Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Das Studium der Zellzyklus-regulierten Genexpression durch zwei komplementäre Zellsynchronisationsprotokolle

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Wir berichten über zwei Zellsynchronisationsprotokolle, die einen Kontext für das Studium von Ereignissen im Zusammenhang mit bestimmten Phasen des Zellzyklus bieten. Wir zeigen, dass dieser Ansatz für die Analyse der Regulation von spezifischen Genen in einem ungestörten Zellzyklus oder bei Exposition gegenüber Mitteln, die den Zellzyklus beeinflussen, nützlich ist.

Abstract

Das Genexpressionsprogramm des Zellzyklus stellt einen kritischen Schritt zum Verständnis von zellzyklusabhängigen Prozessen und deren Rolle bei Krankheiten wie Krebs dar. Die zellzyklusregulierte Genexpressionsanalyse hängt von der Zellsynchronisation in spezifische Phasen ab. Hier beschreiben wir eine Methode, die zwei komplementäre Synchronisationsprotokolle verwendet, die üblicherweise zum Studieren einer periodischen Variation der Genexpression während des Zellzyklus verwendet werden. Beide Verfahren basieren auf einer vorübergehenden Blockierung des Zellzyklus in einem definierten Punkt. Das Synchronisationsprotokoll durch Hydroxyharnstoffbehandlung (HU) führt zu einem zellulären Arrest in der späten G1 / frühen S-Phase, und die Freisetzung aus dem HU-vermittelten Arrest liefert eine zelluläre Population, die gleichmäßig durch S und G2 / M fortschreitet. Das Synchronisationsprotokoll durch Thymidin- und Nocodazol (Thy-Noc) -Behandlung blockiert Zellen in der frühen Mitose und die Freisetzung von Thy-Noc-vermittelten Arrest liefert eine synchronisierte zelluläre Population, die für die G1-Phase und die S-Phase-en geeignet istVersuche Studien. Die Anwendung beider Verfahren erfordert die Überwachung der Zellzyklusverteilungsprofile, die typischerweise nach der Propidiumjodid (PI) -Färbung der Zellen und der Durchflusszytometrie-vermittelten Analyse des DNA-Gehalts durchgeführt wird. Wir zeigen, dass die kombinierte Verwendung von zwei Synchronisationsprotokollen ein robuster Ansatz ist, um die Transkriptionsprofile von Genen, die im Zellzyklus unterschiedlich reguliert sind ( dh E2F1 und E2F7), klar zu bestimmen und folglich ein besseres Verständnis ihrer Rolle im Zellzyklus zu haben Prozesse. Darüber hinaus zeigen wir, dass dieser Ansatz für die Untersuchung von Mechanismen, die Drogen-basierten Therapien ( dh Mitomycin C, ein Antikrebsmittel) zugrunde liegen, nützlich ist, da es erlaubt, Gene zu unterscheiden, die auf das genotoxische Mittel reagieren, von denen, die nur von Zellzyklus-Störungen betroffen sind Verhängt durch den agent

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Der Übergang durch alle Phasen des Zellzyklus ist an ein streng reguliertes Genexpressionsprogramm gekoppelt. Dieses koordinierte "On und Off" der Gen-Transkription im gesamten Zellzyklus wird vermutlich unter der Kontrolle von komplexen Transkriptionsregulationssystemen liegen, was nicht nur das Timing, sondern auch die Ebenen der Genexpression reguliert. Die Deregulierung von Schlüssel-Zell-Zyklus-Komponenten ist bekannt, um zur Entwicklung von mehreren Krankheiten beitragen und ist ein etabliertes Kennzeichen der Tumorigenese 1 , 2 . Genom-weite transkriptomische Analysen, die in Hefe- und Säugetierzellen durchgeführt wurden, haben ergeben, dass eine große Anzahl von Genen periodische Genexpressionsmuster im Zellzyklus aufweisen, was darauf hindeutet, dass die Transkriptionsfluktuation während des Zellzyklus eine Reflexion der zeitlichen Anforderung eines gegebenen Genprodukts ist In einer präzisen Phase 3 , 4 , 5

Eine wesentliche Aufgabe bei der Untersuchung der zellzyklusregulierten Genexpression ist die Synchronisation von Zellen in spezifische Zellzyklusphasen. Die Zellsynchronisation hilft, die Assoziation eines Genexpressionsmusters auf einen bestimmten Zellzyklus-Phasenübergang zu interpretieren, und es hat zu einem besseren Verständnis der Regulation und Funktion zahlreicher Gene geführt. Die Zellsynchronisation ist auch wichtig für die Untersuchung des Wirkmechanismus von Antikrebsarzneimitteln, da bekannt ist, dass Chemotherapeutika sowohl die Genexpression als auch die Zellzykluskinetik 6 , 7 beeinflussen. Trotzdem ist es oft schwierig zu bestimmen, ob die aus der Behandlung mit diesen Mitteln resultierenden Genexpressionsdifferenzen eine direkte Reaktion auf die Behandlung sind oder lediglich die Folge von Veränderungen der Zellzyklusprofile sind. Um zwischen diesen Möglichkeiten zu unterscheiden, sollte die Genexpression in Zellen analysiert werden, die s gewesen sindYnchronisiert vor der Zugabe des chemotherapeutischen Arzneimittels.

Mit Ausnahme von einigen primären Zellen wie frisch isolierten lymphatischen Zellen, die eine homogene Zellpopulation darstellen, die in G0 8 synchronisiert ist, wachsen in vitro etablierte Zelllinien asynchron in Kultur. Unter regelmäßigen Wachstumsbedingungen finden sich diese asynchron zyklischen Zellen in allen Phasen des Zellzyklus, aber bevorzugt in G1 9 . Daher bietet dieser Kontext kein optimales Szenario für Funktions- oder Genexpressionsanalysen in einer bestimmten Zellzyklusphase ( zB G1, S etc.). Nicht transformierte immortalisierte Zelllinien ( zB Fibroblasten) können mit sogenannten physiologischen Methoden synchronisiert werden 10 . Diese Methoden basieren auf den beibehaltenen primären Zellmerkmalen von nicht-transformierten Zellen, wie z. B. Zell-Kontakt-Inhibition und Wachstumsfaktor-Abhängigkeit, um den Zyklus fortzusetzen. EntfernungDes Serums in Kombination mit Kontaktinhibierung macht nicht-transformierte Zellen bei G0 / G1 verhaftet. Der synchronisierte Zellzykluseintrag und die Progression erfordert jedoch oft eine Subkultur, die auch eine künstliche Ablösung der Zellen und eine erneute Plattierung beinhaltet. Am wichtigsten ist, dass dieses Verfahren nicht für die Synchronisation von transformierten Zelllinien geeignet ist, wobei die überwiegende Mehrheit der etablierten Zelllinien, die gegenwärtig verwendet werden, dadurch gekennzeichnet ist, dass sie keine Zellkontakt-vermittelte Wachstumshemmung oder Reaktion auf Wachstumsfaktorentzug haben. So ist es klar, dass alternative Verfahren für eine effiziente Zellsynchronisation in bestimmten Phasen des Zellzyklus erforderlich sind. Im Allgemeinen basieren die am häufigsten verwendeten Synchronisationsmethoden auf einer transienten chemischen oder pharmakologischen Hemmung eines definierten Punktes des Zellzyklus, typischerweise DNA-Synthese oder mitotischer Spindelbildung. Die Hemmung der DNA-Synthese synchronisiert die Zellen, indem sie sie in der späten G1- oder frühen S-Phase festnehmen. Das kann achi seinDurch die Zugabe von Verbindungen wie Mimosin, einem Inhibitor der Nukleotidbiosynthese 11 , 12 , Aphidicolin, einem Inhibitor der DNA-Polymerasen 13 , 14 , Hydroxyharnstoff, einem Inhibitor der Ribonukleotidreduktase 15 , 16 oder durch überschüssige Mengen an Thymidin 17 , 18, Andererseits sind Inhibitoren der Mikrotubuluspolymerisation, wie Colchicin oder Nocodazol, in der Lage, die mitotische Spindelbildung zu blockieren, die zu einer Zellsynchronisation in der frühen M-Phase 19 , 20 , 21 führt .

