Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

Summary

Biomaterials doped with Bone Morphogenetic Protein 2 (BMP2) have been used as a new therapeutic strategy to heal non-union bone fractures. To overcome side effects resulting from an uncontrollable release of the factor, we propose a new strategy to site-directly immobilize the factor, thus creating materials with improved osteogenic capabilities.

Abstract

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present several limitations that have led to the use of biomaterials in combination with osteogenic growth factors, such as bone morphogenetic proteins (BMPs). Commonly used absorption or encapsulation methods require supra-physiological amounts of BMP2, typically resulting in a so-called initial burst release effect that provokes several severe adverse side effects. A possible strategy to overcome these problems would be to covalently couple the protein to the scaffold. Moreover, coupling should be performed in a site-specific manner in order to guarantee a reproducible product outcome. Therefore, we created a BMP2 variant, in which an artificial amino acid (propargyl-L-lysine) was introduced into the mature part of the BMP2 protein by codon usage expansion (BMP2-K3Plk). BMP2-K3Plk was coupled to functionalized beads through copper catalyzed azide-alkyne cycloaddition (CuAAC). The biological activity of the coupled BMP2-K3Plk was proven in vitro and the osteogenic activity of the BMP2-K3Plk-functionalized beads was proven in cell based assays. The functionalized beads in contact with C2C12 cells were able to induce alkaline phosphatase (ALP) expression in locally restricted proximity of the bead. Thus, by this technique, functionalized scaffolds can be produced that can trigger cell differentiation towards an osteogenic lineage. Additionally, lower BMP2 doses are sufficient due to the controlled orientation of site-directed coupled BMP2. With this method, BMPs are always exposed to their receptors on the cell surface in the appropriate orientation, which is not the case if the factors are coupled via non-site-directed coupling techniques. The product outcome is highly controllable and, thus, results in materials with homogeneous properties, improving their applicability for the repair of critical size bone defects.

Introduction

The ultimate goal of bone tissue engineering and bone regeneration is to overcome the disadvantages and limitations occurring during common treatments of non-union fractures. Auto- or allo-transplantations are predominantly used as current therapy strategies, even though they both have several drawbacks. The ideal bone graft should induce osteogenesis by osteoinduction as well as osteoconduction, leading to the osteointegration of the graft into the bone. Nowadays, only auto-transplantation is considered as the "gold standard" since it provides all characteristics of an ideal bone graft. Unfortunately, it also presents important negative aspects, such as long ....

Protocol

1. Production of the BMP2 Variant BMP2-K3Plk

1. Cloning of BMP2-K3Plk by site-directed mutagenesis using PCR¹²
   1. Amplify human mature BMP2 (hmBMP2) from a p25N-hmBMP2 vector (see Table of Materials) with a forward primer (5' GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3') and a reverse primer (5' CCAGGAGGATCCTTAGCGACACCCACAACCCT 3') introducing an amber stop codon (TAG) at the position of the first lysine of BMP2´s mature part. Perform the PCR reaction using 33.5 µL of H₂O, 10 µL of PCR reaction mix, 1.5 µL of 10 µM dNTP stock solution, 1.5 µL....

Results

In this article, we describe a method to covalently couple a new BMP2 variant, BMP2-K3Plk, to commercially available azide functionalized agarose beads (Figure 1). The bioactivity of the produced BMP2-K3Plk variant was validated by the induction of alkaline phosphatase (ALP) gene expression in C2C12 cells. The in vitro test shows similar ALP expression levels induced by wild type BMP2 (BMP2-WT) and BMP2-K3Plk (Figure 2)........

