Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Visualisatie van cellulaire elektrische activiteit in de zebravis vroege embryo's en tumoren

doi: 10.3791/57330 Published: April 25, 2018

Summary

Hier, laten we het proces van het creëren van een cellulaire elektrische spanning verslaggever zebrafish lijn om te visualiseren van embryonale ontwikkeling, beweging, en vis tumor cellen in vivo.

Abstract

Bioelectriciteit, endogene elektrische signalering gemedieerd door ionenkanalen en pompen gelegen op de celmembraan, speelt belangrijke rol in het signaleren van processen van prikkelbaar neuronale en motorische cellen en vele andere biologische processen, zoals embryonale Developmental patronen. Er is echter behoefte aan een in vivo elektrische Activiteitencontrole in gewervelde embryogenese. De voorschotten van genetisch gecodeerde fluorescerende spanningsindicatoren (GEVIs) hebben het mogelijk gemaakt te bieden een oplossing voor deze uitdaging. Hier beschrijven we hoe maak je een transgene voltage indicator zebrafish met behulp van de gevestigde voltage-indicator, ASAP1 (versnelde Sensor van actie Potentials 1), als voorbeeld. De Tol2 kit en een promotor van de alomtegenwoordige zebrafish, ubi, werden gekozen in deze studie. We leggen ook de processen van Gateway site-specific klonen, Tol2 transposon gebaseerde zebrafish Transgenese en de procedure voor beginnende vis embryo's en vis tumoren met behulp van reguliere epifluorescerende microscopen. Met behulp van deze vis lijn, vonden wij dat er veranderingen van cellulaire elektrische spanning tijdens de embryogenese van zebravis en vis larvale beweging. Bovendien werd naar voren gebracht dat in een paar zebrafish maligne perifere zenuw schede tumoren, de tumor cellen waren over het algemeen gepolariseerde ten opzichte van het omliggende normale weefsel.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bioelectriciteit verwijst naar het endogene elektrische signalering gemedieerd door ionenkanalen en pompen, gelegen op de celmembraan1. Ionische exchanges over de cellulaire membraan, en de gekoppelde elektrische potentiële en huidige wijzigingen, zijn essentieel voor de signalering van processen van prikkelbaar neuronale en motorische cellen. Bovendien, hebben bioelectriciteit en ion verlopen allerlei andere belangrijke biologische functies zoals energieopslag, biosynthese en transport metaboliet. Bioelectrische signalen werd ook ontdekt als een regulator van embryonale patroonformatie, zoals lichaam assen, de celcyclus en cel differentiatie1. Het is dus cruciaal voor het begrip van vele aangeboren ziekten bij de mens die uit de verkeerde regulering van dit type van signalering voortvloeien. Hoewel patch-clamp wijd verbeid gebruikt is voor het opnemen van de afzonderlijke cellen, is het nog steeds verre van ideaal voor de gelijktijdige bewaking van meerdere cellen tijdens de embryonale ontwikkeling in vivo. Spanning gevoelige kleine moleculen zijn bovendien ook niet ideaal voor in vivo toepassingen als gevolg van hun specifieke kenmerken, gevoeligheden en toxicities.

De oprichting van een verscheidenheid van genetisch gecodeerd fluorescerende spanning indicatoren (GEVIs) biedt een nieuw mechanisme om deze kwestie te overwinnen, en zorgt voor gemakkelijke toepassing te bestuderen van de embryonale ontwikkeling, hoewel zij oorspronkelijk waren bedoeld voor het toezicht op neurale cellen2,3. Een van de momenteel beschikbare GEVIs is de versnelde Sensor van actie Potentials 1 (ASAP1)4. Het is samengesteld uit een extracellulaire lus van een spanning-sensing domein van spanning gevoelige fosfatase en een circulair permuted groen fluorescent proteïne. Daarom, ASAP1 kunt visualisatie van cellulaire elektrische potentiële veranderingen (polarisatie: heldergroen; depolarisatie: donkergroen). ASAP1 heeft 2 ms op-en-off kinetiek en subthreshold potentiële verandering4kunt bijhouden. Dus, deze genetische tool zorgt voor een nieuw niveau van werkzaamheid in real-time bioelectrische bewaking in levende cellen. Verder begrip van de rol van bioelectriciteit in de embryonale ontwikkeling en vele menselijke ziekten, zoals kanker, zal nieuwe licht werpen op de onderliggende mechanismen, die is van cruciaal belang voor de behandeling van de ziekte en preventie.

Zebravis hebben bewezen een krachtige diermodel ontwikkelingsbiologie en menselijke ziekten waaronder kanker5,6te gaan studeren. Zij 70% orthologous genen delen met mensen, en ze hebben soortgelijke gewervelde biologie7. Zebravis bieden relatief gemakkelijk te onderhouden, de grootte van een grote koppeling van eieren, hanteerbare genetica, gemakkelijk Transgenese en transparante externe embryonale ontwikkeling, waardoor ze een superieur systeem voor in vivo imaging5,6. Met een grote bron van mutant vis lijnen al aanwezig en een volledig gesequenceerd genoom zorgt zebravis voor een relatief onbeperkt scala aan wetenschappelijke ontdekking.

