This protocol provides a workflow on how to combine artificial microRNA-mediated RNA interference with optogenetics to stimulate specifically presynaptic boutons with reduced expression of selective gene(s) within intact neuronal circuits.
Method Article
This protocol provides a workflow on how to combine artificial microRNA-mediated RNA interference with optogenetics to stimulate specifically presynaptic boutons with reduced expression of selective gene(s) within intact neuronal circuits.
The purpose of this protocol is to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. We describe a workflow on how to combine artificial microRNA (miR)-mediated RNA interference with optogenetics to achieve selective stimulation of manipulated presynaptic boutons in acute brain slices. The experimental approach involves the use of a single viral construct and a single neuron-specific promoter to drive the expression of both an optogenetic probe and artificial miR(s) against presynaptic gene(s). When stereotactically injected in the brain region of interest, the expressed construct makes it possible to stimulate with light exclusively the neurons with reduced expression of the gene(s) under investigation. This strategy does not require the development and maintenance of genetically modified mouse lines and can in principle be applied to other organisms and to any neuronal gene of choice. We have recently applied it to investigate how the knockdown of alternative splice isoforms of presynaptic P/Q-type voltage-gated calcium channels (VGCCs) regulates short-term synaptic plasticity at CA3 to CA1 excitatory synapses in acute hippocampal slices. A similar approach could also be used to manipulate and probe the neuronal circuitry in vivo.
This protocol describes a new approach to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. Investigating presynaptic function in intact neuronal circuits is challenging because many presynaptic boutons are too small and far away from the soma to allow combined molecular and electrophysiological interventions. Although RNA interference offers a powerful and flexible means to knockdown synaptic proteins1, this approach has been used sparingly to investigate presynaptic function because it is difficult to detect the effects of knockdown using traditional electrical stimulations, which do not distinguish between manipulated and naïve presynaptic boutons2. Here, we describe how to combine artificial microRNA (miR)-mediated RNA interference with recently developed optogenetic technology to achieve selective stimulation of manipulated presynaptic boutons in acute brain slices.
While conditional knockout mice in combination with electrophysiology could also be used to investigate the function of presynaptic proteins3,4, our strategy does not require the development and maintenance of genetically modified mouse lines and can also be easily employed to knock down specific isoforms of a gene. Relative to more commonly used short hairpin RNAs (shRNAs), artificial miRs, which we employ here, offer key advantages for knockdown in neurons. Unlike shRNAs, they can be expressed under the control of a polymerase II promoter1. Thus, a single promoter can be used to drive the expression of both miR and an optogenetic probe, along with a fluorescent reporter. In this way, the size of the construct can be kept within the packaging limits of recombinant adeno-associated viruses (rAAV, Figure 1A). Also, the use of a single construct and a single promoter reduces experimental variability because it allows for expression of the miR, the optogenetic probe and the fluorescent reporter in a fixed ratio.
We have recently applied this technology to examine the role of alternatively spliced isoforms of presynaptic calcium channels in the hippocampus5. Such a strategy is generally applicable to studying the physiological relevance of other presynaptically expressed proteins in any brain circuit of interest.
All experiments were carried out in accordance with the guidelines established by the European Communities Council (Directive 2010/63/EU of March 4, 2014), and were approved by the Italian Ministry of Health.
1. Design of microRNAs for RNA Interference and Evaluation of their Efficiency in Heterologous Expression Systems
NOTE: This protocol requires knowledge of the following well-established methods: molecular cloning, DNA sequencing, maintenance of cell lines, calcium phosphate transfection, quantitative real time PCR (qRT-PCR), preparation of cell lysates from cell lines and Western blotting.
2. Construction of Recombinant Adeno-associated Vectors for Combined Expression of Optogenetic Probes and microRNAs
NOTE: This protocol requires knowledge of the following well-established methods: molecular cloning, DNA sequencing and rAAV production.