In dieser Arbeit beschreiben wir eine Methode, die zwei komplementäre Synchronisationsprotokolle umfasst, die auf einer transienten chemischen Inhibition basieren, um die Expression von zellzyklusregulierten Genen an der mRNA zu untersuchenEbene. Diese Methode ist grundlegend für die Definition der Rolle von Zellzyklus-Genen in bestimmten Zellzyklus-Prozesse. Darüber hinaus bietet es einen allgemeinen Rahmen für das Studium der Auswirkungen von Antikrebs-Behandlungen, um genau zu erkennen, Droge reagierende Gene und zu minimieren Fehlinterpretationen aus Störungen in Zellzyklus Progression von diesen Medikamenten generiert abgeleitet.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Zelluläre Synchronisation, Freigabe und Überwachung der Zellzyklusprogression

  1. Thymidin- und Nocodazol-basierte (Thy-Noc) Synchronisation und Freisetzung von U2OS-Zellen aus Mitose
    1. Bereiten Sie das erforderliche Zellkulturmedium vor. U2OS-Zellen werden routinemäßig in DMEM-Glutamin-Medium, ergänzt mit 10% (vol / vol) FBS (optional: 1% Penicillin / Streptomycin), gezüchtet. Führen Sie die mittlere Vorbereitung und Manipulation unter sterilen Bedingungen durch und erwärmen Sie das komplementierte Medium (von nun an als "komplettes Medium") bis 37 ° C vor dem Gebrauch aufwärmen.
    2. Samen 2 x 10 6 U2OS Zellen pro 100 mm Schale in 10 ml vollständigem Kulturmedium. Um die Anzahl der benötigten Speisen zu berechnen, ist zu berücksichtigen, dass jede 100-mm-Schale typischerweise genügend mitotische Zellen bereitstellt, um etwa 5 Vertiefungen einer 6-Well-Platte (0,2 - 0,25 x 10 & sup6; Zellen / Vertiefung) wieder aufzubauen (siehe Fig 1B ). Zwei Brunnen pro ausgewählter Zeitpunkt sind requirIm Experiment (1 Well für RNA Extraktion und 1 Well für Zellzyklusüberwachung). Zusätzlich kann eine dritte Vertiefung pro Zeitpunkt für die Proteinanalyse gesammelt werden.
      HINWEIS: Tellerzellen am Abend (ca. 19 Uhr), so dass nachfolgende Schritte während der Arbeitszeit in den folgenden Tagen durchgeführt werden können. Include 2 zusätzliche Brunnen von asynchron wachsenden Zellen, um die FACS-Analysekompensationseinstellungen zu definieren.
    3. Lassen Sie die Zellen durch Inkubieren von 100 mm-Schalen bei 37 ° C in einer befeuchteten Atmosphäre mit 5% CO 2 für 24 h anhängen.
    4. Für den Thymidinblock wird eine 200 mM Thymidin-Stammlösung durch Auflösen von 145,2 mg Thymidinpulver in 3 ml H 2 O (oder äquivalenten Mengen) hergestellt und die Lösung durch Filtration durch ein 0,2 μm Porengrßenfilter sterilisiert. Leichte Erwärmung könnte helfen, Thymidin aufzulösen. 100 μl des frisch zubereiteten 200 mM Stammes zu jeder 100 mm Kulturschale (Endkonzentration 2 mM) geben. Inkubieren von Zellen mit Thymidin für 20 h bei 3776, C in einer befeuchteten Atmosphäre mit 5% CO 2 .
      HINWEIS: Behandeln Sie Zellen am Abend (um 7 Uhr), um Zeit zu haben, sowohl Thymidin-Freisetzung als auch Nocodazol-Block am nächsten Tag durchzuführen.
    5. Um aus dem Thymidin-Block freizusetzen, entfernen Sie Thymidin-haltiges Wachstumsmedium am Nachmittag des folgenden Tages (15 Uhr); Waschen Sie die Zellen zweimal mit vorgewärmtem 1x PBS und fügen Sie 10 ml vollständiges Medium zu jeder 100 mm Schale hinzu. Inkubieren von Zellen für 5 h bei 37 ° C in einer befeuchteten Atmosphäre mit 5% CO 2 .
    6. Für den mitotischen Zellarrest fügen Sie Nocodazol zu einer Endkonzentration von 50 ng / ml (20 Uhr) hinzu. Eine Stammlösung durch Auflösen von Nocodazolpulver in DMSO ( zB 5 mg / ml) zubereiten und bei -20 ° C gefroren aufbewahren. Inkubieren von Zellen mit Nocodazol für nicht länger als 10 - 11 h bei 37 ° C in einer befeuchteten Atmosphäre mit 5% CO 2 .
    7. Freisetzung aus dem Nocodazol-vermittelten Arrest in der frühen M-Phase (mitotisches Shake-off) und Sammlung von Proben zu mehrmals poiNts (ab 6-7 Uhr).
      1. Abgerundete (mitotische) Zellen durch Schütteln jeder Platte und sanftes Pipettieren von nocodazolhaltigem Wachstumsmedium abziehen. Sammeln Sie das Medium mit abgelösten Zellen von jeder 100 mm-Platte in 50 ml sterile Röhrchen, zentrifugieren Sie (300 xg, 5 min, Raumtemperatur (RT)) und waschen Sie die Zellen zweimal, indem Sie 1x PBS hinzufügen, gefolgt von Zentrifugation. Die Verwendung von kaltem PBS oder PBS plus Nocodazol wird empfohlen, um mitotischen Schlupf zu vermeiden (siehe Diskussionsteil).
      2. Resonieren Sie mitotische Zellen, die aus jeder 100 mm Platte in 10 ml vollständigem Medium gewonnen wurden. Sparen Sie 2 ml für die RNA-Extraktion und 2 ml für die FACS-Analyse für den 0-h-Zeitpunkt (ca. 0,2-0,25 x 10 6 Zellen pro Probe).
      3. Wiederholte verbleibende mitotische Zellen für nachfolgende Zeitpunkte in 6-Well-Platten (2 ml / Vertiefung, 0,2-0,25 x 10 & sup6; Zellen / Vertiefung).
        HINWEIS: Denken Sie daran, dass 2 ausgewählte Zeitpunkte (1 für RNA und 1 für die FACS-Analyse) benötigt werden.
    8. Sammle Proben bei selZeitpunkte. Alle 1,5 bis 3 h werden empfohlen, um ein adäquates Profil der Zellzyklusprogression zu erhalten.
      1. Für die RNA-Extraktion, entfernen Sie das Medium, spülen Sie gut mit 2 ml vorwärmenden 1x PBS aus und fügen Sie 1 ml des geeigneten RNA-Isolationsreagenzes ( zB TRIzol) in den Brunnen hinzu (führen Sie diesen letzten Schritt in einem Sicherheitsschrank für Chemikalien) durch. Pipettieren Sie nach oben und unten, um Zellen zu lindern und zu lysieren, übertragen Sie das Zelllysat in ein 1,5 ml Mikrozentrifugenröhrchen, inkubieren Sie 5 min bei RT und speichern Sie das Röhrchen bei -80 ° C bis zur weiteren Verwendung.
      2. Für die FACS-Analyse mit 2 ml vorwärmendem 1x PBS gut ausspülen, vorgewärmte Trypsin-EDTA-Lösung (0,3 ml / Vertiefung) abgeben, um Zellen zu entfernen, Trypsin-EDTA zu blockieren, indem man 1 ml vollständiges Medium zugibt und jede Probe in einem separaten sammelt 15 ml Rohr.
        1. Zentrifugen von Zellen (300 xg, 5 min, RT), retten zelluläres Pellet und verwerfen den Überstand. Um Zellen zu fixieren, werden die Zellen in 1 ml gekühltem 70% (v / v) Ethanol in 1x PBS durch sanftes Vortexen von Röhrchen resuspendiert und auf Eis gelegtEtwa 15 min vor der Lagerung bei 4 ° C oder zur Färbung zur weiteren Analyse durch FACS (beschrieben in den Schritten 1.4 - 1.5).
  2. HU-basierte Synchronisation und Freisetzung von U2OS-Zellen aus G1 / S-Grenze
    1. Vorbereiten des vollständigen Zellkulturmediums, wie in Schritt 1.1 beschrieben.
    2. Samen 0,25 x 10 & sup6; U2OS-Zellen pro Vertiefung in 6-Well-Platten (2 ml vollständiges Kulturmedium pro Vertiefung). Um die für das Experiment benötigte Anzahl von Bohrlöchern zu berechnen, ist zu berücksichtigen, dass für einen ausgewählten Zeitpunkt 2 Vertiefungen erforderlich sind (1 Well für die RNA-Extraktion und 1 Well für die Zellzyklusüberwachung) und dass 2 zusätzliche Wells von asynchron wachsenden Zellen sind Benötigt, um die Einstellungen der FACS-Analyse zu definieren.
    3. Die Zellen werden durch Inkubieren von 6-Well-Platten über Nacht (O / N) bei 37 ° C in einer befeuchteten Atmosphäre mit 5% CO 2 gebunden.
    4. Entfernen Sie das komplette Medium aus den Brunnen am nächsten Morgen und fügen Sie 2 ml hinzuVon vorgewärmtem FBS-freiem DMEM-Glutamin-Medium pro Vertiefung. Inkubieren von Zellen für weitere 24 h bei 37 ° C in einer befeuchteten Atmosphäre mit 5% CO 2 .
