores on conidiophores); isolates of 3 main genera, Metarhizium, Beauveria, and Nomuraea, can be identified.
  2. For the molecular identification of Metarhizium strains, extract the genomic DNA from the mycelial biomass using a DNA isolation kit; follow the manufacturer's instructions (see the Table of Materials). Check the quality of genomic DNA by performing electrophoresis on a 0.8% agarose gel.
    1. PCR-amplify the ITS1-5.8S-ITS2 and 26S rDNA region. Use genomic DNA as a template, with ITS1 forward (TCCGTAGGTGAACCTGCGG) and ITS4 reverse (TCCTCCGCTTATTGATATGC) primers10.
    2. Gel-elute and purify the expected-size amplicons using a gel extraction kit; follow the manufacturer's instructions (see the Table of Materials). Quantify the purified amplicon and sequence.
    3. Read and edit the sequences using the software and perform a BLAST search of the nucleotide sequences in the NCBI GenBank data library to analyze the close homology11.
    4. Deposit the sequences of identified entamopathogenic isolates to the NCBI GenBank database to retrieve the accession numbers.

3. Screening of Metarhizium Isolates Against H. armigera

  1. Insect rearing
    1. Establish the initial culture of H. armigera by collecting healthy larvae and pupae of the insect from the field.
    2. For rearing, grow the larvae individually in sterile polypropylene vials (3.85 x 6.0 cm, 50-mL capacity) containing pieces of okra disinfected with 0.5% (v/v) sodium hypochlorite for 10 min12.
    3. Collect the insect eggs laid during rearing and surface-sterilize them with 0.5% (v/v) sodium hypochlorite.
    4. Maintain the larvae at 25 ± 2 °C and 65 ± 5% RH.
  2. Insect bioassay
    Note: For the insect bioassay, the production of spores, and field performance studies, the first subcultures of Metarhizium strains from mycosed H. armigera larvae were used, unless otherwise noted.
    1. For the insect bioassays, use III-instar larvae of H. armigera.
    2. Dip a set of 30 larvae in triplicate individually into a 10-mL spore suspension of Metarhizium isolates (1 x 107 spores/mL, unless otherwise mentioned; viability > 90%) for 5 s.
    3. After treatment, transfer each larva individually to a separate, sterile vial to avoid cannibalism. To each vial, add moist Whatmann filter paper No. 1 and a piece of disinfected okra as feed. Change the paper and feed on alternate days.
    4. Keep the larvae at 25 ± 2 °C, 65 ± 5% RH, and 16:8 light: dark for 14 days or until they die.
    5. Transfer the dead larvae to sterile Petri plates containing moist cotton swabs and keep them at 28 °C and 70-80% RH for 3-7 days to allow mycelia and spore formation over the cadavers.
    6. For a control, treat a set of 30 larvae in triplicate with 0.1% (w/v) Tween-80 in sterile distilled water.
    7. Conduct all experiment in triplicate using freshly prepared spore suspensions. Collect and pool the data on percent mortality from three experiments to get average values. Calculate the corrected percent mortality using Abbott's formula13.
    8. Perform the experiments using a randomized complete block design (RCBD) layout, with each treatment containing a set of 30 larvae in triplicate. Based on percent mortality against H. armigera, select Metarhizium isolates for further screening of the best isolate for commercial production.
    9. Select the isolates demonstrating >90% mortality against H. armigera III-instar larvae.
      Note: Here, 12 isolates were selected.
    10. Determine the LT50 of these isolates and select the isolates demonstrating the fastest killing (in less time).
      Note: Here, 5 isolates were selected from the 12 most potent isolates.
    11. Determine the LC50 values of the selected isolates using four different concentrations (i.e., 1 × 103, 1 × 105, 1 × 107, and 1 × 109 spores/mL) of spore suspension.
    12. Determine the LC50 of the Metarhizium isolates against III-instar larvae of H. armigera to increase the possibility of identifying the difference in virulence of isolates with high mortality values that might go undetected if only a single dose is used.