3. Extraction of RNA from Primary Neuronal Cultures for Evaluation of miR Knockdown Efficiency of Endogenous Genes by qRT-PCR
NOTE: (i) This protocol requires knowledge of the following well-established methods: preparation and maintenance of primary neuronal cultures and qRT-PCR. (ii) Repeat the quantification of knockdown efficiency (steps 3.1–3.14) at least 3 times (biological replicates). (iii) Estimation of knockdown efficiency at the mRNA level by qRT-PCR is suitable when an analysis of the protein content is precluded, such as when knocking down alternatively spliced isoforms for which specific antibodies are not available5.
4. Assessing the Role of Presynaptic Proteins in Intact Neuronal Circuits by Targeted Stimulation of Knocked-down Neurons with Optogenetics
NOTE: The following protocol requires previous experience with electrophysiological recordings in acute brain slices and access to an electrophysiological setup.
The procedures described above provide a robust method to assess how synaptic transmission is affected by the knockdown of synaptic proteins in presynaptic neurons. Representative results on how the knockdown of alternative splice isoforms of presynaptic Cav2.1 (P/Q-type) VGCCs regulates short-term synaptic plasticity at CA3 to CA1 excitatory synapses are given below as an example.
Cav2.1 (P/Q-type) channels are the predominant presynaptic VGCCs at most fast synapses in the central nervous system. Alternative splicing of the mutually exclusive exons 37a and 37b of the pore-forming α1 subunit of Cav2.1 (α1A) produces two major variants, Cav2.1[EFa] and Cav2.1[EFb]16,17,18. To determine whether Cav2.1[EFa] and Cav2.1[EFb] differentially regulate synaptic transmission and plasticity in rat hippocampal pyramidal neurons, we first developed isoform-specific miRs to knockdown selectively Cav2.1[EFa] or Cav2.1[EFb]5. Despite the short size (97 bp) and high similarity (61.86% identity at the nucleotide level) between exons 37a and 37b, we could design three miR sequences against rat Cav2.1[EFa] (miR EFa1: TCCTTATAGTGAATGCGGCCG; miR EFa2: ATGTCCTTATAGTGAATGCGG; miR EFa3: TTGCAAGCAACCCTATGAGGA) and two against rat Cav2.1[EFb] (miR EFb1: ATACATGTCCGGGTAAGGCAT; miR EFb2: ATCTGATACATGTCCGGGTAA) with predicted high knockdown efficiency. As negative control (miR Control), we used the pcDNA6.2-GW/EmGFP-miR-neg plasmid containing a sequence that does not target any known vertebrate gene. Based on a first screen in HEK 293 cells against heterologous channels, we selected miR EFa1, miR EFa3 and miR EFb2 and cloned their expression cassettes into the 3'UTR of the vector pAAV-Syn-ChETA-TdT-miR-X, which is designed for production of rAAVs and where the synapsin promoter drives expression of the ultrafast channelrhodopsin ChETA, the red fluorescent protein TdTomato and the inserted miR (Figure 1). We also duplicated the expression cassette of miR EFb2 to increase the knockdown efficiency of this miR.
Next, we prepared rAAV1/2 for the above four constructs, and quantified their knockdown efficiency and selectivity in primary rat neuronal cultures using isoform-specific qRT-PCR. miR EFa1 and miR EFa3 reduced mRNA of native Cav2.1[EFa] by ~70% but not that of Cav2.1[EFb], whilst miR EFb reduced mRNA of native Cav2.1[EFb] by ~60% but not that of Cav2.1[EFa] (Figure 2).
We then stereotactically injected each of the four rAAV1/2 into the CA3 area of the hippocampus of P18 rats (Figure 3A-C), with coordinates of (A-P/M-L/D-V from Bregma) −2.6/± 2.9/−2.9. Fifteen to twenty-four days post-injection, we prepared acute hippocampal slices from rAAV1/2-injected rats and used TdTomato fluorescence to confirm the expression and localization of rAAVs (Figure 3B). To investigate whether presynaptic knockdown of either Cav2.1[EFa] or Cav2.1[EFb] affected short-term synaptic plasticity at CA3 to CA1 synapses, we stimulated selectively infected CA3 neurons with brief 473 nm laser light pulses (2 ms-long; Figure 3C), and recorded the resulting EPSCs by patching pyramidal neurons in the proximal to medial tract of the CA1 region (Figure 3C). We found that the knockdown of Cav2.1 splice isoforms affected responses to paired-pulse stimulation in opposite directions: knockdown of Cav2.1[EFa] (miR EFa1 or miR EFa3) boosted paired-pulse facilitation (PPF) whereas knockdown of Cav2.1[EFb] (miR EFb2) abolished it (Figure 3D, E).