Om te onderzoeken de in vivo real-time elektrische activiteit van cellen, profiteren we van de zebravis modelsysteem en ASAP1. In deze paper, we beschrijven hoe de fluorescerende spanning biosensor ASAP1 geïntegreerd in het genoom van de zebravis met behulp van Tol2 transposon Transgenese en visualiseren van cellulaire elektrische activiteit tijdens de embryonale ontwikkeling, vis larvale beweging, en in levende tumor .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De zebravis zijn gehuisvest in een AAALAC-goedgekeurd dier faciliteit, en alle experimenten werden uitgevoerd volgens de protocollen die zijn goedgekeurd door de Purdue Animal Care en gebruik Comité (PACUC).

1. Tol2 Transposon plasmide Construct voorbereiding

Opmerking: Tol2, een transposon die werd ontdekt in medaka, vis is wijd gebruikt in de zebravis onderzoek Gemeenschap8,9. Het is met succes aangenomen om de site-specifieke recombinatie gebaseerde klonen gatewaysysteem en bekend als de Tol2 kit10. De Tol2 kit voorziet in een handige methode voor het maken van aangepaste expressie constructies, terwijl het ook het verhogen van de efficiëntie van Transgenese. Dus was het geen gemakkelijke beslissing om te profiteren van dit systeem, en maak een alomtegenwoordige ASAP1 expressie zebrafish regel met behulp van een gevalideerde ubiquitin promotor te rijden ASAP111.

  1. Creëren van een constructie midden vermelding ASAP1: pDONR221-ASAP1
    1. Verwerven genetisch gecodeerde voltage sensor ASAP1 constructie voor de pcDNA3.1/Puro-CAG-ASAP1 (plasmide #52519), van Addgene. Om te vullen de ASAP1 codering regio, ingesteld een PCR met behulp van de aangepaste inleidingen (attB1-ASAP1F en attB2-ASAP1R) geflankeerd door attB sequenties aan het einde 5' van de inleidingen (Figuur 1). Phusion DNA-polymerase werd gekozen voor zijn hoge efficiëntie en PCR voorwaarden werden geoptimaliseerd op basis van de eerder gepubliceerde protocol12.
    2. De 50 µL PCR producten in een 1% TAE gel met behulp van een regelmatige precisiepipet met 200 µL tips laden en uitvoeren van elektroforese op 160 V in een horizontale gel bak voor ongeveer 30 min.
    3. Controleer de gel onder een UV-transilluminator (353 nm), accijnzen uit de gewenste band met behulp van een mes/scalpel onder een UV-transilluminator als de eerder gepubliceerde13,14, en zet het DNA met gel monster in een schone 1,5 mL microcentrifuge buis.
    4. Reiniging van het gel voor de ASAP1 PCR producten uitvoeren. Herstellen van het DNA in de verwijderde gel met behulp van een commerciële DNA gel zuivering kit volgens instructies van de fabrikant, en elueer de DNA in 20 µL van water. 1 µL als een monster nemen en de concentratie van de DNA met een spectrofotometer meet. De instructies van de software met behulp van water als een blancocontrole15stromen.
    5. Neem 100 ng van PCR product gezuiverd en meng het met 150 ng van pDONR221 plasmide in 10 µL van TE buffer (10 mM Tris, 1 mM EDTA pH 8,0)16. Voeg 2 µL van BP Clonase II in de reactie en de reactie bij kamertemperatuur 's nachts uit te broeden.
    6. Op de tweede dag, voeg 1 µL van proteïnase K in de reactie en de reactie bij 37 ° C gedurende 30 minuten uit te broeden.
    7. Transformatie uitvoeren Breng de reactie en meng het met 50 µL van Top10 bevoegde E. coli cellen en Incubeer de cellen op het ijs gedurende 30 minuten. Dan, breng de reactiebuis in een waterbad van 42 ° C voor 1 min. onmiddellijk verwijderen van de buis en incubeer op ijs gedurende 2 minuten. Vervolgens zet de buis in een shaker 37 ° C en het Incubeer gedurende 1 uur.
    8. Neem de buis en plaat van de cellen op een bord kanamycine LB. Volgende, Incubeer de plaat 's nachts (16-18 h) bij 37 ° C.
    9. Kies eenpersoons- en goed gescheiden kolonies en enten ze in 14 mL cel cultuur buizen met 3 mL van LB medium. Cultuur ze 's nachts bij 37 ° C in een shaker met een rotatiesnelheid van 250 rpm (rotatie per minuut).
    10. Uitvoeren van miniprep met behulp van een commerciële miniprep kit na de instructie handleiding17.
    11. Volgnummer 3-4 plasmiden met Sanger klonen rangschikken identificeren van positieve pDONR221-ASAP1 met behulp van M13F en M13R sequencing inleidingen.
  2. Maken van de constructie van de Tol2 voor microinjection: pDestTol2 -ubi-ASAP1
    1. Kies dat de volgorde gecontroleerd pDONR221-ASAP1 kloon en maatregel zijn DNA-concentratie met een spectrofotometer volgende de instructie van de software met behulp van water als een blanco controle15.
    2. Neem 100 µg voor pDONR221-ASAP1 en meng het met 100 µg Tol2 kit 5-end plasmide (pENTR5'_ubi, Addgene #27320), 100 µg p3E-polyA (Tol2 kit #302) en 150 µg voor pDestTol2pA2 (Tol2 kit #394). Totale volume aan 8 µL aanpassen met behulp van TE buffer (10 mM Tris, 1 mM EDTA, pH 8,0) in een microcentrifuge van 1,5 mL tube en meng goed door een 2-5 s korte vortex. Dan, voeg 2 µL van LR Clonase II plus, en de reactie bij kamertemperatuur 's nachts uit te broeden.
    3. Op de tweede dag, voeg 1 µL van proteïnase K in de reactie met behulp van een precisiepipet µL 10, en de reactie bij 37 ° C gedurende 30 minuten uit te broeden.
    4. Het uitvoeren van transformatie en identificeren van positieve klonen zoals hierboven (stappen 1.1.7-11) beschreven.
    5. Maatregel de DNA-concentratie van sequencing gecontroleerd pDestTol2-ubi-ASAP1 kloon (figuur 1B) met behulp van een spectrofotometer15. De concentratie is meestal rond de 200ng/µL.