Discussion

Generating tagged protein variants by genetic codon expansion allows the introduction of various non-natural amino acid analogs principally at any position of the primary protein sequence. In case of BMPs like BMP2, common tags such as a 6-Histidine (His) tag can only be introduced N-terminally, since the protein´s C-terminal end is buried within the tertiary protein structure, and is thus not accessible from the outside. At other positions, the size of the introduced tag may very likely cause structural alterations.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Material
1-Step NBT/BCIP	Thermo Fisher	34042	Add solution to cells
3-Azido-7-hydroxycoumarin	BaseClick	BCFA-047-1	Chemical used for click reaction
Agarose low melting point	Biozym	840101	Agarose for ALP assay
Azide agarose beads	Jena Bioscience	CLK-1038-2	Beads used for reaction
BamHI (Fast Digest enzyme)	Thermo Fisher Scientific	FD0054	Restriction enzyme
BMP receptor IA (BMPR-IAEC)	--	--	Produced in our lab
Coomassie Brilliant Blue G-250 Dye	Thermo Fisher Scientific	20279	Chemical used for Coomassie Brilliant blue staining of SDS PAGE
Copper (II) sulfate anhydrous (CuSO4)	Alfa Aesar	A13986	Chemical used for click reaction
DNA Polymerase and reaction buffer	Kapabiosystems	KK2102	KAPA HiFi PCR Kit
Dulbecco’s modified Eagle’s medium (DMEM) GlutaMAX	Gibco	61965-026	Cell culture media
ethylenediaminetetraacetic acid (EDTA)	Sigma Aldrich GmbH	E5134-1kg	Chemical used to stop click reaction
Isopropyl ß-D-1-thiogalactopyranoside (IPTG)	Carl Roth GmbH	2316.5	Bacteria induction (1mM final concentration)
NdeI (Fast Digest enzyme)	Thermo Fisher Scientific	ER0581	Restriction enzyme
NHS-activated Texas Red	Life technologies	T6134	Coupled to receptor
P- Nitrophenyl Phosphate	Sigma Aldrich GmbH	N4645-1G	Alkaline Phosphatase
p25N-hmBMP2	--	--	Plasmid kindly provided from Walter Sebald to J. Nickel
pET11a-pyrtRNA	--	--	Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
propargyl-L-lysine (Plk)	--	--	Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
pSRFduet-pyrtRNAsynth	--	--	Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
Qiagen Gel Extraction Kit	Qiagen	28704	Gel Purification
Qiagen PCR purification Kit	Qiagen	28104	PCR Purification
Sodium L-ascorbate	Sigma Aldrich GmbH	A7631-100G	Chemical used for click reaction
T4 DNA Ligase	ThermoScientific	EL0011	Ligation
tris(3-hydroxypropyltriazolylmethyl)amine (THPTA)	BaseClick	BCMI-006-100	Chemical used for click reaction
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol	Sigma Aldrich GmbH	X100-1L	Triton X 100
Name	Company	Catalog Number	Comments
Equipment
Amicon concentrating cell 400 ml	Merck KGaA	UFSC40001	Concentrating unit
Amicon Ultra-15 Centrifugal Filter Units	Merck KGaA	UFC901024	Concentrating centrifugal unit
ÄKTA avant FPLC	ÄKTA	--	FPLC machine
Avanti J-26XP	Beckman Coulter	393124	Centrifuge for bacterial culture
Bacterial Shaking Incubator	Infors HT		Shaking incubator for bacterial culture
FluorChem Q system	proteinsimple	--	Imaging and analysis system for SDS-PAGE
Fluorescent miscroscope	Keyence	BZ-9000 (BIOREVO)
Fractogel® EMD SO3- (M)	Merck KGaA	116882	Ion Exchange Chromatography column material
Greiner CELLSTAR® 96 well plates	Sigma	M5811-40EA	96 well plates for cell culture (ALP Assay)
Heraeus Multifuge X1R	ThermoScientific	--	Centrifuge
M-20 Microplate Swinging Bucket Rotor	ThermoScientific	75003624	Rotor for Microcentrifuge for plate during ALP staining
Microcentrifuge - 5417R	Eppendorf	--	Centrifuge
OriginPro 9.1 G	OriginLab	--	software for stastic analysis of ALP assay data
Polysine Slides	ThermoScientific	10143265	microscope slides
Rotor JA-10	Beckman Coulter	--	rotor for Avanti J-26XP centrifuge
Rotor JLA 8.1	Beckman Coulter	--	rotor for Avanti J-26XP centrifuge
Rotor JA 25.50	Beckman Coulter	--	rotor for Avanti J-26XP centrifuge
Tecan infinite M200 multiplate reader	Tecan Deutschland GmbH	--	Multiplate reader for ALP assay
Thermocycler - Labcycler Gradient	SensoQuest GmbH	--	PCR
TxRed - microscope filter	Keyence		Filter for fluorescent microscope
Ultrafiltration regenerated cellulose discs 3 kDa	Merck KGaA	PLBC04310	used with amicon concentrating cell 400ml
Ultrafiltration regenerated cellulose discs 10 kDa	Merck KGaA	PLGC04310	used with amicon concentrating cell 400ml