4. Production of Spores of a Metarhizium Isolate for Field Performance Studies

  1. Production of Metarhizium spores by SSF
    1. For SSF, prepare the inoculum by adding 2 x 107 spores of the Metarhizium isolates to 200 mL of YPG (0.3% yeast extract, 0.5% peptone, and 1.0%, glucose) medium. Incubate the flasks at 28 °C with shaking (180 rpm) for 48 h.
    2. For the mass production of spores by SSF, use rice as a substrate unless otherwise noted.
    3. For SSF, fill autoclave bags (type/14 with a single microvented filter of 0.5 µm; 2 kg capacity; 64 × 36 cm) with 2 kg of rice. Add 1,000 mL of distilled water to the rice in the bags and soak overnight14. Autoclave the bags with the soaked rice at 121 °C for 45 min15.
    4. Inoculate the bags with 48-h-old mycelial inoculum (10% inoculum, 200 mL for 2 kg of rice) and incubate at 28 °C and 70-80% RH for 14 days.
    5. Harvest the spores by liquid extraction using 0.1% Tween-80. For this, add the contents of the bag to 0.1% Tween-80 (3 L per 1 kg of rice), mix thoroughly, separate the spores from the liquid by centrifugation, and dry at 37 °C for 2 days.
    6. Alternatively, dry the bags containing rice with the spores and some mycelia at 37 °C for 2 days to reduce the moisture content (<20%). Harvest the spores using a myco-harvester or vibro-sifter.
  2. Viability studies
    1. Determine the percent viability of the harvested spores using different methods15. For this, prepare the spore suspensions in 0.1% (w/v) Tween-80 and adjust the count to 1 × 103 spores/mL.
    2. Spread the spore suspensions (0.1 mL) onto PDA plates in triplicate and incubate at 28 °C and 70-80 % RH for 72 h.
    3. Manually count the isolated colonies and determine the total viable count for the respective sample.
  3. Spore sedimentation rate
    1. For a uniform dosage, the homogenous spore suspension is required; determine the spore sedimentation rates for Metarhizium isolates as described16. Check the sedimentation rates of spores in 0.2 M ammonium sulphate and 0.1% Tween-80.
    2. Adjust the count of the spore suspension to ~7 × 107 spores/mL to obtain an initial absorbance of 0.6 at 540 nm. Allow the cuvettes to stand undisturbed for 6 h for the spores to settle.
    3. Record the absorbance for up to 6 h. Express the sedimentation rate in percent and calculate the time required for 50% sedimentation (ST50). Repeat the experiment thrice using freshly prepared spore suspensions.

5. Field Performance Studies of the Ability of the Selected M. anisopliae Isolate to Control H. armigera in Pigeon Peas

  1. Wettable powder formulation of M. anisopliae M 34412 spores
    1. Prepare the 2.5-5% wettable powder formulation by mixing the spores with talc.
    2. Adjust the final viable count (TVC) to 1 x 1012 spores per kg of formulation.
  2. Field performance studies of M. anisopliae M 34412 spores
    1. For field performance studies of the ability of the selected M. anisopliae isolate to control H. armigera infestation in pigeon peas,use an RCBD with four replications.
      Note: Here, performed at Mahatma Phule Krushi Vidyapeeth (MPKV), Rahuri (19.3927° N, 74.6488° E).
    2. Use two different spray formulations, an oil formulation of spores (5 x 1012 spores/3 L of diesel: sunflower oil, 7:3) and an aqueous formulation in Tween-80 (0.1%). Spray the oil formulation with an ultra-low volume (ULV) sprayer (70 min; 3 L/ha) the aqueous formulation with a knapsack sprayer (5 x 1012 spores, 500 L/ha).
      Note: Here, the larval populations were recorded one day before the spray and 3 and 7 days after the application of each spray to 5 randomly selected plants. The total population was transformed to the square root of n + 1 for the statistical analysis.
      1. According to agricultural practices for the pigeon pea crop, perform the first spraying between 10 and 15 d after egg laying and 2 more times with a 14-day interval. Perform the spraying between 16:00 and 18:00 h IST. Monitor the wind direction and, if necessary, use cloth curtains to avoid the drift of spores to neighboring plots.
    3. For comparison, spray the chemical insecticides with a hand compression knapsack sprayer.
    4. Determine the persistence of the inoculum in the field by collecting H. armigera larvae 0, 3, 5, 7, and 14 days after spraying.
    5. Keep these larvae under observation for a period of 14 days and after death, transfer them to a plastic vial containing moist filter paper. Incubate at 25 ± 2 °C and 70 ± 10% RH to observe mycosis.
    6. Determine the persistence of the inoculum on the larval population based upon the percent mortality data of the larvae collected from the field after spraying.
    7. Evaluate the field studies on the basis of percent efficacy17, percent pod damage, and percent yield18.
      Note: Here, the data for the parameters, such as temperature, humidity, wind velocity (km/h), sunshine (h), rainfall (mm), rainy days, and evaporation (mm), were recorded during a trial at an agriculture university (Mahatma Phule Krushi Vidyapeeth, Rahuri, 19.3927° N, 74.6488° E).
  3. Farmers' participatory program
    1. Select the number of farmers for the demonstration trials. Supply the pigeon pea seeds (BSMR - 736) along with fertilizer to the farmers.
      Note: In this study, 20 farmers were involved. Village: Deolali Pravara, (19.473° N 74.6° E).
    2. Use the same spray formulations and number of sprays as in step 5.2.