2. Tol2 Transposase mRNA en injectie oplossing voorbereiden

  1. Streak E. coli glycerol voorraad van pCS2FA-transposase plasmide (Tol2 kit #396) op een bord LB (met 100 µg/mL ampicilline) met een gesteriliseerde inoculatie-lus. Incubeer de plaat bij 37 ° C in een broedstoof 's nachts. De volgende dag, kies een één kolonie en het in 3 mL LB (100 µg/mL ampicilline) met behulp van een gesteriliseerde 10 µL pipette uiteinde worden geënt. Cultuur het 's nachts bij 37 ° C in een shaker met een rotatiesnelheid van 250 rpm.
  2. Miniprep op de cultuur van de E. coli met behulp van een commerciële miniprep kit na haar handleiding uitvoeren. Elueer plasmide DNA in 30-50 µL van TE buffer door 1 minuut centrifuge op 14.000 rpm en de concentratie ervan DNA meten met een spectrofotometer.
  3. Linearize 1-2 µg plasmide met niet ik endonuclease en te zuiveren van het DNA met een DNA reinigingsset niet ik de handleiding na vertering. Elueer de DNA in 5 µL van water door centrifugatie bij 14.000 omwentelingen per minuut gedurende 1 minuut. De verwachte concentratie is ongeveer 200-300 ng/µL.
  4. In vitro transcriptie uitvoeren met Not ik gelineariseerde pCS2FA-transposase als een DNA-sjabloon met behulp van een commerciële SP6 transcriptie kit.
  5. Zodra de reactie wordt gebeëindigd, zuiveren Tol2 transposase mRNA met behulp van een commerciële RNA reiniging kit na instructies van de fabrikant. Tenslotte Elueer mRNA in 20 µL van de RNAase-vrij van het water en de concentratie van RNA in een spectrofotometer meten. De verwachte concentratie is ongeveer 1-3 µg / µL. monsters kunnen worden opgeslagen in een vriezer-80 ° C, indien nodig.
  6. Bereid de oplossing van microinjection door het mengen van 20 ng/µL pDestTol2 -ubi-ASAP1 en Tol2 transposase mRNA (100 ng/µL) in een microcentrifuge-buis door pipetteren. Ter voorkoming van aantasting van de nucleic zuur veroorzaakt door herhaalde ontdooien en refreezing, aliquoot 6 µL per buis en opslaan in een vriezer-80 ° C voor toekomstig gebruik.

