Method Article

Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

7.2K views

DOI:

10.3791/56616

March 29th, 2018

In This Article

Summary

Biomaterials doped with Bone Morphogenetic Protein 2 (BMP2) have been used as a new therapeutic strategy to heal non-union bone fractures. To overcome side effects resulting from an uncontrollable release of the factor, we propose a new strategy to site-directly immobilize the factor, thus creating materials with improved osteogenic capabilities.

Abstract

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present several limitations that have led to the use of biomaterials in combination with osteogenic growth factors, such as bone morphogenetic proteins (BMPs). Commonly used absorption or encapsulation methods require supra-physiological amounts of BMP2, typically resulting in a so-called initial burst release effect that provokes several severe adverse side effects. A possible strategy to overcome these problems would be to covalently couple the protein to the scaffold. Moreover, coupling should be performed in a site-specific manner in order to guarantee a reproducible product outcome. Therefore, we created a BMP2 variant, in which an artificial amino acid (propargyl-L-lysine) was introduced into the mature part of the BMP2 protein by codon usage expansion (BMP2-K3Plk). BMP2-K3Plk was coupled to functionalized beads through copper catalyzed azide-alkyne cycloaddition (CuAAC). The biological activity of the coupled BMP2-K3Plk was proven in vitro and the osteogenic activity of the BMP2-K3Plk-functionalized beads was proven in cell based assays. The functionalized beads in contact with C2C12 cells were able to induce alkaline phosphatase (ALP) expression in locally restricted proximity of the bead. Thus, by this technique, functionalized scaffolds can be produced that can trigger cell differentiation towards an osteogenic lineage. Additionally, lower BMP2 doses are sufficient due to the controlled orientation of site-directed coupled BMP2. With this method, BMPs are always exposed to their receptors on the cell surface in the appropriate orientation, which is not the case if the factors are coupled via non-site-directed coupling techniques. The product outcome is highly controllable and, thus, results in materials with homogeneous properties, improving their applicability for the repair of critical size bone defects.

Introduction

The ultimate goal of bone tissue engineering and bone regeneration is to overcome the disadvantages and limitations occurring during common treatments of non-union fractures. Auto- or allo-transplantations are predominantly used as current therapy strategies, even though they both have several drawbacks. The ideal bone graft should induce osteogenesis by osteoinduction as well as osteoconduction, leading to the osteointegration of the graft into the bone. Nowadays, only auto-transplantation is considered as the "gold standard" since it provides all characteristics of an ideal bone graft. Unfortunately, it also presents important negative aspects, such as long surgery times, and a second trauma site that usually entails more complications (e.g., chronic pain, hematoma formations, infections, cosmetic defects, etc.). Allogenic grafts, on the other hand have suboptimal characteristics for all general aspects1. Alternative bone graft technologies have been improved in the last few years, with the aim to produce scaffolds that are osteoinductive, osteoconductive, biocompatible, and bioresorbable. Since many biomaterials do not show all of these osteogenic characteristics, different growth factors, mainly BMP2 and BMP7, have been incorporated in order to improve the osteogenic potential of the particular scaffold2.

As an essential criterion, such growth factor delivery systems should provide a controlled dose release over time in order to facilitate the essential events like cell recruitment and attachment, cell ingrowth, and angiogenesis. However, BMPs as well as other osteogenic growth factors have been commonly immobilized non-covalently3. Entrapment and adsorption techniques require the use of supra-physiological amounts of protein due to an initial burst release, which leads to severe disadvantages in vivo, typically affecting the surrounding tissues by inducing bone overgrowth, osteolysis, swelling, and inflammation4. Thus, the retention of growth factors at the delivery site for longer periods of time can be achieved by covalent immobilization methods. Chemically modified BMP2 (succinylated5, acetylated6 or biotinylated7), engineered heterodimers8, or BMP2 derived oligopeptides9 have been designed and used to overcome the limitations related to absorption. However, the bio-activity of these constructs is not predictable since the arrangement potentially inhibits the binding of the immobilized ligand to the cellular receptors. As previously shown, it is essential that all four receptor chains involved in the formation of activated ligand-receptor complexes interact with the immobilized BMP2 in order to fully activate all downstream signaling cascades10.