6. Effect on Non-target Organisms

  1. Observe the effect of mycoinsecticide spray, if any, on the pigeon pea leaves.
  2. Collect the soil dwelling arthropods and leaf-inhabiting insects 1 day after each treatment in the untreated plots and in the plots treated with M. anisopliae.
  3. Collect the soil-dwelling arthropods with pitfall traps within 24 h after treatment and collect the leaf-inhabiting insects with a sweep net on the morning following the treatment (i.e., about 15-18 h after treatment).
  4. Keep them individually in cylindrical plastic boxes with diameters of 3.5 cm and heights of 4.0 cm. Check the insects daily for infection and feed them with appropriate food.
  5. Record the presence of M. anisopliae, if at all, and isolate the fungus.

7. Identification of Quality-control Parameters

  1. Check the spore viability by measuring the spore germination on PDA at 28 °C.
  2. Measure cuticle degrading enzyme activities, such as chitinase, chitin deacetylase, chitosanase, protease, and lipase, produced in the YPG and chitin media, as described earlier15.
  3. Determine the percent mortality of H. armigera in a laboratory bioassay15.
  4. Use molecular markers, such as a PCR-RFLP pattern of Chitinases (Chit 1, 2, and 4) and protease (Pr1A) genes, as virulence attributes for M. anisopliae.
    1. Extract the genomic DNA from the mycelia biomass using a DNA isolation kit15. PCR-amplify the Chit1 and Chit2 gene fragments using genomic DNA as a template, with primer pairs Chit1F/Chit1R (CTCTGCAGGCCACTCTCGGT/AGCCATCTGCTTCCTCATAT) and Chit2F/Chit2R (GACAAGCACCCGGAGCGC/GCCTTGCTTGACACATTGGTAA). For Chit4, use the primer pair Chit4F/Chit4R (ATCCGGCAGCACGGCTAC/CTTGGATC CGTCCCAGTTG).
    2. For the amplification of the Pr1A gene, use the METPR2 and METPR5 primer pair (AGGTAGGCAGCCAGACCGGC/TGCCACTATTGGCCGGCGCG).
    3. Perform the restriction digestion19 of the Chit1 gene with BsaJI, BstUI, and ScrFI; of the Chit2 gene with AluI, HpyCH4IV, and HpyCH4V, and of the Chit4 gene with BstUI, HaeIII, and MboI. For the digestion of the Pr1A gene, use RsaI, DdeI, and MspI20.
    4. Observe the restriction fragment length polymorphism (RFLP) pattern on 1.5% agarose gel by electrophoresis for each gene for most virulent strains (>90% mortality); this can be used as a virulence marker for the selection of M. anisopliae.

Access restricted. Please log in or start a trial to view this content.

Results

During the investigations, different strains of Metarhizium, Beauveria, and Nomuraea were isolated by various isolation methods (data not shown)6,14 As Metarhizium strains were found to be more effective at controlling H. armigera, a dreadful pest in pulses6,14, further isolations were targeted to isolate Metarhizium strains from different crop fields and insec...