      HINWEIS: Führen Sie diesen Schritt in allen Vertiefungen mit Ausnahme von 2 (die gespeichert, um FACS-Einstellungen zu definieren). Der Serumentzugsschritt kann weggelassen werden, wenn eine effiziente Synchronisation durch einfaches Inkubieren von Zellen mit HU erreicht wird.
    5. G1 / S-Zellzyklus verhaftet mit HU.
      1. Vor dem Gebrauch eine frische HU-Stammlösung (500 mM) vorbereiten. 2 ml H 2 O zu 76,06 mg HU-Pulver zugeben und mischen, bis es gut aufgelöst ist. Sterilisieren der Lösung durch Filtration durch ein 0,2 μm Porengrßenfilter. Mischen Sie 50 ml vollständiges Medium mit 400 μl Filter-sterilisierter HU-Stammlösung für eine endgültige HU-Konzentration von 4 mM.
      2. Entfernen Sie das Medium aus allen Vertiefungen, außer aus den 2 Vertiefungen, die für die Definition der FACS-Einstellungen erforderlich sind, und ersetzen Sie es durch ein frisch zubereitetes 4 mM HU-haltiges vollständiges Medium (2 ml / Vertiefung).
      3. Inkubieren von Zellen für 24 h inHU-haltiges Medium bei 37 ° C in einer befeuchteten Atmosphäre mit 5% CO 2 .
    6. Freisetzung von Zellen aus HU-vermittelter Verhaftung. HU-haltiges Medium aus den Brunnen entfernen und die Wells zweimal mit vorgewärmtem 1x PBS (jeweils 2 ml) abspülen. 2 ml Vollmedium pro Vertiefung zugeben. Sammeln Sie 2 Proben für den 0-h-Zeitpunkt (1 für die RNA-Extraktion und 1 für die Zellzyklus-Verhaftungsüberprüfung durch FACS) sowie 2 Samples, die für die FACS-Einstellungen gespeichert wurden. Legen Sie die restlichen Brunnen in den Inkubator.
    7. Sammle Proben alle 1,5 bis 3 Stunden, um eine adäquate Verteilung der Zellzyklusprogression zu erhalten. Zu jedem Zeitpunkt die Probenverarbeitung durchführen (für die RNA-Extraktion und für die FACS-Analyse), wie in 1.1.8.1-1.1.8.2 beschrieben.
  3. Behandlung mit DNA-schädigenden Mitteln
    HINWEIS: Immer wenn es darum geht, die Wirkung einer Verbindung ( zB DNA-schädigende Agenzien) in Zellzyklus-Ereignissen zu ermitteln, kann jede der zuvor beschriebenen Synchronisationsmethoden seinKombiniert mit der Behandlung von Zellen mit dem genotoxischen Mittel. Um die Synchronisationsmethode zu wählen, ist es wichtig, die Phase des Zellzyklus zu betrachten, die wir analysieren möchten. Im Allgemeinen kann das Thy-Noc-Verfahren geeignet sein, die Wirkung einer Verbindung in der G1-Phase oder des S-Phaseneintrags zu untersuchen, während die HU-vermittelte Synchronisation geeigneter ist, um den Einfluss in S bis G2-Phasen oder im Eintritt zur Mitose zu untersuchen.
    1. Analyse der Wirkung von genotoxischen Mitteln in G1-Phase oder S-Phase-Eintritt
      1. Synchronisieren Sie die Zellen wie in 1.1.2 beschrieben. Bis 1.1.6.
      2. Die Zellen aus Nocodazol freisetzen und wie in 1.1.7 beschrieben wieder aufplatten. Inkubieren sie bei 37 ° C in einer befeuchteten Atmosphäre mit 5% CO 2 für 3 h, um sie vor dem Hinzufügen von Mitteln zuzugeben (erforderliche Inkubationszeit kann je nach Zelllinie variieren).
      3. Add Agent und sammeln Proben wie zuvor in 1.1.8 beschrieben.
    2. Analyse der Wirkung von Genotoxika in SG2 Phasen oder M Eintrag
      1. Synchronisieren Sie die Zellen wie in 1.2.2 beschrieben. Bis 1.2.5.
      2. Freisetzen von Zellen aus HU, wie in 1.2.6 beschrieben. Und Agent sofort hinzufügen.
      3. Sammle Proben wie oben in 1.8 beschrieben.
  4. Überwachung der Zellsynchronisation und -progression durch den Zellzyklus durch Propidiumjodid (PI) -Färbung und FACS-Analyse
    HINWEIS: Proben, die zu allen Zeitpunkten gesammelt wurden, zusammen mit denen, die zur Definition von FACS-Einstellungen erforderlich sind, können bei 4 ° C gespeichert werden, sobald sie fixiert sind (wie in 1.1.8.2 erwähnt). Färben Sie die Färbung mit PI-Lösung, gefolgt von der FACS-Analyse für alle Proben des Experiments gleichzeitig. PI interkaliert in die Hauptrille von doppelsträngiger DNA, die ein hochfluoreszierendes Signal erzeugt, wenn sie bei 535 nm mit einem breiten Emissionspeak um 600 nm angeregt wird. Da PI auch an doppelsträngige RNA binden kann, ist es notwendig, die Zellen mit RNase für eine optimale DNA-Auflösung zu behandeln.
    1. Frisch hergestellte PI-Färbelösung vorbereiten. Eine PI-Stammlösung kann durch Auflösen von PI-Pulver in PBS ( zB 5 mg / ml) hergestellt werden. Lagern Sie die Stammlösung bei 4 ° C (in Dunkelheit). Die Färbelösung besteht aus PI (140 μM), Natriumcitrat (38 mM) und Triton X-100 (0,01% v / v).
    2. Aufwärmen einer geeigneten Oberfläche ( zB Backofen) auf 37 ° C.
    3. Zentrifugen feste Zellen (450 xg, 5 min, RT), dekantierender Überstand (Ethanol) und einmal mit 1x PBS waschen.
    4. Zentrifugieren Sie Zellen erneut, entfernen Sie PBS und fügen Sie 300 μl PI-Färbelösung pro Probe hinzu (mit Ausnahme einer der Proben für FACS-Einstellungen), addieren Sie PBS zu dieser Probe stattdessen.
    5. Übertragen von Zellen auf FACS-Röhrchen (5 ml Rundboden-Polystyrol-Röhrchen).
    6. Füge 1 μl RNase A zu jeder Probe hinzu, mischen und inkubiere die Proben für 30 min in Dunkelheit bei 37 ° C. Proben können bei 4 ° C für ein Maximum von 2 - 3 Tagen vor Licht geschützt geschützt werden.
    7. Analysieren Sie den DNA-Gehalt in Proben nach DurchflussZytometrie Definieren Sie die FACS-Analysekompensationseinstellungen mit PI-gefärbten asynchronen Samples. Verwenden Sie eine Blindprobe (ohne PI-Färbelösung), um die Autofluoreszenz zu überprüfen. Grundlagen der PI-färbungsvermittelten Analyse des DNA-Gehalts durch Durchflusszytometrie wurden zuvor beschrieben 9 .
  5. Bestimmung des mitotischen Index durch doppelte Phospho-H3 (Ser 10) / PI-Färbung
    HINWEIS: Zellen, die sich einer Mitose unterziehen, können leicht durch Durchflusszytometrie mit Antikörpern identifiziert werden, die für Phospho-Histon H3 in Serin 10 (pH 3) spezifisch sind. Eine gleichzeitige PI-Färbung ist nützlich, um die DNA-inhaltsbasierte Verteilung der Zellpopulation zu bestimmen. Für die optimalen Konfigurationen der FACS-Einstellungen sind 5 Samples erforderlich: leer, nur PI-nur, pH3-only, sekundärer Antikörper und doppelte Färbung.
    1. Zentrifugierte feste Zellen (450 xg, 5 min, 4 ° C) und verwerfen den Überstand. Die folgenden Schritte werden beschrieben, um eine Färbung in 15 ml Röhrchen durchzuführen.
    2. Waschen von Zellen durch Zugabe von 1Ml PBS-T (PBS + 0,05% Tween-20) zum Pellet und Zentrifuge (450 xg, 5 min, 4 ° C). Den Überstand entfernen.
    3. Füge anti-pH3-Antikörper, verdünnt (1: 500), in 100-200 & mgr; l PBS-T + 3% BSA zu und inkubiere mit einem Kippen für 2 h bei RT (oder O / N bei 4 ° C).
    4. 2 ml PBS-T (PBS + 0,05% Tween-20) zugeben und zentrifugieren (450 xg, 5 min, 4 ° C). Den Überstand entfernen.
    5. Waschen Sie noch einmal durch Zugabe von 2 ml PBS-T zum Pellet, zentrifugieren und verwerfen Sie den Überstand.
    6. Sekundär-Antikörper (Anti-Kaninchen-AlexaFluor 488 im Falle eines ausgewählten pH3-Antikörpers) verdünnt (1: 500) in 100-200 & mgr; l PBS-T + 3% BSA und inkubieren mit Kokern für 1 h bei RT (oder O / N Bei 4 ° C). Schützen Sie die Proben vor Licht.
    7. Waschen Sie zweimal mit PBS-T (2 ml) durch Zentrifugation wie in Schritt 1.5.4 beschrieben.
    8. Führen Sie die PI-Färbung wie beschrieben durch (Schritte 1.4.1 bis 1.4.6).