3. microinjection

  1. Instellen van 4-6 fokken tanks met ten minste 2 reutjes en 2 teefjes de middag vóór injectie. Deze vis moet niet worden gevoed in de middag. Deze stap zal verminderen de hoeveelheid visafval en Bespaar tijd om ze schoon uit de volgende ochtend, terwijl ook het helpen voor het opwekken van een reactie van de fokkerij.
  2. De volgende ochtend Verwijder de oplossing bereid injectie (pDestTol2 -ubi-ASAP1 construct en Tol2 mRNA) uit de diepvries-80 ° C, en plaats deze op het ijs.
  3. Trek de scheidingslijnen in de vis fokken van tanks en laat de vis om te paren. In het algemeen, leggen vis eieren binnen 20-30 minuten na het uittrekken van de scheidslijn. Als niet, 1-2 uur langer wachten. Sommige vissen kunnen niet het leggen van eieren helemaal. In dit geval, herhaal dit experiment voor vis embryo's worden verzameld.
  4. Terwijl we wachten, zorg ervoor dat er naalden bereid met de tip gebroken onder een hoek maken een afgeschuinde rand met een tang, of door te breken op een delicate taak wisser.
    1. Haal de naalden van capillaire glas op een trekker van de micropipet met de volgende parameters: warmte 545; Trek 60; snelheid 80; tijd 250; Druk 500. Breken de naald met pincet onder een dissectie scope (met oog-delige liniaal voor diameter schatting) door de verlostang op een hoek van ongeveer 45 °. Gewenste naald diameters kunnen variabele afhankelijk van de instellingen van de microinjector, maar kleinere diameter is de voorkeur voor het verminderen van embryo sterfte.
  5. Zodra de vis hebben eieren gelegd, verzamelen ze in een 10-cm diameter petrischaal en breng ze naar de dissectie reikwijdte. Verwijder alle abnormale embryo's en vissen afval.
  6. Pipetteer de bevruchte embryo's in de bereide 3% agarose injectie schimmel. Verwijder overtollig water om te helpen bewaren van de embryo's op plaats.
  7. Zodra alle rijen gevuld zijn met levensvatbare embryo's, moet u deze ordenen zodat de afzonderlijke cellen alle geconfronteerd met de dezelfde richting van de naald, die ongeveer een hoek van 45° horizontaal is. Dit zal gemakkelijker injectie veel later.
  8. Terwijl het dragen van handschoenen, gebruik een Pipetteer 20 µL laden uiteinde en 5 µL van de voorbereide constructie verwijderen uit de buis op ijs.
  9. Breng zorgvuldig de tip in de back-end van het gebroken capillair helemaal naar waar het begint te tapper, over het krijgen van het reagens zo dicht mogelijk bij de tip. Als er nog luchtbellen, schud de naald, ervoor zorgend om de tip niet te breken.
  10. Plaats de naald direct in de microinjection naald houder en draai voorzichtig vast totdat de naald op zijn plaats blijft. Aanpassen van de hoek tot ongeveer 45°.
  11. Zodra de naald is opgesteld en aangesloten, zet de Membraanreservoir Microscoop en gas. Commerciële CO2 tanks zijn over het algemeen goed voor dit doel. Het geïnjecteerde volume wordt afgesteld door de holding en uitwerpen druk: geschatte 0.5 psi voor bedrijf en 30 psi voor uitwerpen. Moet u controleren dat de oplossing komt uit bij het indrukken van het pedaal.
  12. Gebruik een micrometer fase met een daling van minerale olie, pas het volume en de stroom van de oplossing voor ~ 150 µm in diameter (ongeveer 2 nL). Zorg ervoor dat de tegendruk een kleine hoeveelheid druppelen laat uit van de naald. Als er niet genoeg tegendruk, zal capillair actie veroorzaken vloeistof om te gaan van de naald en vernietigen de mRNA.
  13. Zodra de naald is gekalibreerd, beginnen de constructie injecteren in een enkele cel van de bevruchte embryo's.
    Opmerking: Dit gaat een grote hoeveelheid van de praktijk, geduld en finesse, als gevolg van de celmembraan wordt hard te doorboren. Het is belangrijk om te injecteren de oplossing in de cel, niet de dooier, voor het genereren van transgene zebrafish. Dit is anders dan morfolino injectie. Het maakt niet uit welke kant de naald treedt de cel zolang de constructie gaat in de cel. De Transgenese heeft een zeer laag tarief van succes als geïnjecteerd in de dooier in plaats van de cel. Eencellige fase injectie is ook belangrijk, of somatische chimera vis zal worden gecreëerd. Dit zal verminderen de kans op de transgenic gaan in de geslachtscellen.
  14. De rand van de inkeping gel gebruiken om een steun die houdt van het embryo in plaats en kan de naald druk uitoefenen zonder te verplaatsen van het embryo. Zodra de punt van de naald in een enkele cel is, druk op de pedaal om de gewenste hoeveelheid oplossing vrij te geven. Herhaal dit proces voor alle van de embryo's.
  15. Wanneer voltooid, overdracht van de geïnjecteerde embryo's in een gelabelde schotel door ze te spoelen uit de agarose inkeping met vis systeem water en een wegwerp 3,4 mL overdracht pipet. De embryo's worden opgeslagen in een incubator 28,5 ° C te laten ontwikkelen. Controleer terug gedurende de dag verwijderen dode vissen embryo's en vervang water met 0,1% methyleenblauw in water van de vis.
  16. Ongeveer 6-8 uur na de injectie, nemen 10 individuele geïnjecteerd vissen van embryo's en bereiden van genomic DNA van hen met behulp van de Hotshot methode18.
  17. De volgende ochtend, gebruik een dissectie Microscoop met een lichtbron van fluorescentie uitzoeken van de embryo's GFP in de weefsels van de niet-dooier tonen. Deze vis embryo's moeten de ingespoten construct bevatten.
  18. Tol2 accijnzen test om te controleren de transposon activiteit zoals eerder beschreven19uit te voeren. Als de verwijderde plasmide kan worden opgespoord, houden de ingespoten vissen van embryo's en hen te verhogen. Als geen verwijderde plasmide kan worden opgespoord, herhaalt u de Tol2 mRNA-synthese en microinjection proces tot het bereiken van de positieve resultaten van de bepaling van de accijnzen Tol2.

4. vaststellen van de transgene ASAP1 vis, GS (ubi: ASAP1)

  1. Verhogen de ingespoten vis (F0 generatie) naar volwassenheid, zoals eerder is beschreven in de zebravis boek20. Dit duurt meestal ongeveer 4 maanden.
  2. Neem een enkele volwassen F0 vis en het Kruis met een honkslag tegenover geslacht wildtype vis. Het verzamelen van vis embryo's na fokken later op de dag. Houd de verzamelde vis embryo's in de incubator 28,5 ° C in vis water met 0,1% methyleenblauw.
  3. Op de derde dag, neem contact op de vis embryo's onder een Microscoop fluorescerende dissectie met een GFP-filter. Groene vis embryo's, uitzoeken, als die er zijn, en hen te verhogen naar volwassenheid als F1 generatie transgene vis, GS (ubi: ASAP1).
    Opmerking: Mendelian verhouding wordt niet verwacht aangezien de meeste van de ouderlijke F0 vis germinale genetische Chimaera.
  4. Kruis één F1 volwassen vis met wildtype vis en vis embryo's te verzamelen. Groene vis embryo's uitzoeken en ze naar volwassenheid als F2 generatie vis te verhogen.
    Opmerking: Groen en niet-groene vis embryo's moeten zijn dicht bij 1:1 als er een enkele transgenic.
  5. Elektrische potentiële om wijzigingen te bekijken in de tumor als maligne perifere zenuw schede tumoren (MPNST), kruis de F2 generatie GS (ubi: ASAP1) vis met rpl35hi258/wt vis. Het is bekend dat zichtbare tumoren beginnen te vinden in de 6-8 maand oud volwassenen21,22.