Access restricted. Please log in or start a trial to view this content.

Discussion

During the 1880s, the first attempt was made to use Metarhizium to control the scarab beetle, Anisoplia austriaca, and the sugar beet curculio, Cleonis punctiventris21. In this protocol, one of the prerequisites was to isolate a virulent strain, either from the soil or from infected insects. Indeed, other parameters, such as LC50, LT50, and ST50, significantly contributed to the cost-effectiveness of the product22<...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

The authors acknowledge the contribution of collaborators from the Indo-Swiss Collaboration in Biotechnology (ISCB) program of the Department of Biotechnology, New Delhi and the Swiss Agency for Development and Cooperation, Berne, Switzerland. The contributions of project students and staff involved in the development of the mycoinsecticide, including Vandana Ghormade, Pallavi Nahar, Priya Yadav, Shuklangi Kulkarni, Manisha Kapoor, Santosh Chavan, Ravindra Vidhate, Shamala Mane, and Abhijeet Lande, are acknowledged. EKP and SGT thank the University Grants Commission, India and the Council of Scientific and Industrial Research (CSIR), India, respectively, for research fellowships. MVD acknowledges the support from the Council of Industrial and Scientific Research, New Delhi for the Emeritus Scientist Scheme. The authors are grateful to the Department of Biotechnology, New Delhi, India for the financial support under the ISCB and SBIRI programs. We are thankful to reviewers for their inputs.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
AgarHi-MediaRM666Reagent
Ammonium sulphate Thomas Baker11645Reagent
DNA analyzer Applied biosystemABI prism 3730  Instrument
DNA islation kitQiagen69104Reagent
DodineSigma45466Reagent
Gel extraction kitQiagen28604Reagent
GlucoseHi-MediaGRM077Reagent
Knapsac sparyerKaypeeHY-16L (1004)Instrument
PeptoneHi-MediaRM006-500GReagent
Polypropylene vials LaxbroSV-50Plasticware
Potato dextrose agar (PDA) Hi-MediaM096-500GReagent
Tween-80SRL28940Reagent
Ultra low volume sparyerMatabiINSECDISKInstrument
Unicorn-bags UnicornUP-140024-SMBAutoclavalbe bag for SSF
Yeast extractHi-MediaRM027-500GReagent
Chromas 2.1software