2. Probenentnahme und -verarbeitung für die Genexpressionsanalyse

  1. Nehmen1,5 mL Mikrozentrifugenproben im RNA-Isolationsreagenz aus dem Gefrierschrank und lassen sie bei RT in einem Sicherheitsschrank für Chemikalien auftauen.
  2. Füge 400 μl Chloroform zu jeder Probe hinzu und schüttele kräftig (aber nicht vortexen) bis zum vollständigen Mischen. Inkubieren Sie die Proben für 5 min bei RT.
  3. Zentrifugenröhrchen für 15 min (≥ 8000 xg, 4 ° C) in einer Tischzentrifuge zentrifugieren.
  4. Übertragen Sie die wässrige (obere) Phase auf ein neues 1,5 mL Mikrozentrifugenröhrchen und registrieren Sie das übertragene Volumen (um das Verfahren zu vereinfachen, empfiehlt es sich, in allen Proben des Experiments gleiche Volumina zu sammeln).
  5. Füge 1 Volumen von 100% Ethanol langsam (tropfenweise) in die wässrige Phase während des Mischens zu. Nicht zentrifugieren
  6. Führen Sie die nächsten Schritte mit dem kommerziellen RNA Mini Prep Kit. Pipetieren Sie bis zu 700 μl jeder Probe, einschließlich aller Niederschläge, die sich gebildet haben können, in eine Spinsäule in einem 2 ml Sammelröhrchen (vom Hersteller bereitgestellt).
  7. SchließeDeckel und Zentrifuge (≥ 8.000 g, RT) für 15 s. Verwerfe den Durchfluss. Wiederholen Sie den vorherigen Schritt mit dem restlichen Sample (falls vorhanden).
  8. Befolgen Sie die Anweisungen der Hersteller für die RNA-Reinigung und Elution (eluieren Sie jede Probe in 30 - 40 μl nukleasefreies H 2 O, um eine geeignete RNA-Konzentration für den nächsten Schritt zu erreichen).
  9. Bestimmen Sie die RNA-Konzentration und die Reinheit der Proben durch Absorptionsmessungen (ein A 260/280 -Verhältnis von 2,0-2,1 zeigt eine gute Reinheit der RNA-Probe an). RNA-Proben bei -80 ° C bis zur Verwendung für RT-qPCR-Analyse aufbewahren.
  10. Für die RNA-Umwandlung in cDNA und nachfolgende quantitative PCR nehmen Sie 1 μg RNA pro Probe und bereiten die Retrotranskriptase-Reaktion gemäß den Anweisungen des Herstellers vor. Erhaltene cDNA-Proben können bei 4 ° C (für ein paar Tage) oder bei -20 ° C (für längere Zeit) gelagert werden.
    HINWEIS: Probenvorbereitung, Grundierung und andere Überlegungen für Echtzeit-PCR sind exSpannend in der Literatur 22 , 23 beschrieben.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Schematische Darstellung von Thy-Noc- und HU-basierten Protokollen zur Zellsynchronisation.

Abbildung 1 fasst die Schritte zusammen, die für die U2OS-Zellsynchronisation und die anschließende Probensammlung erforderlich sind, um die Progression durch den Zellzyklus zu überprüfen und Genexpressionsanalysen durchzuführen.

Phospho-H3 und PI-Färbung sind gute Auswerteparameter zur Auswahl von Synchronisationsmethoden.

Zell-Synchronisationsverfahren müssen für jede Zelllinie aufgrund der inhärenten Heterogenität von kultivierten Zellen beurteilt und optimiert werden. Die Synchronisation bei der Mitose wird typischerweise mit dem Thy-Noc-Protokoll erreicht und die Anreicherung von mitotischen Zellen nach der Behandlung mit Nocodazol kann mit Antikörpern bestimmt werden, die für phosphoryliertes Histon H3 (pH3) spezifisch sind, ein typischer mitotischer Marker. Ide Ntifizierung von pH3-positiven Zellen ermöglicht die Unterscheidung zwischen mitotischen Zellen und solchen mit einem 4C-DNA-Gehalt, der keine Mitose erfährt (die alle als "G2" -Population durch PI-Färbung angesehen werden). In U2OS-Zellen führte das Thy-Noc-Protokoll zu einer signifikanten Anreicherung einer Population mit 4C-DNA-Gehalt (Abbildung 2A, obere linke Grafik, blaue Population durch PI-Färbung), und der relative Anteil der mitotischen Zellen in dieser Population war routinemäßig rein (ungefähr 91% im Vergleich zu 2% in asynchronen Zellen). Die Freisetzung von Nocodazol führt zu einer synchronisierten Progression von Zellen zur nächsten G1-Phase, wie sie durch die Akkumulation einer Population mit 2C-DNA-Gehalt bestimmt wird (Abbildung 2A , obere rechte Grafik, grüne Population durch PI-Färbung) und das nahezu verschwindende pH3-positives Mitotikum Zellen ( Abbildung 2A , rechts unten). Somit bestätigten die pH3-Färbungsergebnisse die Eignung des Thy-Noc-Protokolls für die mitotische Synchronisation von U2OS-Zellen.