5. beeldvorming

  1. Beeld van de zebravis embryo's, meerdere F2 generatie oprichter vis en kruis hen met wildtype vis in enkele letterparen. Vis embryo's verzamelen op verschillende gewenste ontwikkelingsstadia volgens de zebravis enscenering gids23.
  2. Voor de vroege stadia van vis embryo's, schil en chorions van de embryo's zorgvuldig met behulp van een paar pincet onder het toepassingsgebied van een dissectie in een 10-cm diameter petrischaal met vis systeem water verwijderen.
  3. Pipetteer een paar vis embryo's op een concaved glasplaatje met 3% methylcellulose met behulp van een precisiepipet 3,4 mL wegwerp overdracht. Aanpassen van de embryo's naar de gewenste posities te bekijken van de cellulaire GFP activiteit met behulp van een naald onder een fluorescente dissectie-scope.
  4. Voor de bewegende fasen van vis gebruiken embryo's (ouder dan 12 Somiet stadium), 0.05% tricaïne mesylaat om te anesthetize de vis embryo's voordat u ze overbrengt op dia's. Kort, vis embryo's waren ontstaan in 0.05% tricaïne mesylaat in vis water totdat ze gestopt met zwemmen en verlies lichaam evenwicht. Ook het toevoegen van een daling van 0,05% tricaïne mesylaat met de methylcellulose op de dia.
  5. Voor minder dan 12 Somiet stadium vis embryo's, gebruik een epi-fluorescentie samengestelde microscoop met een compatibele camera en software voor beeldbewerking. Voor ouder dan 12 Somiet stadium vis-embryo's, gebruikt u een fluorescentie dissectie Microscoop.
  6. Beeld van de tumor cel spanning, eerst het identificeren van de vis met MPNST tumoren. Dan anesthetize de vis met 0,05% tricaïne mesylaat. Voor hele mount imaging, zet u de vis in een 10-cm diameter petrischaal. Als u wilt weergeven van de cel van de elektrische activiteit van tumor, kunnen uit na hele mount imaging vis tumoren worden ontleed.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In een succesvolle injectie, meer dan 50% geïnjecteerd vis embryo's verschijnt een zekere mate van groene fluorescentie in de lichaamscellen, maar de meeste van hen zullen positief door Tol2 transposon accijnzen assay (Figuur 2). Na 2-4 generaties van uitgaande kruis met wildtype vis (totdat de fluorescerende vis 50 procent, de verwachte Mendelian verhouding tot), werden de transgene vis gebruikt voor de beeldvorming experiment om bij te houden van de celmembraan potentieel tijdens de embryonale ontwikkeling. Eerst, membraan potentiële wijzigingen werden onderzocht in de celcyclus tijdens de vroege embryonale ontwikkelingsstadia zebrafish. Er werd opgemerkt dat de cellen hyperpolarized vóór de splitsing furrow formatie (figuur 3A3 c, en aanvullende Video 1). Bovendien toonde verschillende weefsels een verscheidenheid van membraan potentieel in 1-3 daagse oude vis embryo's. (Figuur 3D-3G). Bijvoorbeeld, zijn de somieten en chorda over het algemeen hyperpolarized, ten opzichte van de aangrenzende weefsels/organen. Zodra de zebravis embryo's verplaatsen konden, konden we ook sporen van de neuromusculaire elektrische activiteiten (Figuur 4, aanvullende Video 2). Zoals bioelectrische eigenschappen van kankercellen kunnen worden gewijzigd, we profiteerde van deze ASAP1 verslaggever vis, en stak het met een rpL35 gene mutant, die gevoelig voor spontane maligne perifere zenuw schede tumoren21,24 is ,25. Hoewel slechts een paar vis tumoren werden onderzocht, als gevolg van de lange potentiële groeiperiode voor de vis tumor mutant, was het merkbaar dat er spanning verschillen tussen tumoren en omliggende weefsels in levende tumor-dragende zebrafish (Figuur 5 waren). Dus, deze representatieve resultaten aangetoond de succesvolle generatie van een cellulaire elektrische verslaggever vis lijn, en de potentiële toepassing ervan op de ontwikkelings- en cellulaire biologie.

