mRNA Interactome Capture from Plant Protoplasts

Summary

Here, we present an interactome capture protocol applied to Arabidopsis thaliana leaf mesophyll protoplasts. This method critically relies on in vivo UV crosslinking and allows for the isolation and identification of plant mRNA-binding proteins from a physiological environment.

Abstract

RNA-binding proteins (RBPs) determine the fates of RNAs. They participate in all RNA biogenesis pathways and especially contribute to post-transcriptional gene regulation (PTGR) of messenger RNAs (mRNAs). In the past few years, a number of mRNA-bound proteomes from yeast and mammalian cell lines have been successfully isolated through the use of a novel method called "mRNA interactome capture," which allows for the identification of mRNA-binding proteins (mRBPs) directly from a physiological environment. The method is composed of in vivo ultraviolet (UV) crosslinking, pull-down and purification of messenger ribonucleoprotein complexes (mRNPs) by oligo(dT) beads, and the subsequent identification of the crosslinked proteins by mass spectrometry (MS). Very recently, by applying the same method, several plant mRNA-bound proteomes have been reported simultaneously from different Arabidopsis tissue sources: etiolated seedlings, leaf tissue, leaf mesophyll protoplasts, and cultured root cells. Here, we present the optimized mRNA interactome capture method for Arabidopsis thaliana leaf mesophyll protoplasts, a cell type that serves as a versatile tool for experiments that include various cellular assays. The conditions for optimal protein yield include the amount of starting tissue and the duration of UV irradiation. In the mRNA-bound proteome obtained from a medium-scale experiment (10⁷ cells), RBPs noted to have RNA-binding capacity were found to be overrepresented, and many novel RBPs were identified. The experiment can be scaled up (10⁹ cells), and the optimized method can be applied to other plant cell types and species to broadly isolate, catalog, and compare mRNA-bound proteomes in plants.

Introduction

Eukaryotes use multiple RNA biogenesis regulatory pathways to maintain cellular biological processes. Among the known types of RNA, mRNA is very diverse and carries the coding capacity of proteins and their isoforms¹.The PTGR pathway directs the fates of pre-mRNAs^2,3. RBPs from different gene families control the regulation of RNA, and in PTGR, specific mRBPs guide mRNAs through direct physical interactions, forming functional mRNPs. Therefore, identifying and characterizing mRBPs and their mRNPs is critical to understanding the regulation of cellular mRNA metabolism^2<....

Protocol

1. Arabidopsis Leaf Mesophyll Protoplast Isolation

NOTE: Arabidopsis leaf mesophyll protoplasts are essentially isolated as described by Yoo et al., 2007, with several modifications⁴⁰.

1. Growth of plants
   1. Soak approximately 200 Arabidopsis thaliana Col-0 ecotype seeds in sterilized water for 2 days at 4 °C in darkness for stratification.
      NOTE: This number of seeds is enough for one non-CL sample and one CL sample (see step 1.3).
   2. Prepare pots with a 50% (v/v) mixture of soil and vermiculite and soak the pots with....

Results

We observed a characteristic halo, which surrounds the bead pellet in the CL sample, in wash step 4.3 with wash buffer 2 (Figure 1B). Although it has not been investigated, this phenomenon can probably be explained by the interference of crosslinked mRNP complexes with bead aggregation during the magnetic capture, causing a more diffuse aggregate to form. It indicates that the oligo-d(T)₂₅ bead capture was effective¹⁴.

<.......

Discussion

We successfully applied mRNA interactome capture, developed for yeast and human cells, to plant leaf mesophyll protoplasts. Leaf mesophyll cells are the major type of ground tissue in plant leaves. The major advantage of this method is that it uses in vivo crosslinking to discover the proteins from a physiological environment.