To overcome the problems of an inhomogeneous product outcome with limitations in terms of bioactivity, stability, and bioavailability of the immobilized factor, we designed a BMP variant capable of covalently binding scaffolds in a site-directed manner. This variant, termed BMP2-K3Plk, comprises an artificial amino acid which was introduced by genetic codon expansion11. This variant has been successfully linked to scaffolds using a covalent coupling strategy while maintaining its biological activity.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Production of the BMP2 Variant BMP2-K3Plk

  1. Cloning of BMP2-K3Plk by site-directed mutagenesis using PCR12
    1. Amplify human mature BMP2 (hmBMP2) from a p25N-hmBMP2 vector (see Table of Materials) with a forward primer (5' GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3') and a reverse primer (5' CCAGGAGGATCCTTAGCGACACCCACAACCCT 3') introducing an amber stop codon (TAG) at the position of the first lysine of BMP2´s mature part. Perform the PCR reaction using 33.5 µL of H2O, 10 µL of PCR reaction mix, 1.5 µL of 10 µM dNTP stock solution, 1.5 µL of forward primer (10 pmol/µL), 1.5 µL of reverse primer (10 pmol/µL), 1 µL of p25N-hmBMP2 (10 ng/µL), and 1 µL of DNA polymerase (see Table of Materials) in a thermal cycler (denaturation at 95 °C for 5 min, 30 cycles of denaturation at 95 °C for 1 min, annealing at 60 °C for 1 min, elongation at 72 °C for 1 min, and a final extension at 72 °C for 10 min).
    2. Purify the PCR product using a commercially available kit following manufacturer recommendations (see Table of Materials).
    3. Digest the PCR product with the restriction enzyme NdeI at 37 °C for 45 min using 16 µL of H2O, 3 µL of digestion buffer, 10 µL of DNA (20 ng/µL), and 1 µL of restriction enzyme. Heat-inactivate the enzyme at 65 °C for 5 min. Digest the PCR product with the restriction enzyme BamHI at 37 °C for 1 h using 16 µL of H2O, 3 µL of digestion buffer, 10 µL of DNA (20 ng/µL), and 1 µL of restriction enzyme. Heat-inactivate enzyme at 80 °C for 5 min.
    4. Digest the pET11a-pyrtRNA vector with NdeI at 37 °C for 2 h and 45 min using 16 µL of H2O, 3 µL of digestion buffer, 10 µL of DNA (20 ng/ µL), and 1 µL of restriction enzyme. Heat-inactivate at 65 °C for 5 min. Digest the pET11a-pyrtRNA vector with BamHI at 37 °C for 1 h using 16 µL of H2O, 3 µL of digestion buffer, 10 µL of DNA (20 ng/µL), and 1 µL of restriction enzyme. Heat-inactivate at 80 °C for 5 min.
    5. Separate the digested vector from undigested vector and digestion remnants by agarose gel electrophoresis (0.8% agarose, 60 min at 100 V). Ligate the digested BMP2-K3TAG insert with digested pET11a-pyrtRNA backbone at room temperature (RT) for 2 h using 100 ng of pET11a-pyrtRNA backbone and 34.5 ng of BMP2-K3TAG insert (1:3 molar ratio). The reaction mixture contains the DNA backbone and insert, 2 µL of ligase buffer, 1 µL of DNA ligase, and H2O to a total volume of 20 µL.
    6. Perform a co-transformation of pET11a-pyrtRNA-BMP2-K3Plk and pSRF-duet-pyrtRNAsynth in BL21(DE3) bacteria:
      1. Add 50 ng of each plasmid to the bacteria, place the mixture on ice for 30 min, heat shock at 42 °C for 50 s, place on ice for 5 min, add 500 µL of Lysogeny Broth (LB) medium in the mixture, and shake at 300 rpm for 60 min.
      2. Spread 100 µL of the bacterial mixture onto pre-warmed kanamycin (50 µg/mL)/ampicillin (100 µg/mL) plates, and incubate overnight at 37 °C.
  2. Expression and Purification of BMP2-K3Plk13,14
    1. Propagate a single colony overnight in 50 mL of LB medium with 50 µg/mL of kanamycin and 100 µg/mL of ampicillin at 37 °C.
    2. Dilute overnight cultures 1:20 into 800 mL of Terrific Broth (TB) medium supplemented with 50 µg/mL of kanamycin and 100 µg/mL of ampicillin, and grow at 37 °C until an OD600 of 0.7 is reached. Add propargyl-L-lysine to a final concentration of 10 mM. Collect a 100 µL sample from the culture before isopropyl β-D-1-thiogalactopyranoside (IPTG) induction.
    3. Induce gene expression by the addition of IPTG to a final concentration of 1 mM. Grow the culture at 37 °C for 16 h in an orbital shaker at 180 rpm. Collect a 100 µL sample from the culture.
    4. Centrifuge the whole culture at 9000 x g for 30 min. Discard the supernatant, and resuspend the bacterial pellet in 30 mL of TBSE buffer (10 mM Tris, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA)) with 1:1000 (v/v) 2-mercaptoethanol (freshly added).