Der Synchronisation von U2OS-Zellen in G1 / S wurde mit Thymidin und Hydroxyharnstoff, zwei weit verbreiteten Synchronisatoren, getestet. Die Anreicherung in verschiedenen Phasen des Zellzyklus wurde durch PI-Färbung bestimmt FACS-Analyse und Prozentsatz der in einer Tabelle zusammengefassten Zellen (Abbildung 2B ) Eine 24-stündige Exposition von U2OS-Zellen gegenüber Thy (2mM) war bei der Arretierung von Zellen in der G1 / S-Grenze ineffizient (Abbildung 2B ), während die Behandlung mit HU oder mit einem Doppelten Runde von Thymidin (DT) führte zu einer befriedigenden Verhaftung, aber nur HU-behandelten Zellen erholten sich vollständig von der Arrest und gingen adäquat durch den Zellzyklus fort. Im Gegensatz dazu induzierte DT-Block eine permanente G1-Arrest in einem signifikanten Anteil der Zellpopulation ( 13,3% der Zellen in G1 zu 6 h Zeitpunkt mit DT gegenüber 3,1% mit HU-basiertem Protokoll), die die Zellsynchronität negativ beeinflusst haben, so dass die Exposition gegenüber HU als geeignetes G1 / S-Synchronisationsverfahren empfohlen wirdOd für U2OS-Zellen.

Thy-Noc- und HU-basierte Protokolle sind komplementär für die Zellsynchronisation.

Wie in Abbildung 3A (0 h-Zeitpunkt) gezeigt, verhaftete die Behandlung durch Thy-Noc-Protokoll effizient U2OS-Zellen im M-Phasen-Eintrag (Population mit 4C-DNA-Gehalt, blau dargestellt) und Behandlung durch HU-Protokoll verhaftete Zellen in G1 / S-Grenze (Population mit 2C DNA Inhalt, in grün / rot gezeigt). Nach dem Entfernen der Medikamente traten die Zellen in den Zellzyklus ein und gingen so synchron durch. Zellen, die aus der Thy-Noc-Behandlung gewonnen wurden, wurden zuerst in der frühen G1-Phase (Population in Grün) beobachtet und anschließend durch G1 und bis zur S-Phase gleichmäßig überführt. Zellen, die aus der HU-Behandlung gewonnen wurden, wurden synchron durch S (Population in Rot) und G2 / M fortgesetzt. Die Progression durch den nächsten Zellzyklus begleitete den Verlust der Synchronizität. KonsequentY, Zeitpunkte über 15 Stunden wurden nicht in diese Analysen wegen des Verlustes der Synchronizität nach diesem Zeitpunkt aufgenommen.

Western-Blot-Analyse von Cyclin E1 (ein G1 / S-Cyclin) und Cyclin B1 (ein G2 / M-Cyclin), zwei Proteine, deren Niveaus im Zellzyklus genau reguliert sind, und des mitotischen Markers pH3, bestätigten die Zellzyklusphase von jedem Zeitpunkt, der von FACS analysiert wurde ( Abbildung 3B ). Wie erwartet, zeigten Zellen in M-Phase (entsprechend 0 h-Zeitpunkt von Thy-Noc-synchronisierten Zellen) und Zellen in G2 bis M-Phase (9 h bis 12 h Zeitpunkt von HU-synchronisierten Zellen) eine dramatische Akkumulation von Cyclin B1 Und nicht nachweisbare Konzentrationen von Cyclin E1. Darüber hinaus waren die Cyclin-B1-Spiegel in der G1-Phase (3 h bei Freisetzung aus Nocodazol) niedrig und es wurde eine allmähliche Akkumulation beobachtet, da die Zellen durch S (nach Thy-Noc-Freisetzung) und in G2 (nach HU-Freisetzung) fortschritten wurden. Starke pH3-Markierung von Zellen bei 0 h nach Thy-Noc-SynchronisationBei der Bestätigung der Anreicherung von Zellen bei der Mitose zu diesem Zeitpunkt verhaftet. Eine leichte Zunahme auf pH3-Spiegel bei 12 h nach Freisetzung von HU ergab, dass die Mehrheit der Zellen mit 4C-DNA-Gehalt noch in G2 war, während der Anteil der Zellen bei der Mitose um 15 h-Zeitpunkt erhöht wurde. Im Gegensatz dazu zeigte das Expressionsmuster von Cyclin E1 eine progressive Akkumulation vom frühen G1 bis zum S-Phaseneingang (Thy-Noc-Verfahren) und allmähliches Verschwinden in der G2 / M-Phase (HU-Verfahren).

Die Expression von Genen, die im Zellzyklus unterschiedlich reguliert werden, kann mit einer Kombination von Thy-Noc- und HU-basierter Synchronisation genau analysiert werden.

Als Proof-of-Concept, dass die zellzyklusregulierte Genexpressionsanalyse am besten durch eine Kombination von zwei Zellsynchronisationsverfahren untersucht wird, ist die mRNA-Expression von zwei E2F-Familienmitgliedern, die bekanntermaßen eine unterschiedliche Expressionskinetik im Zellzyklus aufweisen(E2F1 und E2F7) wurden durch reverse Transkriptase quantitative PCR (RT-qPCR) untersucht. Zu diesem Zweck wurden Thy-Noc- und HU-Synchronisationsprotokolle verwendet, wie in Fig. 1 zusammengefasst, und die Zellzyklusverteilung wurde durch Durchflußzytometrie überwacht, wie in Fig. 3A gezeigt . Abbildung 4 zeigt E2F1 (obere zwei Graphen) und E2F7 (untere zwei Graphen) mRNA-Profile durch den Zellzyklus. Das Transkriptionsregulationsprofil des E2F1-kodierenden Gens wurde am besten mit dem Thy-Noc-Verfahren beobachtet, wobei die E2F1-Expression allmählich von der frühen G1-Phase an zunahm, um einen Peak in der späten G1-Phase zu erreichen (9 h nach Thy-Noc-Freisetzung, grüner Hintergrund). Sein Niveau sank danach, begleitet mit einem Einstieg in S und G2 Phasen (rote und blaue Hintergründe). Im Gegensatz dazu wurde die E2F7-Genexpressionskinetik am besten nach der HU-basierten Synchronisation (unterer Graph, roter Hintergrund) mit einem Peak-Expression bei 6 h aus der Freisetzung (entsprechend dem S-zu-G2-Phasenübergang) nachgewiesen. Thy-NocVerfahren war andererseits geeignet, die Induktion von E2F7 zu beobachten, aber nicht seine Abwärtsregulation. Bemerkenswert ist die Erweiterung der Analyse über 15 h Zeitpunkt wiedergegebene E2F1- und E2F7-mRNA-Expressionsprofile früherer Zeitpunkte, allerdings mit einem verminderten Bereich der mRNA-Variation (Daten nicht gezeigt). Insgesamt bestätigen diese Ergebnisse, wie wichtig es ist, mit einer richtig synchronisierten Zellpopulation zu arbeiten, um nicht nur die Genexpressionskinetik zu beurteilen, sondern auch die genaue Amplitude der Veränderungen der mRNA-Spiegel.

Die Zellsynchronisation bietet ein besseres Verständnis des Genexpressionsprogramms, das durch eine Antikrebstherapie beeinflusst wird.