References

  1. Aktar, M. W., Sengupta, D., Chowdhury, A. Impact of pesticides use in agriculture: their benefits and hazards. Interdisciplinary Toxicology. 2 (1), 1-12 (2009).
  2. Dhaliwal, G. S., Jindal, V., Mohindru, B. Crop losses due to insect pests: Global and Indian scenario. Indian J Entomol. 77 (2), 165-168 (2015).
  3. Popp, J., Peto, K., Nagy, J. Pesticide productivity and food security. A review. Agronomy for Sustainable Development. 33 (1), 243-255 (2015).
  4. van Lenteren, J. C., Manzaroli, G. Evaluation and use of predators and parasitoids for biological control of pests in greenhouses. Integrated pest and disease management in greenhouse crops. Albajes, R., Gullino, M. L., van Lenteren, J. C., Elad, Y. , Kluwer. Dordrecht, The Netherlands. 183-201 (1999).
  5. Charnley, A. K., Collins, S. A. Entomopathogenic fungi and their role in pest control. The Mycota IV: Environmental and Microbial Relationships. Kubicek, C. P., Druzhinina, I. S. , 2nd, Springer-Verlag. Berlin. 159-187 (2007).
  6. Deshpande, M. V., et al. Comparative evaluation of indigenous fungal isolates, Metarhizium anisopliae M34412, Beauveria bassiana B3301 and Nomuraea rileyi N812 for the control of Helicoverpa armigera (Hüb.) on pulses. Proceeding of the international workshop on entomopathogenic fungi - a valuable alternative to fight against insect pests. MV, D. eshpande , National Chemical Laboratory. Pune, India. 51-59 (2004).
  7. Roberts, D. W., Hajek, A. E. Entomopathogenic fungi as bioinsecticides. Frontiers in industrial mycology. Leathan, G. F. , Chapman & Hall. New York, NY. 144-159 (1992).
  8. Goettel, M., Inglis, G. D. Fungi: Hyphomycetes. Manual of techniques in insect pathology. Lacey, L. A. , Academic Press. USA. 213-245 (1996).
  9. Keller, S., Kessler, P., Schweizer, C. Distribution of insect pathogenic soil fungi in Switzerland with special reference to Beauveria brongniartii and Metharhizium anisopliae. BioControl. 48 (3), 307-319 (2003).
  10. White, T. J., Bruns, T., Lee, S., Taylor, J., et al. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR-Protocols: A guide to methods and applications. Innis, M. A., et al. , Academic Press, Inc. San Diego. USA. 315-322 (1990).
  11. Basic Local Alignment Search Tool. , http://www.ncbi.nlm.nih.gov/BLAST (2017).
  12. Ignoffo, C. M., Futtler, B., Marston, N. L., Hostetter, D. L., Dickerson, W. A. Seasonal incidence of the entomopathogenic fungus Spicaria rileyi associated with noctuid pests of soybeans. J Invertebr Pathol. 25 (1), 135-137 (1975).
  13. Abbott, W. S. A method for computing the effectiveness of an insecticide. J Econ Entomol. 18 (2), 265-267 (1925).
  14. Nahar, P. Development of biocontrol agents for the control of pests in agriculture using chitin metabolism as target. , PhD thesis submitted to Department of Microbiology, University of Pune 137(2004).
  15. Kulkarni, S. A., et al. Comparison of Metarhizium isolates for biocontrol of Helicoverpa armigera (Lepidoptera: Noctuidae) in chickpea. Biocontrol Sci Tech. 18 (8), 809-828 (2008).
  16. Jeffs, L. B., Khachatourians, G. G. Estimation of spore hydrophobicity for members of the genera Beauveria, Metarhizium, and Tolypocladium by salt-mediated aggregation and sedimentation. Can J Microbiol. 43 (1), 23-28 (1997).
  17. Henderson, C. F., Tilton, E. W. Tests with acaricides against the brow wheat mite. J Econ Entomol. 48 (2), 157-161 (1955).
  18. Hassani, M. Development and proving of biocontrol methods based on Bacillus thuringiensis and entamopathogenic fungi against the cotton pests Spodoptera littoralis, Helicoverpa armigera (Lepidoptera: Noctuidae) and Aphis gossypii (Homoptera: Aphididae). , PhD thesis submitted to Justus-Liebig-University Giessen, Germany (2000).
  19. Enkerli, J., Ghormade, V., Oulevey, C., Widmer, F. PCR-RFLP analysis of chitinase genes enable efficient genotyping of Metarhizium anisopliae var. anisopliae. J Invert Pathol. 102 (2), 185-188 (2009).
  20. Bidochka, M. J., Melzer, M. J. Genetic polymorphism in three subtilisin-like protease isoforms (Pr1A, Pr1B and Pr1C) from Metarhizium strains. Can. J. Microbiol. 46 (12), 1138-1144 (2000).
  21. McCoy, C. W., Samson, R. A., Boucias, D. G. Entomogenous fungi. Handbook of natural pesticides, Microbial insecticides, Part A. Entomogenous protozoa and fungi. Ignoffo, C. M., Mandava, N. B. , CRC Press. Boca Raton, FL. 151-236 (1988).
  22. Nahar, P. B., et al. Effect of repeated in vitro sub-culturing on the virulence of Metarhizium anisopliae against Helicoverpa armigera (Lepidoptera Noctuidae). Biocontrol Sci Tech. 18 (4), 337-355 (2008).
  23. Kapoor, M., Deshpande, M. V. Development of mycoinsecticide for the control of insect pests: Issues and challenges in transfer of technology from laboratory to field. Kavaka. 40, 45-56 (2013).
  24. Deshpande, M. V. Mycopesticide Production by Fermentation: Potential and Challenges. Crit Rev Microbiol. 25 (3), 229-243 (1999).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

Mycoinsecticide DevelopmentInsect BioassaySolid State FermentationSpore ProductionSoil Dilution MethodLC50 DeterminationLT50 MeasurementField Trial EvaluationQuality Control Parameters

Related Articles