      Caution: Handle 2-mercaptoethanol under the fume hood. Avoid contact with skin and eyes. Avoid inhalation of vapor or mist. Perform all the resuspension steps with buffers containing 2-mercaptoethanol under the fume hood.
    5. Weigh an empty centrifuge beaker and transfer the resuspended pellet into the empty beaker. Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh the beaker with the pellet. Subtract the weight of the empty beaker to calculate the weight of the pellet.
      NOTE: The protocol can be paused here. Freeze the pellet at -20 °C in the short term or at -80 °C in the long term. Upon resuming the protocol, thaw the pellet at RT.
    6. Resuspend the pellet in STE buffer (10 mM Tris pH 8.0; 150 mM NaCl; 1 mM EDTA, 375 mM sucrose; 1:1000 (v/v) 2-mercaptoethanol (freshly added)). Use 200 mL of STE buffer for every 10 g of pellet.
    7. Sonicate the suspension on ice (10 min with 40 s pulse, 20 s brake, and 30% amplitude). Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh the pellet. Repeat the sonication and centrifugation steps 4 times.
    8. Resuspend the pellet in 100 mL of TBS buffer (10 mM Tris, 150 mM NaCl). Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh pellet.
    9. Resuspend the pellet in nuclease buffer (100 mM Tris, 1 mM EDTA, 3 mM MgCl2) with freshly added 80 U/mL nuclease (e.g., Benzonase) using 10 mL/g of pellet. Incubate the suspension overnight at RT on a stirring plate (30 rpm).
    10. Add Triton buffer (60 mM EDTA, 1.5 M NaCl, 6% (v/v) 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol) to the suspension. The volume of Triton buffer to add corresponds to a 0.5 volume part of the suspension. Incubate for 10 min at RT (no stirring). Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh the pellet.
    11. Resuspend the pellet in TE buffer (100 mM Tris, 20 mM EDTA) using 8 mL/g of pellet. Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh the pellet.
    12. Resuspend the pellet by adding 4 mL/g of 25 mM NaAc pH 5.0 and 5 mL/g of of 6 M GuCl with 1 mM dithiothreitol (DTT) (freshly added). Incubate the suspension overnight at 4 °C on a stirring plate (30 rpm).
    13. Centrifuge at 75,500 x g for 20 min. The supernatant now contains the unfolded monomeric BMP2 protein. Collect the supernatant and concentrate this extract to 20 OD/mL using a 3 kDa molecular weight cut-off (MWCO) membrane in a concentrating cell (see Table of Materials).
    14. Add the concentrated monomers in single drops to the Renaturation buffer (2 M LiCl, 50 mM Tris, 25 mM CHAPS, 5 mM EDTA, 1 mM glutathione disulfide (GSSG), 2 mM glutathione (GSH)) while stirring (30 rpm). Incubate at RT for 120 h in the dark.
      NOTE: During this incubation period, refolding occours. The solution from this step onwards contains the folded dimeric BMP2-K3Plk.
    15. Adjust the pH of the solution to 3.0 using concentrated HCl. Dialyze the solution against 1 mM HCl. Concentrate the dialyzed solution using a 10 kDa molecular weight cut-off (MWCO) membrane in a concentrating cell.
    16. Equilibrate the solution by adding buffer A (20 mM NaAc, 30% isopropanol). Add a volume of buffer A corresponding to a 30% volume of the solution. Centrifuge the solution at 4700 x g for 15 min.
    17. Equilibrate the column for ion exchange on a fast protein liquid chromatography (FPLC) system15 with 150 mL of buffer A. Load the protein solution onto the equilibrated column. Elute fractions using a linear gradient of buffer B (20 mM NaAc, 30% isopropanol, 2 M NaCl) using 100 mL of buffer B. Collect 2 mL fractions.
      NOTE: Concentrate the protein before loading to the column according to the total column volume. The final protein volume should be <5% of the total column volume.
    18. Analyze 20 µL of each fraction by SDS Polyacrylamide gel (12%) electrophoresis (SDS-PAGE) 16 and Coomassie Brilliant Blue staining17 (see Table of Materials).
      NOTE: The Coomassie Brilliant Blue stained SDS-PAGE gel shows fractions containing dimers (26 kDa) and fractions containing monomers (13 kDa).
    19. Pool dimer-containing fractions. Dialyze the pool of dimer containing fractions overnight at 4 °C against 1 mM HCl (5 liter volume). Concentrate the final product by using a 10 kDa concentrating centrifugal filter unit (see Table of Materials). Analyze the final product by SDS Polyacrylamide (12%) gel electrophoresis (SDS-PAGE) and Coomassie Brilliant Blue staining.
      NOTE: The band on the Coomassie Brilliant Blue stained SDS-PAGE gel should show only one band at 26 kDa. This is the final BMP2-K3Plk product.