Um die Wirkung des Antitumor-Arzneimittels Mitomycin C (MMC) sowohl in der Zellzyklusdynamik als auch in der Genexpression zu analysieren, wurden U2OS-Zellen zunächst mit HU synchronisiert und anschließend mit MMC behandelt. Die Exposition gegenüber diesem genotoxischen Wirkstoff aktiviert einen CheckpoinT in der G2-Phase, die nach 15 h Exposition deutlich wurde ( Abbildung 5A , untere Reihe, blauer Peak). Im Gegensatz dazu gingen unbehandelte Zellen zu diesem Zeitpunkt normal durch G1 vor ( Fig. 5A , obere Reihe, grüner Peak). Langzeit-MMC-Behandlung (36 h) zeigte eine permanente Verhaftung von Zellen in der G2-Phase, während Zellen ohne MMC-Behandlung eine Zellzyklusverteilung zeigten, die ähnlich war wie die, die durch die asynchrone Zellpopulation gezeigt wurde.

E2F1 und p21 Cip1 (CDKN1A) wurden für die Genexpressionsanalyse in MMC-behandelten Zellen ausgewählt (Abbildung 5B ), da ihre unterschiedliche zellzyklusabhängige Regulation vorliegt. Die Expression von E2F1 ist g1 phasenabhängig, wie in Fig. 4 beschrieben, während die Induktion von p21- Cip1- Expression an die Zellzyklus-Arrest / Checkpoint-Aktivierung 24 gekoppelt ist. Wie in 5B gezeigt (oberer linker Graph), ist die E2F1-Genexpression kiNetics waren in der Gegenwart oder Abwesenheit von MMC ähnlich, da die Zellen durch G1 / S und in die S-Phase fortschritten. Unterschiede in der E2F1-Genexpression unter MMC-behandelten und unbehandelten Zellen wurden nach 15 h Exposition gegenüber MMC beobachtet, wobei MMC-behandelte Zellen niedrigere E2F1-mRNA-Spiegel als Kontrollzellen exprimierten (Abbildung 5B , Vergleiche feste und gestrichelte Linien). Trotz des deutlichen Unterschieds in der Expression kann nicht gefolgert werden, dass MMC die E2F1-Expression reguliert, da Zellzyklusprofile von MMC-behandelten und unbehandelten Zellen in diesen späteren Zeitpunkten deutlich unterschiedlich sind, und zwar aufgrund einer anhaltenden G2-Phasenstörung, die von MMC auferlegt wird. Tatsächlich spiegeln niedrige E2F1-mRNA-Spiegel nach dem 15-stündigen Zeitpunkt in MMC-exponierten Zellen wahrscheinlich eine Wirkung des Arzneimittels in der Zellzyklusdynamik und nicht auf eine Wirkung von MMC in der E2F1-Transkriptionsregulation.

Im Gegensatz zu E2F1 ist p21 Cip1 ein MMC-responsives Gen. Erhöhte Stufen von p21 Cip1 wurden bei HU-auferlegten G1 / S-Arrest erkannt, was die G1-Checkpoint-Aktivierung durch HU anzeigt (Abbildung 5B , 0 h-Zeitpunkt) und deren Expression danach in nicht MMC-behandelten Zellen verringert wurde, im Einklang mit einer ungestörten Zellzyklus-Progression nach der Freisetzung von verhaften. Im Gegensatz dazu führte die MMC-Behandlung zu erhöhten p21- Cip1- mRNA-Niveaus (Abbildung 5B , obere rechte Grafik, durchgezogene Linie), während sich die Zellen in der G2-Phase (9 h MMC-Exposition) anreichten. Trotz der Tatsache, dass Zellzyklusprofile am 9-stündigen Zeitpunkt der Kontroll- und MMC-behandelten Zellen ähnlich waren, zeigt die Genexpressionsanalyse einen grundsätzlichen Unterschied. MMC-exponierte Zellen zeigten einen aktivierten G2-Kontrollpunkt, der durch die Induktion der p21- Cip1- Expression nachgewiesen wurde, während unbehandelte Zellen einen ungestörten Übergang durch G2 mit niedrigen p21- Cip1- Konzentrationen durchlaufen.

Daten, die durch Durchflusszytometrieanalyse erhalten wurden ( FiGure 5A) und Daten, die aus RT-qPCR (Abbildung 5B , obere Graphen) resultierten, wurden in einem einzigen Graphen für jedes der ausgewählten Gene kombiniert (Abbildung 4B, niedrigere Graphen). MRNA-Expressionsniveaus, die als relative Höhe der Stäbe gezeigt wurden, während die Zellzyklusverteilung der Zellen für jede Probe mit dem Farbanteil dargestellt wurde: Grün für die G1-Phase (2C-DNA-Gehalt), Blau für die G2-Phase (4C-DNA-Gehalt) und Rot Für S-Phase (Zwischen-DNA-Gehalt). Diese kombinierte Methode der grafischen Darstellung kann für die Interpretation von Zellzyklusverteilung und Genexpressionsanalysen hilfreich sein.

Zusammenfassend erlaubte die mit einem Kultursynchronisationsverfahren gekoppelte Genexpressionsanalyse die Identifizierung eines auf Genotoxic-Agenten ansprechenden Gens (p21 Cip1 ) und führte dazu, dass Veränderungen, die bei der E2F1-Expression zwischen den mit dem Mittel behandelten und unbehandelten Zellen beobachtet wurden, indirekt waren undMöglicherweise im Zusammenhang mit Unterschieden in der Zellzyklusverteilung von Zellen.