Figure 1: Scheme of the constructs for combined expression of the ultrafast optogenetic probe ChETA and isoform-specific miRs against Cav2.1[EFa] and Cav2.1[EFb]. (A) Map of the rAAV construct pAAV-Syn-ChETA-TdT-miR-X, containing a synapsin promoter (Syn), the ultrafast channelrhodopsin ChETA fused to TdTomato and, in the proximal 3'UTR, a Cav2.1 splice isoform-specific miR. Restriction enzymes shown are single cutters. (B) Top, scheme of the expression cassette. The synapsin promoter drives expression of both ChETA-TdTomato and an isoform-specific miR. Bottom, reverse complement of the 21-nucleotide target sequences, which form part of the miR cassette. For miR EFb2 two identical miR cassettes were expressed in tandem one after the other. Please click here to view a larger version of this figure.

Figure 2. Evaluation of the knockdown efficiency and selectivity of isoform-specific miRs for Cav2.1[EFa] and Cav2.1[EFb]. Isoform-specific qRT-PCR analysis on RNA isolated from 17-18 DIV primary cultures infected at 6 DIV with rAAVs expressing miRs targeting either Cav2.1[EFa] (miR EFa1 and miR EFa3) or Cav2.1[EFb] (miR EFb2). Data are normalized to the negative control (miR Control). miR EFa1 and miR EFa3 significantly and selectively reduce mRNA of Cav2.1[EFa] (n = 8 and 7 cultures, respectively), while miR EFb significantly and selectively reduces mRNA of Cav2.1[EFb] (n = 4 cultures; ***p<0.001; one-way analysis of variance test followed by the Tukey-Kramer post-test). Data are presented as mean ± SEM. This figure has been adapted from Thalhammer, A. et al.5. Please click here to view a larger version of this figure.

Figure 3. Assessing the role of Cav2.1[EFa] and Cav2.1[EFb] in the native hippocampus by targeted stimulation of knocked-down neurons with optogenetics. (A) Scheme of the expression cassette of the rAAV constructs used for in vivo infection. (B) Hippocampal section showing that TdTomato fluorescence is limited to the CA3 region and its projections. (C) Experimental configuration: laser beam was directed onto CA3 somata, and patch clamp recordings were performed from CA1 pyramidal neurons. (D) 2 ms-long blue (473 nm) laser light pulses shone at 20 Hz evoke EPSCs whose PPF is increased by miRs targeting Cav2.1[EFa] and abolished by miR for Cav2.1[EFb]. (E) Summary of paired-pulse ratio for experiments as in (D), showing an increase in PPF for miR EFa1 and miR EFa3 and a decrease for miR EFb2, relative to miR Control (n = 9 - 11 recordings; *p=0.02; **p=0.01; ***p<0.0004; analysis of covariance). Data are presented as mean ± SEM. This figure has been adapted from Thalhammer, A. et al.5. Please click here to view a larger version of this figure.
Co-expression of an optogenetic probe and a miR against a presynaptic gene of interest offers a powerful approach to characterize the effect of gene knockdown on presynaptic function within intact neuronal circuits. For this experimental approach, it is important to identify and characterize miRs that are highly efficient and selective in knocking down the gene of interest in native systems. If possible, two or more independent miRs against the same mRNA of interest should be used to control for eventual off-target effects. Rescue experiments, in which a miR-resistant gene is reintroduced in the system, can be used as a control for specificity.
Using the same construct to express an optogenetic probe and a miR allows for stimulating optically only the presynaptic neurons that have been manipulated. This is not possible with electrical stimulations because they do not distinguish between infected and non-infected neurons, thus producing mixed and diluted results. Because optical stimulations can induce multiple action potentials15, it is important to choose only the fastest optogenetic probes, among an expanding palette15,19,20,21. In addition, it is essential to ensure that optical stimulation does not induce a direct depolarization of presynaptic boutons, to avoid bypassing some of the steps of synaptic transmission one wishes to investigate22.