2. Optimization of Copper (I)-Catalyzed Alkyne-Azide Cycloaddition (CuAAC) Conditions

  1. Effect of sodium ascorbate (NaAsc) and copper (II) sulfate (CuSO 4 ) on wild type BMP2 (BMP2-WT)
    1. Incubate 20 µM BMP2-WT with different ratios of NaAsc to CuSO4. Use 0.5 mM NaAsc and 0.5 mM CuSO4 (starting concentration) in a 50 µL volume. Proceed with the following ratios of NaAsc to CuSO4: (1:1), (1.7:1), (10:1), (20: 1), keeping the CuSO4 concentration constant at 0.5 mM and adjusting the concentration of NaAsc accordingly. Perform the reaction in H2O on a rotating mixer (20 rpm) overnight at RT.
    2. Prepare reduced samples by adding loading buffer containing 5% 2-mercaptoethanol and incubate sample at 95 °C for 6 min. Analyze reduced and non-reduced samples by SDS Polyacrylamide gel (12%) electrophoresis (SDS-PAGE) and Coomassie Brilliant Blue staining. The Coomasie stained SDS-PAGE gels show bands in the range of 13 kDa (reduced conditons) to 26 kDa and higher molecular weight (non-reduced conditions).
  2. Effect of Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA) on the CuAAC Reaction
    1. Incubate 20 µM BMP2-K3Plk with different ratios of THPTA to CuSO4. Use 5 mM NaAsc, and 200 µM 3-Azido-7-hydroxycoumarin (keep NaAsc and 3-Azido-7-hydroxycoumarin constant). Use 50 µM THPTA and 0.5 mM of CuSO4 as starting concentrations. Use different ratios of THPTA to CuSO4: (7:1); (10:1); (12:1); (15:1); (20:1). Perform reaction in H2O (50 µL total volume) for 24 h at RT on a rotating mixer (20 rpm).
    2. Upon coupling, 3-Azido-7-hydroxycoumarin becomes a fluorescent dye. Prepare samples in reduced and non-reduced conditions and analyze them by SDS-PAGE. Visualize the gels under the excitation channel with the specific wavelength for the 3-Azido-7-hydroxycoumarin (λabs = 404 nm; λem = 477 nm).