Figure 1
Figuur 1: Illustratie van de bouw van de plasmide transposon gebaseerde Tol2.
(A) BP recombinatie werd gebruikt voor de ASAP1 sub-kloont in de vector van de middelste post pDONR221. attB sequenties werden toegevoegd aan het 5-einde van de inleidingen voor ASAP1. (B) -Diagram voor het Tol2 transposon gebaseerde construct samenstellen op basis van LR recombinatie. Paarse ovale vorm toont Tol2 ondersteboven wordt herhaald. De stippellijnen homologe recombinatie. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: Typische resultaten van ingespoten embryo's door epifluorescence en Tol2-accijnzen assay.
(A) niet-positieve 1dpf vis embryo. (B) geïnjecteerd met succes 1dpf vis embryo. GFP plekken zijn duidelijk in de kofferbak. (C) niet-positieve 2dpf vis embryo. (D) geïnjecteerd met succes 2dpf vis embryo. GFP plekken zijn duidelijk in de kofferbak. (E) een representatief resultaat van Tol2 accijnzen assay. Lane 1-7-PCR werden versterkt van 7 willekeurig geselecteerd vis embryo's 8 uur na de injectie. De laatste is een negatieve controle (NC) zonder enige genomic DNA. Schaal bar = 250 μm. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: Dynamische spanning verandert tijdens de zebravis embryo-ontwikkeling.
(A-C) Differentiële cellulaire spanning polarity tijdens de mitose in de vis-embryo's. (A) 2-cel fase zebrafish embryo. (B) 4-cel fase embryo. (C) 8-cel fase embryo. De rode pijl hoofden geven de standpunten van de furrows decollete in de panelen (A-C). De veranderingen zijn ook zichtbaar in de bijbehorende film (aanvullende Video 1). De streek rond de splitsing furrow is meer gepolariseerd ten opzichte van de rest van de cel. (D-G) Dynamische elektrische spanning veranderingen in de verschillende vroege stadia van zebravis embryo's. (D) 12-Somiet stadium. (E) 22-Somiet stadium. (F) 48 uur post bevruchting. (G) 72 uur post bevruchting. e, oog; ht, hart; NT, chorda; op, optic vesikel; ov, otic vesikel; pf, pectoral fin; dus, Somiet; yk, dooier. Schaal bar = 250 μm. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4: Elektrische spanning wijzigingen van het lichaam van de vis tijdens vis embryo beweging.
2 - dagen oude vis embryo's Toon de neuro-musculaire elektrische activiteiten tijdens beweging. (A) - (F) sequentiële beeldvorming van de dezelfde vis embryo. Dichtheid kleurwijzigingen zijn betrekking hebben op de elektrische signalering transductie. De intervaltijd tussen twee opeenvolgende beelden is ongeveer 12.4 milliseconden. De rode pijlen geven de posities dat spanning gedurende de beeldvorming veranderd. De veranderingen zijn ook zichtbaar in de bijbehorende film (aanvullende Video 2). Alle panelen zijn in dezelfde schaal. Schaal bar = 250 μm. Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5: De tumorcellen neiging om meer worden gepolariseerd.
Een 10 - maand oude vis (rpL35hi258/wt; GS (ubi: ASAP1) ontwikkelde een maligne perifere zenuw schede gezwel in de buik. (A) & (C) Bright veld afbeelding. (B) en (D) afbeelding met GFP-kanaal. (A) en (B) Intact vis. (C) en (D) buik tumor was ontleed uit. Tumorcellen zijn meer gepolariseerde (helderder groen) in vergelijking met omringende weefsels (donkergroen). Pijlpunten Toon de tumoren. Alle panelen zijn in dezelfde schaal. Schaal bar = 25 mm. Klik hier voor een grotere versie van dit cijfer.

Aanvullende Video 1 . Epifluorescerende beeldvorming van elektrische signalering tijdens decollete stadia in GS (ubi: ASAP1) vis embryo. Deze film is opgenomen van de weergave van dier pole. De fluorescentie van de ASAP1 is gekoppeld aan de vorming van cel decollete furrow, een tijdelijke structuur tijdens de celdeling. Klik hier om dit bestand te downloaden.

Aanvullende Video 2 . Epifluorescerende beeldvorming van elektrische signalering tijdens 2 - dagen oude GS (ubi: ASAP1) vissen embryo beweging. De verhuizing is opgenomen van de laterale weergave van de 2 - dagen oude vis embryo na afstomping. The ASAP1 fluorescentie wijzigingen zijn duidelijk in de neuromusculaire weefsel tijdens de bewegende proces. Klik hier om dit bestand te downloaden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hoewel de cellulaire en weefsel niveau elektrische activiteiten tijdens de embryonale ontwikkeling en ziekten bij de mens lang geleden ontdekt waren, nog de in vivo dynamische elektrische veranderingen en hun biologische rollen grotendeels onbekend. Een van de grootste uitdagingen is het visualiseren en kwantificeren van de elektrische veranderingen. Patch-clamp-technologie is een doorbraak voor het bijhouden van afzonderlijke cellen, maar de toepassing ervan op gewervelde embryo's is beperkt, omdat ze samengesteld uit vele cellen zijn. De huidige chemische spanning kleurstoffen zijn ook niet ideaal vanwege hun gevoeligheden, specifieke kenmerken en toxicities. De recente inspanningen op de uitvinding van GEVIs bieden ons een nieuw pad om te visualiseren cellulaire elektrische activiteiten in vivo en in real time. Hier toonden wij het proces van het creëren van een zebravis elektrische verslaggever lijn, GS (ubi:ASAP1).

Met behulp van deze verslaggever vis lijn, laten we zien cellulaire elektrische activiteiten die kunnen worden gecontroleerd in zebrafish embryo's. De verandering van de elektrische spanning is sterk gerelateerd aan de celcyclus tijdens de vroege embryonale ontwikkeling. Wij hebben geconstateerd dat hyperpolarisatie gebeurt vóór de vorming van het decolleté furrow/celdeling (Figuur 3). Dit is in tegenstelling tot de huidige kennis dat depolarisatie gebeurt voordat celdeling26. Dus, meer details van de celmembraan spanning verandert tijdens de cyclus van de cel van de andere dierlijke en menselijke cellen, en of dit is gerelateerd aan weefsel context, nader onderzoeken. Verwante studies zijn momenteel aan de gang in ons laboratorium. Bovendien hebben we vastgesteld dat ASAP1 vermag fysiologische spanning wijzigingen bijhouden in het neurale-musculaire systeem (Figuur 4), waarin de wijziging relatief snel vergeleken met de wijzigingen gedurende cel cycli is.

Het werd ook aangetoond dat deze verslaggever kan ook worden gebruikt om te visualiseren zebrafish tumoren (Figuur 5). Het was interessant om te vinden van tumor cellen waren over het algemeen meer gepolariseerd ten opzichte van het omliggende normale weefsel. Of dit een algemeen verschijnsel voor alle kwaadaardige weefsels is vereist echter verder onderzoek, als gevolg van de beperking van de tumor monsters en tumor vissoorten in deze studie. Toekomstige onderzoeken op celmembraan polarisatie en spanning kwantificering op andere soorten tumoren en menselijke kankercellen zullen informatief voor beter inzicht in de rollen tijdens tumorvorming.