In this protocol, we mainly present a number of optimized experimental conditions (e.g., the number of protoplasts to use as starting material and the .......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
REAGENTS
0.8 M Mannitol	Sigma	M1902-500G	Primary isotonic Enzyme solution & MMg solution
2 M KCl	MERCK	Art. 4935	Primary isotonic Enzyme solution & W5 buffer
0.2 M MES (pH 5.7) (4-morpholineethanesulfonic acid)	Sigma-aldrich	M2933	Primary isotonic Enzyme solution, W5 buffer & MMg solution, Filtration sterilization
Cellulase R10	Yakult Pharmaceutical Industry Co., Ltd.	CELLULASE “ONOZUKA” R-10, 10 g	Final isotonic enzyme solution
Macerozyme R10	Yakult Pharmaceutical Industry Co., Ltd.	MACEROZYME R-10, 10g	Final isotonic enzyme solution
10% (w/v) BSA (Bovine Serum Albumin)	Sigma-aldrich	A7906-100G	Final isotonic enzyme solution & Filtration sterilization
1 M CaCl2	Chem-Lab NV	CL00.0317.1000	Final isotonic enzyme solution, W5 buffer & Digestion buffer
1 M NaCl	Fisher Chemical	S/3160/60	W5 buffer
2 M MgCl2	Sigma	M8266-100G	MMg solution
1 M LiCl (Lithium Chloride)	Acros	199885000	Lysis/binding buffer, Wash buffer 1, Wash buffer 2 & Low salt buffer
5% (w/v) LiDS (Lithium Dodecyl Sulphate)	Sigma-aldrich	L4632-25G	Lysis/binding buffer, Wash buffer 1 & Filtration sterilization
1 M DTT (Dithiothreitol)	Thermo Fisher Scientific Wash buffer 1 & Wash buffer 2	307866	Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl))	Acros & Fisher Chemical	167620010 & H/1200/PB15	Lysis/binding buffer, Wash buffer 1, Wash buffer 2, Low salt buffer & Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid)	Sigma-aldrich	ED-500G	Lysis/binding buffer, Wash buffer 1, Wash buffer 2, Low salt buffer & Elution buffer
Tween 20	MERCK	8.22184.0500	Regeneration of oligo-d(T)25 beads
0.1 M NaOH	VWR PROLABO CHEMICALS	28244.295	Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4) (Phosphate Buffered Saline) containing (NaCl; KCl; Na2HPO4; KH2PO4)	Fisher Chemical, MERCK, Sigma-aldrich & SAFC	S/3160/60, Art. 4935, 71640-250G & 60230	Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL)	Thermo Fisher Scientific	11789020	Protein digestion
Loading dye	Invitrogen	LC5925	SDS-PAGE
qPCR master mix	Promega	A6001	qRT-PCR assay
RNase Cocktail	Thermo Fisher Scientific	AM2286	RNA digestion
Methanol	Sigma-aldrich	322415	Gel fixation and gel destaining
Acetic acid	Sigma-aldrich	537020	Gel fixation and gel destaining
Coomassie Brilliant Blue R-250	Thermo Fisher Scientific	20278	Gel staining
1 M NH4HCO3 (Ammonium bicarbonate)	Sigma-aldrich	09830-500G	Gel hydration & Digestion buffer
CH3CN (Acetonitrile)	Sigma-aldrich	34851-100ML	Gel dehydration & Peptide dissolving solution
IAA (Iodoacetic acid)	Sigma-aldrich	I4386-10G	Alkylating agent
TFA (Trifluoroacetic acid)	Sigma-aldrich	302031-10X1ML	Peptide dissolving solution
FA (Formic acid)	Sigma-aldrich	06554-5G	Peptide extraction
Trypsin solution (6 ng/μL)	Promega	V5280	Digestion buffer
Name	Company	Catalog Number	Comments
EQUIPMENT
Soil	Peltracom	LP2D	Plant growth
Vermiculite 3	Sibli AS	05VERMICULIET	Plant growth
Petri dish (150 x 20 mm)	Sarstedt	82.1184.500	Carrier for protoplast suspension
0.22 μm filter	Millipore	SE2M229104	Homogenization of final isotonic enzyme solution
Razorblade	Agar Scientific	T585	Rosette leaf strips
35-75 μm nylon mesh	SEFAR NITEX	74010	Protoplast suspension filtration
50 mL round bottom tubes	Sigma-aldrich	T1918-10EA	Carrier for protoplast suspension
Hemocytometer (Bürker hemocytometer)	MARIENFELD	650030	Protoplast cell counting
UV crosslinking apparatus (HL-2000 HybriLinker)	UVP, LLC	UVP95003101	in vivo UV crosslinking
UV lamp (Sankyo-Denki G8T5)	SANKYO DENKI	SD G8T5	in vivo UV crosslinking
50 mL glass syringe	FORTUNA Optima	Z314560	Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm)	Becton Dickinson microlance 3	2021-04	Homogenization of protoplast lysate
Rotator Model L26	Labinco BV	26110912	Sample incubation by rotating
Oligo-d(T)25 magnetic beads (5 mg/mL)	New England BioLabs	S1419S	mRNPs and mRNAs binding and pull-down
Magnetic rack	Invitrogen	CS15000	mRNPs and mRNAs binding and pull-down
Centrifugal filter units (Amicon Ultra-4 centrifugal filter units)	EMD Millipore	UFC800308	mRBP concentration
Pierce Silver Stain Kit	Thermo Fisher Scientific	24612	Silver-staining assay
RNA purification kit (InviTrap Spin Plant RNA Mini Kit)	STRATEC Molecular	1064100300	RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer)	Thermo Fisher Scientific	ND-1000	RNA quality and quantity
Real-Time PCR cycler (StepOne Real-Time PCR cycler)	Thermo Fisher Scientific	4376600	cDNA quantification
µ-C18 columns (Millipore Zip Tip µ-C18 columns)	Sigma-aldrich	720046-960EA	Peptide purification
Mass spectrometer (Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)	Thermo Fisher Scientific	IQLAAEGAAPFALGMAZR	Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument)	Thermo Fisher Scientific	ULTIM3000RSLCNANO	Mass spectrometry-based proteomics
C18 column (Easy Spray Pepmap RSLC C18 column)	Thermo Fisher Scientific	ES800	Mass spectrometry-based proteomics
C18 precolumn (Acclaim Pepmap 100 C18 precolumn)	Thermo Fisher Scientific	160321	Mass spectrometry-based proteomics
Name	Company	Catalog Number	Comments
Primers for qRT-PCR assay	Sequences
UBQ10 mRNA (Li et al., 2014)	Fw: AACTTTGGTGGTTTGTGTTTTGG Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA (Durut et al., 2014)	Fw: CGTAGTTGAACCTTGGGATG Rv: CACGACCCGGCCAATTA