3. Covalent Coupling Technique of BMP2-K3Plk to Azide Functionalized Agarose Beads

  1. Incubate 20 µM of BMP2-K3Plk or BMP2-WT (used as negative control) with 20 µL of azide-activated agarose beads in a total volume of 500 µL in reaction buffer (0.1 M HEPES pH 7.0, 3.9 M urea, 50 µM CuSO4, 250 µM THPTA, 5 mM sodium ascorbate) for 2 h at RT on a rotating mixer (20 rpm). Stop the reaction by adding 5 mM EDTA (final concentration).
  2. Incubate at RT for 15 min on a rotating mixer (20 rpm). Centrifuge samples at 20,000 x g for 1 min at RT. Collect the supernatants.
  3. Wash the pellet containing the beads three times with 1,000 µL of HBS500 buffer (50 mM HEPES, 500 mM NaCl), three times with 1,000 µL of 4 M MgCl2, and two times with 1,000 µL of phosphate buffered saline (PBS). At every washing step, centrifuge at 20,000 x g for 1 min at RT and collect supernatants. Store coupled beads in 1,000 µL of PBS at 4 °C.
    Caution: Do not disturb the bead pellet while removing the supernatant.

4. Validating the Presence and Biological Activity of Immobilized BMP2-K3Plk Using Texas Red Labeled BMP Receptor I A Ectodomain (BMPR-IA EC )

  1. Incubate 50 µL of the BMP2-K3Plk functionalized beads with 1 µM of Texas Red labeled BMPR-IAEC with 150 µL of HBS500 buffer (50 mM HEPES, 500 mM NaCl) at RT for 1 h on a rotating mixer (20 rpm).
  2. Centrifuge the beads at 20,000 x g for 1 min at RT. Discard the supernatant. Wash the beads with 1000 µL of HBS500 buffer. Repeat the washing step an additional 3 times. Centrifuge at 20,000 x g for 1 min at RT after each washing step.
  3. Resuspend the beads in 500 µL of PBS and pipette 50 µL on a glass cover slide. Set the microscope filter between 561 or 594 nm. Detect Texas Red–BMPR-IAEC–BMP2-K3Plk functionalized beads using fluorescent microscopy and take pictures.

5. Measuring Alkaline phosphatase (ALP) Expression to Prove the In Vitro Bioactivity of the Produced BMP2-K3Plk Before and After the Coupling Reaction.