Abbildung 1
Abbildung 1: Überblick über zwei komplementäre Zellsynchronisationsprotokolle: Thymidin-Nocodazol und Hydroxyharnstoff. ( A ) Grafische Darstellung des Säugetierzellzyklus, der die Punkte angibt, an denen der Zellzyklusarrest durch Zellsynchronisationsverfahren erreicht wird. Thy-Noc-basierte Prozedur blockiert Zellen in der frühen Mitose (M), während HU Zellen an der G1 / S-Grenze blockiert. ( B ) Schematische Darstellung des Thy-Noc-Protokolls der Zellsynchronisation. Gezeigt sind die Schritte, die typischerweise für die Genexpressionsanalyse und die Zellzyklusüberwachung in U2OS-Zellen verwendet werden. ( C ) Schematische Darstellung des HU-basierten Protokolls der Zellsynchronisation. Gezeigt sind die Schritte, die typischerweise für die Genexpressionsanalyse und die Zellzyklusüberwachung in U verwendet werden2OS-Zellen Eine kürzere Synchronisationsprozedur, bei der der Serumverarmung unterbrochen wird, kann auch angewendet werden, wenn eine optimale Synchronisation bereits durch eine 24-h-Exposition gegenüber HU erreicht wird. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2: Bewertung geeigneter Synchronisationsmethoden. ( A ) Asynchrone und Thy-Noc-synchronisierte U2OS-Zellkulturen wurden einer pH3-Färbung unterworfen, um jeweils den Anteil der mitotischen Zellen zu bestimmen. Die gleichzeitige PI-Färbung ermöglichte die Überwachung des DNA-Gehalts an Zellen. In der asynchronen Population war nur ein minimaler Bruchteil der Zellen mit 4C DNA-Gehalt (in blau) positiv für den Mitose-Marker. Im Gegensatz dazu, Thy-Noc-Protokoll effizient accu(Positiv für die pH3-Färbung) und erlaubte die richtige Fortschreitung der nächsten G1-Phase (in grün) bei Entfernung von Nocodazol (3 h-Zeitpunkt). Der Prozentsatz der Zellen in jeder Phase ist in der Tabelle zusammengefasst und mit den Farben markiert, je nachdem, wie sie in den PI-Histogrammen verwendet wurden: Grün für 2C-DNA-Inhaltszellen (G1), blau für Zellen mit 4C-DNA-Gehalt (einschließlich G2- und M-Zellen und benannt als G2 in den Histogrammen, um die Figur zu vereinfachen, und rot für Zellen mit Zwischen-DNA-Gehalt (S). ( B ) Thymidin und HU wurden für ihre Zellzyklus-Synchronisationseffizienz in U2OS-Zellen beurteilt. Die Zellen wurden mit Thymidin (ein oder zwei) behandelt Runden) oder mit HU für 24 h und Zellsynchronisation wurde durch PI-Färbung und FACS-Analyse untersucht. Gipfel wurde für die FACS-Datenanalyse verwendet. Klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 3
Abbildung 3: Umrisse des zeitlichen Rahmens für die gleichmäßige Progression von Zellen nach Thy-Noc- und HU-vermittelter Synchronisation. ( A ) U2OS-Zellen wurden in M-Phase durch Thy-Noc-Protokoll (obere Zeile) oder im G1 / S-Übergang durch HU-Protokoll (untere Zeile) synchronisiert. Die Zellzyklusprogression wurde durch PI-Färbung und FACS-Analyse des DNA-Gehalts an Zellen alle 3 h nach der Freisetzung von Chemikalien überwacht. Summit wurde für die FACS-Datenanalyse verwendet. Zellen, die von der Thy-Noc-vermittelten Verhaftung freigesetzt wurden, traten in der frühen G1-Phase nach 3 h synchron ein und gingen gleichmäßig bis zur S-Phase zu den nachfolgenden Zeitpunkten fort. Zellen, die von der HU-vermittelten Verhaftung freigesetzt wurden, wurden synchron durch S- und G2-Phasen umgewandelt. Zellen gesammelt 15 h nach der Freigabe stellte die Grenzen für die Zellsynchronisation dar, da die Progression zur nächsten Phase nur erreicht wurdeD von einem Bruchteil der Bevölkerung. ( B ) Die Zellsynchronisation wurde durch Western-Blot-Analyse durch Sammeln von Proteinproben alle 3 h und bis zu 15 h nach der Freisetzung überwacht. Expressionskinetik von Cyclin E1 (CCNE1), einem Cyclin, der überwiegend durch die S-Phase akkumuliert wurde, Cyclin B1 (CCNB1), hauptsächlich bestehend aus G2 bis M-Phase und pH3, ein Marker für mitotische Zellen, bestätigte Zellzyklusverteilungsprofile, die durch Durchflusszytometrie beobachtet wurden. Actin B (ACTB) wurde als endogene Laststeuerung verwendet, weil seine Niveaus nicht zellzyklusabhängig sind. (Wie von Mitxelena et al . 8 modifiziert). Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4: Studie der Zellzyklusphasenabhängigkeit T Transkription von E2F-Familienmitgliedern durch komplementäre Zellsynchronisationsmethoden. U2OS-Zellen wurden in G2 / M durch Thy-Noc-Protokoll oder in G1 / S durch HU-Behandlung verhaftet, und Proben wurden für die RNA-Extraktion und FACS-Analyse alle 3 h bis zu 15 h nach Freisetzung aus der Verhaftung gesammelt. Die Genexpressionsanalyse durch RT-qPCR zeigte ein E2F1-Expressionsprofil, das hauptsächlich zu G1 (oberer linker Graph) umschrieben wurde, während das E2F7-Genexpressionsprofil in die S-Phase verschoben wurde, mit einer allmählichen Abwärtsregulation durch die G2-Phase (unterer rechter Graph). TBP wurde als endogenes nicht-zellzyklusreguliertes Gen verwendet, um relative Veränderungen in den mRNA-Niveaus zu berechnen, und die Ergebnisse wurden als Mittelwerte und Standardabweichung (SD) dargestellt. Die Progression durch den Zellzyklus wurde durch PI-Färbung und FACS-Analyse des DNA-Gehalts an Zellen bestimmt. Zellzyklusphasen wurden als Hintergrundfarben in Graphen dargestellt: Schwarz (Festnahme bei früher Mitose), Grün (G1-Phase), Rot (S-Phase) und Blau (G2-Phase)..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 5
Abbildung 5: Einfluss der MMC auf die Genexpression und die Zellzyklusprogression. U2OS-Zellen wurden mit HU für 24 h behandelt, und MMC (250 nM) wurde unmittelbar nach der Freisetzung aus HU-vermitteltem G1 / S-Arrest zugegeben. Proben für die FACS-Analyse und die Genexpressionsanalyse wurden zu angegebenen Zeitpunkten gesammelt. ( A ) Die Progression durch den Zellzyklus wurde durch PI-Färbung und FACS-Analyse von DNA-Inhalten durch Summit-Software bestimmt. MMC induzierte eine moderate Verzögerung in der Progression durch S-Phase (rote Population) und eine permanente Verhaftung in G2-Phase (blaue Population), wie durch die Abwesenheit von Zellen in G1 (grüne Population) nach 15 h Behandlung (untere Reihe) verglichen zeigt Zu nicht-Behandelten (oberen) Zellen. ( B ) E2F1 und p21 Die Cip1 -Genexpressionsanalyse in MMC-behandelten oder unbehandelten Zellen wurde auf mRNA-Ebene durch RT-qPCR durchgeführt. Oxa1L wurde als endogenes Nicht-MMC-responsives Gen verwendet und die Ergebnisse wurden als Mittelwerte und SD dargestellt. Obere Graphen repräsentieren relative mRNA-Spiegel von ausgewählten Genen nach Freisetzung von HU und Addition von MMC. Niedrigere Graphen kombinieren Daten, die durch FACS-Analyse und RT-qPCR erhalten werden. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Die Analyse von Feinabstimmungsregulierten Genen, die an transienten und spezifischen Rollen im Zellzyklus beteiligt sind, erfordert eine einheitliche Zellpopulation. Viele Forscher verwenden routinemäßig langjährige Tumorzelllinien für diese Zwecke und es wurden verschiedene Methoden entwickelt, um synchrone (oder teilweise synchrone) Zellpopulationen zu erhalten, mit dem Ziel, möglichst viele Zellen in definierten Zellzyklusphasen zu akkumulieren. Darüber hinaus wurden starke Anstrengungen unternommen, um bewährte Synchronisationsansätze zu verbessern und zu optimieren. Dennoch haben alle Synchronisationsprotokolle Nachteile, die auf die Heterogenität von Zellkulturen zurückzuführen sind, auf eine suboptimale Effizienz der Synchronisationsverfahren oder auf sekundäre Effekte, die chemische Synchronisatoren in der Zellfunktion haben, unter anderem. Diese Einschränkungen müssen bei der Anwendung von Zellsynchronisationsprotokollen berücksichtigt werden. Die Forscher müssen die am besten geeigneten Synchronisationsmethoden für ihre Spezifikationen identifizierenIc Zelltyp oder Experiment. Sogar kultivieren unterschiedliche Zelllinien in genau der gleichen Weise, resultierende Synchronisationsraten können sich aus mehreren Gründen unterscheiden. Einerseits kann die Länge des Zellzyklus in Abhängigkeit von der ausgewählten Zelllinie variieren; Andererseits kann derselbe Inhibitor aufgrund besonderer Eigenschaften jeder Zelllinie 25 kontrastierende Effekte auf verschiedene Zelllinien haben. Weiterhin müssen die ausgewählte Inhibitorkonzentration und die Belichtungszeit immer auf jede Zelllinie eingestellt werden, um eine nicht wünschenswerte Neben-Toxizität zu vermeiden oder zu minimieren 26 . Auch nach der Optimierung all dieser Aspekte wird eine 100% ige Akkumulation von Zellen in einer gegebenen Zellzyklusphase nie erreicht und die Asynchronie erhöht sich nach der Entfernung der Chemikalie allmählich. Daher ist es wichtig zu verstehen, dass die Synchronisationsmethoden in einem bestimmten Zeitrahmen am besten Teilzellpopulationsanreicherungen erhalten.