The experimental approach we describe here, makes it possible to evaluate in parallel the physiological relevance of multiple presynaptic genes of interest within a limited time period (4–6 months). However, it is important to keep in mind that knockdowns rarely reach 100%. Moreover, rAAVs need to be expressed for at least two weeks to allow for maximal knockdown and full expression of the optogenetic probe, which may represent a time constraint when investigating early developmental processes. Though more time consuming, conditional knockout mice limited to presynaptic neurons, generally result in complete removal of the gene of interest and offer therefore a valid complementary approach.
A specific advantage of the miR technology is that it enables the expression of multiple miRs from the same promoter. This property has mainly been used to increase knockdown efficiency by inserting multiple copies of the same miR or different miRs against the same target gene. It can however be used also to knockdown multiple genes by expressing miRs against different target genes7,23. This property might be used to silence multiple presynaptic proteins to dissect presynaptic signaling pathways.
Here, we have combined optogenetics with artificial miRs to characterize the effects of gene knockdown on presynaptic function in acute hippocampal slices. A similar approach could also be used to manipulate and probe neuronal circuitry in vivo. In addition, combining artificial miRs with chemogenetic approaches would enable one to interrogate neuronal circuitry on longer time scales.
The authors have nothing to disclose.
We thank F. Benfenati (Istituto Italiano di Tecnologia, IIT) for support and Carmela Vitale for helping with the demonstration. This work was funded by IIT and the Compagnia San Paolo (grant no. 9734 to LAC).
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Acrylamide | Sigma | Acrylamide/Bis-acrylamide, 30% solution | Toxic |
| Animal Temperature Controller with heat pad | WPI | ATC2000 | |
| BCA protein assay kit | ThermoFisher Scientific | 23225 | |
| BLOCK-iT Pol II miR RNAi Expression Vector kit | ThermoFisher Scientific | K4936-00 | |
| Brain slices Prechamber | Harvard Apparatus | BSC-PC | |
| CCD camera-based imager | Bio-Rad | ChemiDoc™ MP | |
| Cell Culture reagents | Life Technologies | ||
| Chemiluminescent substrate | GE Helthcare | ECL Western Blotting Reagents, RPN2106 | |
| Chloroform | Sigma | C2432 | Toxic |
| Cytosine β-D-arabinofuranoside | Sigma | C6645 | |
| Drill | Foredom | K.1030 | |
| EGTA | Sigma | E4378 | |
| Gentamicin ointment | Local pharmacy | ||
| Glucose | Sigma | G7021 | |
| Hepes | Sigma | 54459 | |
| Injection micropipettes | Narishige | GD1 | |
| Inorganic salts & detergents | Sigma | ||
| K2-creatine phosphate | Calbiochem | 237911 | |
| KGluconate | Fluka | 60245 | |
| Laser | Laserglow Technologies | LRS-0473-GFM-00100-03 | |
| Membrane | Amersham | Protran™ 0.2 µm NC | |
| MgATP | Sigma | A9187 | |
| Micropipette holder | Narishige | IM-H1 | |
| Micropipette puller | Narishige | PC-100 | |
| Na3GTP | Sigma | G8877 | |
| NaPyruvate | Sigma | P5280 | |
| Ocular lubricant | Local pharmacy | Lacrigel | |
| Phosphate inhibitors | Sigma | P0044, P5726 | |
| Protease inhibitors | Sigma | cOmplete™, EDTA-free Protease Inhibitor Cocktail | |
| Protein gel electrophoresis and blotting devices | Bio-Rad | Mini-Protean III Cell | |
| Providone iodine | Local pharmacy | Betadine | |
| Qiazol Lysis Reagent | Qiagen | 79306 | Toxic |
| QuantiTect Reverse Transcription Kit | Qiagen | 205311 | |
| RNeasy Micro Kit | Qiagen | 74004 | |
| Spectrophotometer | ThermoFisher Scientific | Nanodrop 2000 | |
| Stereotactic apparatus | WPI | ||
| Tetrodotoxin | Tocris | 1069 | Toxic |
| Vibratome | Leica | VT1200S |