  1. Alkaline phosphatase (ALP) assay
    1. Culture promyoblastic C2C12 cells (ATCC CRL-172) in Dulbecco's Modified Eagle's Medium (DMEM) with 10% Fetal Calf Serum (FCS), 100 U/mL penicillin G and 100 µg/mL streptomycin at 37 °C in a humidified atmosphere at 5% CO2.
    2. Seed C2C12 cells at a density of 3 × 104 cells/well into a 96-well microplate. Let cells attach overnight. Remove medium and incubate C2C12 cells in the presence of 0.5-200 nM of BMP2-WT or BMP2-K3Plk in 100 µL/well of DMEM (2% FCS, 100 U/mL penicillin G and 100 µg/mL streptomycin) at 37 °C in a humidified atmosphere at 5% CO2 for 72 h.
    3. Remove medium and wash cells with 100 µL of PBS per well. Lyse cells at RT for 1 h with 100 µL/well of lysis buffer (1% NP-40, 0.1 M glycine, pH 9.6, 1 mM MgCl2, 1 mM ZnCl2) on a shaking plate (220 rpm).
    4. Add 100 µL/well of ALP buffer (0.1 M glycine, pH 9.6, 1 mM MgCl2, 1 mM ZnCl2) with 1 mg/mL p-nitrophenylphosphate (freshly added) to the cell lysate.
    5. Measure absorption at 405 nm in a multiplate reader after adding the ALP buffer, and every 5 min until the development of the color is complete. Generate dose response curves and EC50 values using a logistic model, y = A2 + (A1-A2)/(1 + (x/x0)p).
  2. Alkaline phosphatase (ALP) staining
    1. Culture promyoblastic C2C12 cells (ATCC CRL-172) in Dulbecco's Modified Eagle Medium (DMEM) with 10% Fetal Calf Serum (FCS), 100 U/mL penicillin G and 100 µg/mL streptomycin at 37 °C in a humidified atmosphere at 5% CO2.
    2. Seed C2C12 cells at a density of 3 × 104 cells/well in a 96-well microplate. Let cells attach overnight. Remove medium and add 20 µL/well of BMP2-K3Plk coupled beads. BMP2-K3Plk coupled beads are in 1000 µL of a PBS suspension.
    3. Prepare a solution of 0.4% low-melting-point agarose in DMEM. Melt in the microwave (600 W for 3 min) and let it cool down in a water bath at 37 °C until use.
    4. Add 20 µL of 0.4% low-melting-point agarose in each well (covering beads and cells). Centrifuge at 2000 x g for 5 min at 20 °C. Add 80 µL DMEM (2% FCS, 100 U/mL penicillin G and 100 µg/mL streptomycin) and incubate at 37 °C in a humidified atmosphere at 5% CO2 for 72 h.
    5. Remove medium, being careful not to detach the solidified 0.4% agarose. Add 100 µL/well of 1-Step NBT/BCIP (Nitro-blue tetrazolium chloride, 5-bromo-4-chloro-3'-indolyphosphate p-toluidine salt) substrate solution.
    6. Analyze alkaline phosphatase staining using light microscopy immediately after the purple staining becomes apparent. Use bright field microscopy and take pictures.

Access restricted. Please log in or start a trial to view this content.

Results

In this article, we describe a method to covalently couple a new BMP2 variant, BMP2-K3Plk, to commercially available azide functionalized agarose beads (Figure 1). The bioactivity of the produced BMP2-K3Plk variant was validated by the induction of alkaline phosphatase (ALP) gene expression in C2C12 cells. The in vitro test shows similar ALP expression levels induced by wild type BMP2 (BMP2-WT) and BMP2-K3Plk (Figure 2)....

Access restricted. Please log in or start a trial to view this content.

Discussion

Generating tagged protein variants by genetic codon expansion allows the introduction of various non-natural amino acid analogs principally at any position of the primary protein sequence. In case of BMPs like BMP2, common tags such as a 6-Histidine (His) tag can only be introduced N-terminally, since the protein´s C-terminal end is buried within the tertiary protein structure, and is thus not accessible from the outside. At other positions, the size of the introduced tag may very likely cause structural alterations...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare no competing financial interests.