In diesem w Ork zwei Synchronisationsverfahren (Thy-Noc und HU) wurden für ihre Verwendung in U2OS-Zellen optimiert, die beide weitgehend für die Zellsynchronisations-Assays 28 , 29 , 30 verwendet werden. Zur Arretierung von Zellen in der M-Phase funktionierte eine Kombination von Thymidin und Nocodazol effizient in U2OS-Zellen. Angesichts der zytotoxischen Natur von Nocodazol war es wichtig, die Expositionszeit und die Dosis dieses Inhibitors zu bestimmen, um nicht nur eine hoch synchronisierte Zellpopulation, sondern auch ein optimales Zellüberleben zu erhalten. Eine vorherige Exposition gegenüber Thymidin (oder theoretisch jede andere ähnliche Verbindung wie Hydroxyharnstoff) führte zu einer Anreicherung der Zellpopulation in G1- und S-Phasen, wodurch die erforderliche Nocodazol-Expositionszeit verringert wurde. Für die Arretierung von Zellen in G1 / S wurden mehrere Möglichkeiten betrachtet, einschließlich Doppel-Thymidin-Block, ein Verfahren, das bei der Synchronisation von mehreren Zelllinien sehr effizient ist"> 31 , 32. Allerdings wurde Thymidin aufgrund seiner enttäuschenden Ergebnisse in U2OS verworfen. Eine Runde Thymidinbehandlung verhaftete nur einen Bruchteil von Zellen, während zwei Runden der Thymidinbehandlung die Mehrheit der Zellen in G1 / S, aber ein G1 effizient blockierten Die Population wurde nach der Freisetzung von Thymidin beibehalten, und die Zellzyklusprogression verlief nicht gleichmäßig. Im Gegensatz dazu lieferte die Hydroxyharnstoffbehandlung gute G1 / S-Blockierungsergebnisse und ein gleichmäßiges Fortschreiten der Zellen durch S und in G2.

Die Zellzyklusphasenverteilung sollte bei der Durchführung von Zellsynchronisationsexperimenten ( z. B. durch Propidiumjodidfärbung oder pH3-Markierung, gefolgt von einer FACS-Analyse oder durch Immunoblotting von zellzyklusphasenspezifischen Proteinen) 16 , 33 , 34 untersucht werden, um die Genexpression besser zu interpretieren Ergebnisse. Eine falsche Synchronisation efficieNive oder leichte inter-experimentelle Unterschiede in der Progression durch den Zellzyklus können zu falschen Schlussfolgerungen führen. Zum Beispiel ist bekannt, dass die Nocodazol-Behandlung unter bestimmten Bedingungen einen Ausfall der mitotischen Kontrollpunktfunktion verursacht. Dies führt zu einer Population von Zellen mit 4C-DNA-Gehalt, aber negativ für mitotische Marker 34 , die die mitotische Teilung "rutschen" und mit einem 4C-Inhalt 35 interphasieren. Das Auftreten dieser Teilmenge von Zellen, die durch Immunfärbung mit Anti-Phospho-H3-Antikörpern detektiert werden kann (siehe 2A ), kann durch die Verwendung von kaltem PBS für die Nocodazol-Waschschritte minimiert werden. Ein weiterer Effekt, der mit der Verwendung von chemischen Inhibitoren verbunden ist, die die Zell-Synchronität beeinflussen, ist die Kontrollpunktaktivierung, die mit der Exposition gegenüber diesen Verbindungen 36 , 37 assoziiert ist , einem Mechanismus, durch den die Zelle aktiv den Fortschritt durch den Zellzyklus veranlasst, bis sie es kannDass Prozesse vor diesem genauen Punkt (zB korrekte DNA-Replikation, Spindelmontage) gelöst werden. Damit eine Synchronisationsmethode ausreichend ist, muss die Verhaftung nicht nur effizient, sondern auch vollständig reversibel sein. Somit ist es nach der Freisetzung von Zellzyklusinhibitoren wichtig zu analysieren, ob die Wirkungen des Inhibitors umgesetzt worden sind, beispielsweise durch Analysieren der Expression von Kontrollpunktmarkern wie p21 CIP . 5B zeigt, dass hydroxyharnstoff-synchronisierte U2OS-Zellen den Kontrollpunkt effizient aufgelöst haben, da die p21- CIP- Spiegel nach der Freisetzung auf die basale Expression reduziert wurden.

In U2OS-Zellen fallen die Anreicherungsprozentsätze bei Zellzyklus-Arrest in den Bereich, der von anderen Studien an der Zell-Synchronisation 29 , 30 , 39 berichtet wurde : etwa 85% der Zellen mit 4C-DNA-Gehalt (PI-Färbung) und approxiMindestens 90% derjenigen bei der Mitose (pH3-positive Markierung) bei der Thymidin-Nocodazol-Behandlung und etwa 80-90% der G1 / S-Zellen nach der Hydroxyharnstoffbehandlung. Die Freisetzung aus dem Zellzyklus-Arrest führt typischerweise eine ordnungsgemäße Progression durch die nächste ein oder zwei Phasen in einer einheitlichen Weise, obwohl die Synchronisation nach einigen Stunden unveränderlich verloren geht und die Zellen nicht in der Lage sind, einen ganzen Zellteilungszyklus synchron zu vervollständigen. Um also ein vollständiges Bild aller Phasen des Zellzyklus zu erhalten, nutzt das in dieser Arbeit vorgeschlagene Protokoll zwei Synchronisationsmethoden aus verschiedenen Teilen des Zellzyklus. Wie in Fig. 3A gezeigt , stellte jedes einzelne Protokoll keine Synchronität über einen ganzen Zellzyklus sicher. Die Thy-Noc-basierte Synchronisation lieferte einen geeigneten Rahmen für Prozesse, die in G1 bis S-Phasen auftraten, während Zellen, die von HU freigesetzt wurden, für die Analyse von Ereignissen geeignet waren, die während S und G2 / M stattfanden. Die Komplementaritäten der ausgewählten zwei VerfahrenEs wurde durch die Analyse von zwei Mitgliedern der E2F-Transkriptionsfaktorfamilie (Abbildung 4 ) demonstriert, die die Idee unterstützt, dass die Kombination von zwei Methoden, die in verschiedenen Phasen des Zellzyklus synchronisieren, ein leistungsfähiger Ansatz ist, um eine zellzyklusregulierte Genexpression genau festzulegen Um ihre physiologische Rolle besser zu verstehen.

Eine überzeugende Anwendung von Zellsynchronisationsverfahren konzentriert sich auf die Bewertung der Auswirkungen von potentiellen therapeutischen Mitteln. Die Wirkung von pharmazeutischen Verbindungen, wie solchen mit Antitumor-Aktivität, wird häufig in asynchrone Zellpopulationen untersucht. Unter diesen Einstellungen ist es möglich, die Implikation des ausgewählten Arzneimittels bei der Induktion mehrerer Prozesse wie Zelltod, Zellzyklus-Arrest oder Seneszenz 7 , 40 zu bestimmen. Die Auswahl der asynchronen Zelleneinstellungen zur Identifizierung von präzisen molekularen Ereignissen, die regulierenSolche Prozesse können zu unvollständigen oder teilweise falschen Schlussfolgerungen führen. Dieser Punkt, der oft übersehen wird, wurde in der vorliegenden Arbeit durch die Analyse der Wirkung des chemotherapeutischen Arzneimittels MMC auf die E2F1- und p21- Cip1 -Genexpression (Abbildung 5 ) veranschaulicht. Insgesamt bietet die Kombination von Zellsynchronisation und Behandlung mit genotoxischen Mitteln einen geeigneten Kontext, in dem die Expression von Genen, die auf das genotoxische Mittel ansprechen, untersucht wird und von denen, die durch Zellzyklus-Störungen, die durch das Mittel auferlegt werden, zu unterscheiden sind.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgments

Wir danken den Mitgliedern der Zubiaga und den Altmeyer Laboratorien für hilfreiche Diskussionen und für technische Unterstützung. Diese Arbeit wurde durch Zuschüsse des spanischen Ministeriums (SAF2015-67562-R, MINECO / FEDER, UE), der Baskischen Regierung (IT634-13 und KK-2015/89) und der Universität des Baskenlandes UPV / EHU ( UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Das Studium der Zellzyklus-regulierten Genexpression durch zwei komplementäre Zellsynchronisationsprotokolle
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter