Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Summary

The manuscript describes a chip-based digital PCR assay to detect a rare CDH1 transcript variant (CDH1a) in fresh-frozen normal and tumor tissues obtained from patients with gastric cancer.

Abstract

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal gastric mucosa. Recently, we detected CDH1a transcript variant in fresh-frozen tumor tissues obtained from patients with GC. The expression of this variant in tissue samples was investigated by the chip-based digital PCR (dPCR) approach presented here. dPCR offers the potential for an accurate, robust, and highly sensitive measurement of nucleic acids and is increasingly utilized for many applications in different fields. dPCR is capable of detecting rare targets; in addition, dPCR offers the possibility for absolute and precise quantification of nucleic acids without the need for calibrators and standard curves. In fact, the reaction partitioning enriches the target from the background, which improves amplification efficiency and tolerance to inhibitors. Such characteristics make dPCR an optimal tool for the detection of the CDH1a rare transcript.

Introduction

The CDH1 gene encodes for E-cadherin, a key factor involved in the maintenance of the normal gastric epithelium through the regulation of cell adhesion, survival, proliferation, and migration¹. Loss of E-cadherin protein as a result of deleterious germline or somatic alterations of CDH1 has been associated with the development of GC^2,3. Non-canonical transcripts arising from intron 2 of the gene have also been hypothesized to play a role in gastric carcinogenesis^4,5. In particular, one such transcript, CDH1....

Protocol

The protocol follows the guidelines of the IRST Human Research Ethics Committee.

NOTE: This procedure is specifically designed for the detection of a low number of cDNA molecules in human fresh-frozen tissues. The tissue sections have been cut on dry ice, while still frozen, from previously validated patient-derived gastric tumor or normal tissue samples.

1. RNA Isolation and Purification

1. RNA extraction
   Note: RNA isolation is performed under the hood using a specific product (see Table of Materials). However, a variety of isolation kits are commercially av....

Results

Using the procedure presented here, we checked for the expression of the rare transcript variant CDH1a in gastric fresh-frozen tissues. The analysis by dPCR was performed on 21-paired normal and cancer tissue samples and in 11 additional tumor samples. CDH1a was detectable in 15 out of 32 (47%) tumors, whereas no normal tissue samples showed the presence of this rare transcript⁵. In our analysis, chips with less than 13,000 data points were reject.......

Discussion

dPCR was originally developed for DNA molecular measurements^10,11,12,13 and in time this technology was adapted for the quantification of microRNAs and RNA transcripts^5,14,15. In this protocol we have extended the list of applications to include detection of rare transcripts derived from fresh-frozen t.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
TRIazol Reagent	Thermo Fisher Scientific	15596018
Glycogen 20 mg/ml	ROCHE	10901393001
RNeasy MinElute Cleanup kit	QIAGEN	74204
iScript cDNA Synthesis kit	BioRad	1708891
QuantStudio 3D Digital PCR Master Mix v2	Thermo Fisher Scientific	A26358
CDH1a IDT custom designed assay	Integrated DNA Technologies (IDT)	NA	F) GCTGCAGTTTCACTTTTAGTG (R) ACTTTGAATCGGGTGTCGAG (P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ [dPCR optimized assay concentrations: 900 nM (F),        900 nM (R), 250 nM (P)]
QuantStudio 3D Digital PCR 20K Chip Kit v2	Thermo Fisher Scientific	A26316
Heraeus Biofuge Fresco	Thermo  Scientific	75002402
Thermocycler (Labcycler)	Sensoquest	011-103
GeneAmp PCR System 9700	Thermo Fisher Scientific	N805-0200
Dual Flat Block Sample Module	Thermo Fisher Scientific	4425757
QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700	Thermo Fisher Scientific	4486414
QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler	Thermo Fisher Scientific	4485513
QuantStudio 3D Digital PCR Chip Loader	Thermo Fisher Scientific	4482592
QuantStudio 3D Digital PCR Instrument with power cord	Thermo Fisher Scientific	4489084