Acknowledgements

The authors thank Dr. M. Rubini (Konstanz, Germany) for providing the plasmid encoding pyrrolysyl-tRNA and for providing pRSFduet-pyrtRNAsynth encoding the corresponding aminoacyl-tRNA synthetase.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Material
1-Step NBT/BCIPThermo Fisher34042Add solution to cells
3-Azido-7-hydroxycoumarinBaseClickBCFA-047-1Chemical used for click reaction
Agarose low melting pointBiozym840101Agarose for ALP assay 
Azide agarose beadsJena BioscienceCLK-1038-2Beads used for reaction
BamHI (Fast Digest enzyme)Thermo Fisher ScientificFD0054Restriction enzyme
BMP receptor IA (BMPR-IAEC)----Produced in our lab
Coomassie Brilliant Blue G-250 DyeThermo Fisher Scientific20279Chemical used for Coomassie Brilliant blue staining of SDS PAGE
Copper (II) sulfate anhydrous (CuSO4)Alfa AesarA13986Chemical used for click reaction
DNA Polymerase and reaction buffer KapabiosystemsKK2102KAPA HiFi PCR Kit
Dulbecco’s modified Eagle’s medium (DMEM) GlutaMAXGibco61965-026Cell culture media
ethylenediaminetetraacetic acid (EDTA)Sigma Aldrich GmbHE5134-1kgChemical used to stop click reaction
Isopropyl ß-D-1-thiogalactopyranoside (IPTG)Carl Roth GmbH2316.5Bacteria induction (1mM final concentration) 
NdeI (Fast Digest enzyme)Thermo Fisher ScientificER0581Restriction enzyme
NHS-activated Texas RedLife technologiesT6134Coupled to receptor
P- Nitrophenyl PhosphateSigma Aldrich GmbHN4645-1GAlkaline Phosphatase
p25N-hmBMP2 ----Plasmid kindly provided from Walter Sebald to J. Nickel
pET11a-pyrtRNA----Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
propargyl-L-lysine (Plk)----Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
pSRFduet-pyrtRNAsynth----Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg
Qiagen Gel Extraction KitQiagen28704Gel Purification
Qiagen PCR purification KitQiagen28104PCR Purification 
Sodium L-ascorbateSigma Aldrich GmbHA7631-100GChemical used for click reaction
T4 DNA LigaseThermoScientificEL0011Ligation 
tris(3-hydroxypropyltriazolylmethyl)amine (THPTA)BaseClickBCMI-006-100Chemical used for click reaction
4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycolSigma Aldrich GmbHX100-1LTriton X 100 
NameCompanyCatalog NumberComments
Equipment
Amicon concentrating cell 400 ml Merck KGaAUFSC40001Concentrating unit
Amicon Ultra-15 Centrifugal Filter UnitsMerck KGaAUFC901024Concentrating centrifugal unit
ÄKTA avant FPLCÄKTA--FPLC machine
Avanti J-26XPBeckman Coulter 393124Centrifuge for bacterial culture
Bacterial Shaking IncubatorInfors HTShaking incubator for bacterial culture
FluorChem Q systemproteinsimple--Imaging and analysis system for SDS-PAGE
Fluorescent miscroscopeKeyenceBZ-9000 (BIOREVO)
Fractogel® EMD SO3- (M)Merck KGaA116882Ion Exchange Chromatography column material
Greiner CELLSTAR® 96 well platesSigmaM5811-40EA96 well plates for cell culture (ALP Assay)
Heraeus Multifuge X1RThermoScientific--Centrifuge
M-20 Microplate Swinging Bucket RotorThermoScientific75003624Rotor for Microcentrifuge for plate during ALP staining
Microcentrifuge - 5417REppendorf--Centrifuge
OriginPro 9.1 G OriginLab--software for stastic analysis of ALP assay data
Polysine SlidesThermoScientific10143265microscope slides
Rotor JA-10Beckman Coulter --rotor for Avanti J-26XP centrifuge
Rotor JLA 8.1Beckman Coulter --rotor for Avanti J-26XP centrifuge
Rotor JA 25.50Beckman Coulter --rotor for Avanti J-26XP centrifuge
Tecan infinite M200 multiplate readerTecan Deutschland GmbH--Multiplate reader for ALP assay
Thermocycler - Labcycler GradientSensoQuest GmbH--PCR
TxRed - microscope filterKeyenceFilter for fluorescent microscope 
Ultrafiltration regenerated cellulose discs 3 kDaMerck KGaAPLBC04310used with amicon concentrating cell 400ml
Ultrafiltration regenerated cellulose discs 10 kDaMerck KGaAPLGC04310used with amicon concentrating cell 400ml