In dit protocol kozen we een alomtegenwoordige promotor te rijden ASAP1 expressie voor het bijhouden van alle cellen in vis embryo's. Weefsel of orgaan-specifieke initiatiefnemers zou kunnen een andere optie zijn als alleen de voorkeur wordt gegeven aan een bepaalde cel/weefseltype. De ASAP1 voltage sensor is een relatief goed gekarakteriseerd biosensor, en het is samengesteld uit een spanning gevoelige domein van zee squirt spanning-gevoelige fosfatase (S3-S4 lus) en een circulaire permutatie van GFP (standaard is lage fluorescentie). Het was gemeld moet worden uitgedrukt op het membraan buiten cellulaire in menselijke neuron cellen en muis hersenen segmenten4,27,28. De helderheid van de sensor is dominant bepaald door de conformationele standpunten van de S3-S4 lus en GFP. De snelle groene fluorescentie verandering was waarschijnlijk niet veroorzaakt door de eiwitconcentratie, als gevolg van de snelheid van de veranderingen van de helderheid en de eiwitsynthese. Echter kan de transgenic, ASAP1, hebben gewijzigd expressie in tumorcellen, vanwege de aard van de instabiliteit van het genoom. Naast ASAP1 kunnen andere GEVIs, zoals archaerhodopsin gebaseerde spanningsindicatoren (QuasAr1 en QuasAr2), ook een goede aanvullende optie, aangezien zij een volledig ander mechanisme gebruiken en ze ook hebben een hoge gevoeligheid en snelheid van 29. Bovendien is hun emissie in het rode kleurbereik. Dit maakt ze bijzonder gratis naar de groene ASAP1, als er al een ander TL eiwit in dezelfde cel. Bijvoorbeeld, kunnen ASAP1 en QuasAr worden gecombineerd met Fucci zebrafish30 voor de studie van de relatie tussen celcyclus en de elektrische potentiële veranderingen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Het onderzoekswerk gemeld in deze publicatie werd gesteund door de National Institute of General Medical Sciences van de National Institutes of Health onder de Award nummer R35GM124913, Purdue University PI4D incentive programma en PVM interne concurrerende Basisonderzoek fondsen programma. De inhoud is uitsluitend de verantwoordelijkheid van de auteurs en vertegenwoordigt niet noodzakelijk de officiële standpunten van de financiering agenten. Wij danken Koichi Kawakami voor de Tol2 constructie, Michael Lin voor constructie voor de ASAP1 en Leonard Zon voor de ubi -promotor bouwen via Addgene.

Materials

Name Company Catalog Number Comments
14mL cell culture tubes VWR 60818-725 E.Coli culture
Agarose electrophoresis tank Thermo Scientific Owl B2 DNA eletrophoresis
Agarose RA Amresco N605-500G For making the injection gels
Attb1-ASAP1-F primer IDT DNA GGGGACAAGTTTGTACAAAAAA
GCAGGCTTCACCATGGAGACGA
CTGTGAGGTATGAACA
ASAP1 coding region amplification for subcloning
Attb2-ASAP1-R primer IDT DNA GGGGACCACTTTGTACAAGAAA
GCTGGGTCTTAGGTTACCACTTC
AAGTTGTTTCTTCTGTGAAGCCA
ASAP1 coding region amplification for subcloning
Bright field dissection scope Nikon SMZ 745 Dechorionation, microinjection, mounting
Color camera Zeiss AxioCam MRc Fish embryo image recording
Concave slide VWR 48336-001 For holding fish embryos during imaging process
Disposable transfer pipette 3.4 ml Thermo Scientific 13-711-9AM Fish embryos and water transfer
Endonuclease enzyme, Not I NEB R0189L For linearizing plasmid DNA
Epifuorescent compound scope Zeiss Axio Imager.A2 Fish embryo imaging
Epifuorescent stereo dissection scope Zeiss Stereo Discovery.V12 Fish embryo imaging
Fluorescent light source Lumen dynamics X-cite seris 120 Light source for fluorescence microscopes
Forceps #5 WPI 500342 Dechorionation and needle breaking
Gateway BP Clonase II Enzyme mix Thermo Scientific 11789020 Gateway BP recombination cloning
Gateway LR Clonase II Plus enzyme Thermo Scientific 12538120 Gateway LR recombination cloning
Gel DNA Recovery Kit Zymo Research D4002 DNA gel purification
Loading tip Eppendorf 930001007 For loading injection solution into capilary needles
Methylcellulose (1600cPs) Alfa Aesar 43146 Fish embryo mounting
Methylene blue Sigma-Aldrich M9140 Suppresses fungal outbreaks in Petri dishes
Microinjection mold Adaptive Science Tools TU-1 To prepare agaorse mold tray for holding fish embryos during injection
Microinjector WPI Pneumatic Picopump PV820 Microinjection injector
Micro-manipulator WPI Microinjector MM3301R Microinjection operation
Micropipette puller Sutter instrument P-1000 For preparing capillary needle
Mineral oil Amresco J217-500ml For calibrating injection volume
mMESSAGE mMACHINE SP6 Transcription Kit Thermo Scientific AM1340 mRNA in vitro transcription
Monocolor camera Zeiss AxioCam MRm Fish embryo image recording
Plasmid Miniprep Kit Zymo Research D4020 Prepare small amount of plasmid DNA
Plastic Petri dishes VWR 25384-088 For holding fish or fish embryos during imaging process
RNA Clean & Concentrator-5 Zymo Research R1015 mRNA cleaning after in vitro transcription
Spectrophotometer Thermo Scientific NanoDrop 2000 For measuring DNA and RNA concentrations
Stage Micrometer Am Scope MR100 Microinjection volume calibration
Thermocycler Bio-Rad T100 DNA amplification for gene cloning
Thin wall glass capillaries WPI TW100F-4 Raw glass for making cappilary needle
Tol2-exL1 primer IDT DNA GCACAACACCAGAAATGCCCTC Tol2 excise assay
Tol2-exR primer IDT DNA ACCCTCACTAAAGGGAACAAAAG Tol2 excise assay
TOP10 Chemically Competent E. coli Thermo Scientific C404006 Used for transformation during gene cloning
Tricaine mesylate Sigma-Aldrich A5040 For anesthetizing fish or fish embryos
UV trans-illuminator 302nm UVP M-20V DNA visualization
Water bath Thermo Scientific 2853 For transformation process of gene cloning

