We have used the FAIRE method to measure differences in the chromatin accessibility of MHC class II genes in HEK293T cells as published19. MHC class II encoding genes are expressed in antigen presenting cells (APCs), either constitutively or in response to cytokine signaling20. The expression of MHCII genes is driven by an activator complex which binds to specific DNA elements, termed XY boxes, located in the promoter and enhancers of these genes21,22. This is reflected at the level of chromatin, as revealed by our FAIRE analysis of selected regions in the MHC class II genes HLA-DPB1 and HLA-DMA. These experiments showed that chromatin is open at the regions encompassing the XY boxes, while it is more compact in the gene bodies (Figure 2).
As an example, for the calculations, in this particular experiment, we diluted the total DNA sample 10 times (dilution factor 10), and the free DNA sample was not diluted (dilution factor 1) for the qRT-PCR. The Cts obtained for the different regions tested and the calculations to obtain the final recovery ratios and relative recovery ratios are listed in Table 2. These relative recovery ratios were obtained using the ACTB promoter as the positive control. Note that these calculations are for one of the replicates used to generate the results shown in Figure 2.
In a different context, chromatin accessibility was tested in a model for inducible gene expression. In this case, rapid changes of chromatin compaction in response to the pro-inflammatory stimulus tumor necrosis factor (TNF) were measured. HeLa cells were left untreated or stimulated with TNF for 1 h, followed by FAIRE to measure chromatin compaction at the promoter region controlling expression of the gene encoding the TNF-responsive cytokine interleukin 8 (IL8). These results showed a strongly increased chromatin accessibility at the IL8 promoter of TNF-stimulated cells (Figure 3). The accessibility at the IL-8 promoter after TNF stimulation is even higher than that found in the ACTB promoter showing a dramatic chromatin remodeling in this regulatory region. As the recovery ratio obtained in this case is higher than that obtained in the region used as the positive control (ACTB promoter) the relative recovery ratio is higher than one.

Figure 1: The FAIRE workflow. Cells are crosslinked directly in the cell culture flask or dish by adding formaldehyde (A). After quenching of the formaldehyde, cells are washed three times with ice cold PBS (B), and transferred to a reaction tube where they are resuspended in FAIRE lysis buffer and sonicated to shear the DNA (C). One aliquot of the extracted chromatin is de-crosslinked by heating at 65 °C, to get the total DNA reference (D), and afterwards the free DNA is extracted using phenol:chloroform both from the crosslinked and the de-crosslinked aliquots (E). Finally, the DNA is quantified, and the ratio of free vs. total DNA is calculated (F). Please click here to view a larger version of this figure.

Figure 2: Determination of chromatin accessibility in the MHC class II gene cluster in HEK293T cells. HEK293T cells were analyzed by FAIRE. The ratio between free versus total DNA (i.e., the relative recovery ratio) was determined for the promoter of the ACTB gene as a positive control, a heterochromatin region on Chr. 12 as negative control, and the regulatory regions and gene bodies of the MHC class II genes HLA-DMA and HLA-DPB1. The upper part shows a schematic representation of the locus and the positions of the primers. Error bars represent standard deviations from two biological replicates measured in triplicates. The figure was modified from a published report19. Please click here to view a larger version of this figure.

Figure 3: Changes of DNA accessibility at the IL8 promoter in response to TNF treatment. HeLa cells were stimulated with TNF (20 ng/mL) for 1 h and analyzed by FAIRE. The ratio between free versus total DNA was determined for the promoter of ACTB (positive control), a heterochromatin region on Chr. 12 (negative control), and the IL8 promoter. Error bars represent standard errors of the mean (SEM) from three biological replicates measured in duplicates. Please click here to view a larger version of this figure.

Figure 4: Optimization of the sonication conditions. Chromatin extracted from 293T cells was sonified using a focused sonicator with appropriate tubes (Table of Materials). The chromatin was sonicated for the indicated time with repetitions of 30 s with the following settings: peak power 150, duty factor 15, cycles per burst 500, followed by 30 s: peak power 2.5, duty factor 15, cycles per burst 500. The resulting chromatin was de-crosslinked, purified by phenol:chloroform extraction and loaded in a 2% agarose gel. An ethidium-bromide stained gel is shown, and the positions of the molecular weight markers are indicated in bp. In this experiment, the optimal chromatin size (200 - 300 bp) was obtained after 20 min of sonication. Please click here to view a larger version of this figure.
| Primer | Sequence |
| ACTB-Promoter-F | AAAGGCAACTTTCGGAACGG |
| ACTB-Promoter-R | TTCCTCAATCTCGCTCTCGC |
| Chr. 12 negative control-F | ATGGTTGCCACTGGGGATCT |
| Chr. 12 negative control- R | TGCCAAAGCCTAGGGGAAGA |
| HLA-DMA-XY-Box-F | CATCAGTCACTGGGGAGACG |
| HLA-DMA-XY-Box-R | GCTTCCCAGCCCAGTTACAT |
| HLA-DMA-5’-F | GGAGAGAACAATCTCCGCTTCA |
| HLA-DMA-5’-R | AGCTGCTATGTGTGGTTGGT |
| HLA-DMA-3’-F | TGGGGACCTAGTTAGGGAGC |
| HLA-DMA-3’-R | AGATCCATGGGAGGAGGCTT |
| HLA-DPB1-XY-Box-F | GTCCAATCCCAGGGTCACAG |
| HLA-DPB1-XY-Box-R | TGAAAAGAGCTGCAGTCAGGA |
| HLA-DPB1-5’-F | GCGTGTTCATGTCTGCATCC |
| HLA-DPB1-5’-R | TGATCCTCAGAGCCTGGACA |
| HLA-DPB1-3’-F | CCAGCCTAGGGTGAATGTTT |
| HLA-DPB1-3’-R | GCCTGGGTAGAAATCCGTCA |
| IL8 Promoter-F | GTGATGACTCAGGTTTGCCCT |
| IL8 Promoter-R | CTTATGGAGTGCTCCGGTGG |
Table 1: Primers for qPCR.

Table 2: Example calculations of FAIRE Relative Recovery Ratios. Please click here to download this file.