References

  1. Giannoudis, P. V., Dinopoulos, H., Tsiridis, E. Bone substitutes: An update. Injury. 36, Suppl 3. S20-S27 (2005).
  2. Oryan, A., Alidadi, S., Moshiri, A., Bigham-Sadegh, A. Bone morphogenetic proteins: A powerful osteoinductive compound with non-negligible side effects and limitations. Biofactors. 40 (5), 459-481 (2014).
  3. Luginbuehl, V., Meinel, L., Merkle, H. P., Gander, B. Localized delivery of growth factors for bone repair. Eur J Pharm Biopharm. 58 (2), 197-208 (2004).
  4. Haidar, Z. S., Hamdy, R. C., Tabrizian, M. Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair. Part A: Current challenges in BMP delivery. Biotechnol Lett. 31 (12), 1817-1824 (2009).
  5. Hollinger, J. O., Uludag, H., Winn, S. R. Sustained release emphasizing recombinant human bone morphogenetic protein-2. Adv Drug Deliv Rev. 31 (3), 303-318 (1998).
  6. Uludag, H., et al. Implantation of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model. J Biomed Mater Res. 50 (2), 227-238 (2000).
  7. Uludag, H., Golden, J., Palmer, R., Wozney, J. M. Biotinated bone morphogenetic protein-2: In vivo and in vitro activity. Biotechnol Bioeng. 65 (6), 668-672 (1999).
  8. Aono, A., et al. Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer. Biochem Biophys Res Commun. 210 (3), 670-677 (1995).
  9. Suzuki, Y., et al. Alginate hydrogel linked with synthetic oligopeptide derived from BMP-2 allows ectopic osteoinduction in vivo. J Biomed Mater Res. 50 (3), 405-409 (2000).
  10. Knaus, P., Sebald, W. Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily. Biol Chem. 382 (8), 1189-1195 (2001).
  11. Wang, L., Xie, J., Schultz, P. G. Expanding the genetic code. Annu Rev Biophys Biomol Struct. 35, 225-249 (2006).
  12. Costa, G. L., Weiner, M. P. Rapid PCR site-directed mutagenesis. CSH Protoc. 2006 (1), (2006).
  13. Kirsch, T., Nickel, J., Sebald, W. Isolation of recombinant BMP receptor IA ectodomain and its 2:1 complex with BMP-2. FEBS Lett. 468 (2-3), 215-219 (2000).
  14. Tabisz, B., et al. Site-directed immobilization of BMP-2: Two approaches for the production of innovative osteoinductive scaffolds. Biomacromolecules. 18 (3), 695-708 (2017).
  15. Duong-Ly, K. C., Gabelli, S. B. Using ion exchange chromatography to purify a recombinantly expressed protein. Methods Enzymol. 541, 95-103 (2014).
  16. Brunelle, J. L., Green, R. One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE). Methods Enzymol. 541, 151-159 (2014).
  17. Brunelle, J. L., Green, R. Coomassie blue staining. Methods Enzymol. 541, 161-167 (2014).
  18. Kirsch, T., Nickel, J., Sebald, W. BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II. EMBO J. 19 (13), 3314-3324 (2000).
  19. Hein, J. E., Fokin, V. V. Copper-catalyzed azide-alkyne cycloaddition (CuAAC) and beyond: new reactivity of copper(I) acetylides. Chem Soc Rev. 39 (4), 1302-1315 (2010).
  20. Alborzinia, H., et al. Quantitative kinetics analysis of BMP2 uptake into cells and its modulation by BMP antagonists. J Cell Sci. 126 (Pt 1), 117-127 (2013).
  21. Paarmann, P., et al. Dynamin-dependent endocytosis of Bone Morphogenetic Protein2 (BMP2) and its receptors is dispensable for the initiation of Smad signaling. Int J Biochem Cell Biol. 76, 51-63 (2016).
  22. Pohl, T. L., Boergermann, J. H., Schwaerzer, G. K., Knaus, P., Cavalcanti-Adam, E. A. Surface immobilization of bone morphogenetic protein 2 via a self-assembled monolayer formation induces cell differentiation. Acta Biomater. 8 (2), 772-780 (2012).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Request permission to reuse the text or figures of this JoVE article

Request Permission

Tags

BMP2 VariantSite Directed CouplingProtein ExpressionAlkaline Phosphatase AssayCovalent ImmobilizationCuAAC ReactionOsteogenic DifferentiationGenetic Code ExpansionBead Functionalization

Related Articles