DOWNLOAD MATERIALS LIST

References

  1. Levin, M. Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo. Molecular Biology of the Cell. 25, (24), 3835-3850 (2014).
  2. Storace, D., et al. Toward Better Genetically Encoded Sensors of Membrane Potential. Trends in Neuroscience. 39, (5), 277-289 (2016).
  3. Inagaki, S., Nagai, T. Current progress in genetically encoded voltage indicators for neural activity recording. Current Opinion in Chemical Biology. 33, 95-100 (2016).
  4. St-Pierre, F., et al. High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor. Nature Neuroscience. 17, (6), 884-889 (2014).
  5. Lieschke, G. J., Currie, P. D. Animal models of human disease: zebrafish swim into view. Nature Reviews Genetics. 8, (5), 353-367 (2007).
  6. Santoriello, C., Zon, L. I. Hooked! Modeling human disease in zebrafish. Journal of Clinical Investigation. 122, (7), 2337-2343 (2012).
  7. Howe, K., et al. The zebrafish reference genome sequence and its relationship to the human genome. Nature. (2013).
  8. Kawakami, K., Shima, A., Kawakami, N. Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proceedings of the National Academy of Science USA. 97, (21), 11403-11408 (2000).
  9. Urasaki, A., Asakawa, K., Kawakami, K. Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish. Proceedings of the National Academy of Science USA. 105, (50), 19827-19832 (2008).
  10. Kwan, K. M., et al. The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs. Developmental Dynamics. 236, (11), 3088-3099 (2007).
  11. Mosimann, C., et al. Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish. Development. 138, (1), 169-177 (2011).
  12. Lorenz, T. C. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies. Journal of Visualized Experiments. (63), e3998 (2012).
  13. Ordovas, J. M. Separation of small-size DNA fragments using agarose gel electrophoresis. Methods in Molecular Biology. 110, 35-42 (1998).
  14. Downey, N. Extraction of DNA from agarose gels. Methods Mol Biol. 235, 137-139 (2003).
  15. Desjardins, P., Conklin, D. NanoDrop microvolume quantitation of nucleic acids. Journal of Visualized Experiments. 45, (45), (2010).
  16. Green, M. R., Sambrook, J. Molecular cloning : a laboratory manual. Cold Spring Harbor Laboratory Press. (2012).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247 (2007).
  18. Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. Method for isolation of PCR-ready genomic DNA from zebrafish tissues. Biotechniques. 43, (5), 610, 612, 614 (2007).
  19. Kawakami, K., Koga, A., Hori, H., Shima, A. Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio. Gene. 225, (1-2), 17-22 (1998).
  20. Westerfield, M. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). 4th edn, Univ. of Oregon Press. (2000).
  21. Amsterdam, A., et al. Many ribosomal protein genes are cancer genes in zebrafish. PLoS Biology. 2, (5), E139 (2004).
  22. Lai, K., et al. Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish. Developmental Dynamics. 238, (1), 76-85 (2009).
  23. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. Stages of embryonic development of the zebrafish. Developmental Dynamics. 203, (3), 253-310 (1995).
  24. Zhang, G., et al. Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery. PLoS Genetics. 9, (8), e1003734 (2013).
  25. Zhang, G., et al. Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers. Proceedings of the National Academy of Science USA. 107, (39), 16940-16945 (2010).
  26. Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. Potassium channels in cell cycle and cell proliferation. Philosophical Transactions of the Royal Society of London Series B. 369, (1638), 20130094 (2014).
  27. Yang, H. H., et al. Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo. Cell. 166, (1), 245-257 (2016).
  28. Chamberland, S., et al. Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators. Elife. 6, (2017).
  29. Hochbaum, D. R., et al. All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins. Nature Methods. 11, (8), 825-833 (2014).
  30. Sugiyama, M., et al. Illuminating cell-cycle progression in the developing zebrafish embryo. Proceedings of the National Academy of Science USA. 106, (49), 20812-20817 (2009).
Visualisatie van cellulaire elektrische activiteit in de zebravis vroege embryo's en tumoren
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Silic, M. R., Zhang, G. Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors. J. Vis. Exp. (134), e57330, doi:10.3791/57330 (2018).More

Silic, M. R., Zhang, G. Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors. J. Vis. Exp. (134), e57330, doi:10.3791/57330 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter