A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Modifying Baculovirus Expression Vectors to Produce Secreted Plant Proteins in Insect Cells

11.6K views

DOI:

10.3791/58283

August 20th, 2018

In This Article

Summary

Here, we present the protocols for utilizing the insect cell and baculovirus protein expression system to produce large quantities of plant secreted proteins for protein crystallization. A baculovirus expression vector has been modified with either GP67 or insect hemolin signal peptide for plant protein secretion expression in insect cells.

Abstract

It has been a challenge for scientists to express recombinant secretory eukaryotic proteins for structural and biochemical studies. The baculovirus-mediated insect cell expression system is one of the systems used to express recombinant eukaryotic secretory proteins with some post-translational modifications. The secretory proteins need to be routed through the secretory pathways for protein glycosylation, disulfide bonds formation, and other post-translational modifications. To improve the existing insect cell expression of secretory plant proteins, a baculovirus expression vector is modified by the addition of either a GP67 or a hemolin signal peptide sequence between the promoter and multiple-cloning sites. This newly designed modified vector system successfully produced a high yield of soluble recombinant secreted plant receptor proteins of Arabidopsis thaliana. Two of the expressed plant proteins, the extracellular domains of Arabidopsis TDR and PRK3 plasma membrane receptors, were crystallized for X-ray crystallographic studies. The modified vector system is an improved tool that can potentially be used for the expression of recombinant secretory proteins in the animal kingdom as well.

Introduction

It is imperative for a research laboratory to be capable of producing large quantities of homogeneous recombinant proteins for biochemical and biophysical characterizations, especially for X-ray crystallographic studies. There are many well-established heterologous expression systems such as Escherichia coli, yeast, insect cells, mammalian cells, plant cells, etc. Among them, the baculovirus-mediated insect cell expression system is one of the most commonly used techniques to produce large quantities of structurally folded large-sized recombinant eukaryotic proteins for protein crystallization1.

The expression vectors of the baculovirus expression system are engineered to contain a strong polyhedrin or P10 promoter to produce a high yield of recombinant intracellular proteins2,3. To make a recombinant baculovirus, the gene of interest is cloned into an insect vector containing the polyhedrin (polh) locus of the Autographa californica multi-nucleopolyhedroviral genome. The resulting construct is then sequenced and its correct open reading frame (ORF) is verified. The correct construct is then introduced into the host insect cell through the process of transfection. The gene of interest is inserted into the viral genome by homologous recombination. This event results in the production of the recombinant viral genome, which then replicates to produce recombinant budded virus particles1.

The insect cells that are most commonly used in the expression system are Sf9 and High Five (Hi5) cells. Sf9 cells are a clonal isolate of Sf21, derived from the pupal ovarian cells of Spodoptera frugiperda, and Hi5 cells are a clonal isolate derived from the parental Trichoplusia ni ovarian cell line TN-3684,5. Co-transfections, virus amplification, and plaque assays are conducted on Sf9 cells, while Hi5 cells are typically selected to produce higher quantities of recombinant proteins6. It is worth noting that the Hi5 cells are not suitable for the generation and amplification of virus progenies because of their tendency to produce mutant viruses. Traditionally, a temperature range of 25 - 30 °C is considered to be good for the cultivation of insect cells. However, it has been reported that 27 - 28 °C is the optimal temperature for the insect cell growth and infection7,8.

The introduction of a strong signal sequence preceding the gene is needed for the high expression of the secreted proteins. The signal sequence would efficiently guide the translated recombinant protein into the endoplasmic reticulum for protein secretion and post-translational modifications necessary for proper folding and stabilization3. Signal peptide sequences, such as the baculovirus envelop protein GP64/67, honeybee melittin, and others, have been chosen to facilitate the expression of secretory recombinant proteins in the baculovirus-mediated expression systems3. The introduction of the signal peptide of GP67 has been shown to improve the expression yield of a secreted recombinant protein, in comparison to using the intrinsic signal peptide of the target gene9. Hemolin is a hemolymph protein of the giant silk moth Hyalophora cecropia, induced upon bacteria infection10. Due to the relatively high level of induced expression, the signal peptide sequence of the gene can be used to mediate the secretion expression of the recombinant proteins in the baculovirus-insect cell system.

The A. thaliana Tracheary Element Differentiation Inhibitory Factor Receptor (TDR) and Pollen Receptor Kinase 3 (PRK3) both belong to the plant Leucine-rich Repeat Receptor-like Kinase (LRR-RLK) family of proteins11,12. In order to study the structure and function of this family of plant receptor proteins, as well as to facilitate the structural and biochemical characterization of other plant secreted proteins, the baculovirus-insect cell expression system has been modified to improve protein quality and production yield. The extracellular domains of both TDR and PRK3 have successfully been expressed using two modified expression vectors in the baculovirus-insect cell expression system. Both the extracellular domains of TDR and PRK3 proteins have been crystallized. This article reports the expression and purification of large amounts of recombinant secreted plant proteins with two modified baculovirus expression vectors by incorporating either a GP67 or a hemolin signal sequence between the promoter and multiple cloning sites.

Access restricted. Please log in or start a trial to view this content.

Protocol

NOTE: An insect cell/baculovirus system with modified expression vectors for secretory plant protein expression and crystallization is used.

1. Modification of a Baculovirus Expression Vector with the GP67 Signal Peptide for Plant Protein Secretion Expression

  1. Synthesize a DNA fragment containing a 5' BglII cutting site13, the GP67 secretion signal sequence, and a multi-cloning site with NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI, and XhoI (Figure 1A).
    NOTE: Since both BglII and BamHI digested DNA resulted in the same adhesive ends, the linearized vector can ligate to the digested DNA fragment while both the BglII and BamHI sites in the annealed ligation sequence will be mutated to a sequence that is not cleavable by either BglII or BamHI14.
  2. Digest 4 µg of the DNA with BglII and XhoI, and 4 µg of an expression vector DNA with BamHI and XhoI14. Mix 10 units of each restriction enzyme with the DNA in a 1x concentration reaction buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, and 100 µg/mL BSA, pH 7.9 at 25 °C) and incubate the mixture at 37 °C for 4 h.
    1. Purify the excised DNA fragment and the linearized vector DNA by a DNA gel extraction kit15.
  3. Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-µL ligation reaction mixture containing 1x T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, and 10 mM DTT, pH 7.5 at 25 °C) and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 °C for 16 h.
  4. Transform 5 µL of the ligation mixture into 100 µL of DH5α competent cells following a standard transformation protocol and select the resulting colonies on an ampicillin-LB agar plate16. Pick up 5 - 10 colonies and grow each colony in 2 mL of LB medium containing 100 µg/mL ampicillin at 220 rpm and 37 °C in a shaking incubator for 16 h.
  5. Extract each plasmid DNA with a DNA miniprep kit17 and confirm the clones by DNA sequencing with a primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-amplify the A. thaliana TDR gene fragment encoding residues 30 - 642 from a synthetic TDR gene construct (forward primer: CATG GCGGCCGC CTCAAGTTTTCACCTCAACTCTTGTC, reverse primer: GC GGATCC CTA GTG GTG ATG GTG GTG GTG ACCGTCTATATCTGCATTTCCGGC). Amplify the DNA for 30 cycles in a DNA polymerase reaction buffer containing a 0.5 mM dNTP mix, 0.2 µM primers, 0.1 µg of template DNA, 0.4 mM MgCl2, and 1 reaction unit of the DNA polymerase.
    1. For the PCR cycle steps, set the initial denaturation at 95 °C for 30 s, and then 30 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 1 min, with a final extension at 72 °C for 5 min.
  7. Digest both the PCR fragment and the modified vector with NotI and BamHI restriction endonuclease enzymes. Ligate the gene fragment with the linearized vector. Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-µL ligation reaction mixture containing T4 DNA ligase reaction buffer and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 °C for 16 h.
  8. Transform 5 µL of the ligation mixture into 100 µL of DH5α competent cells following a standard transformation protocol and select the resulting colonies on an ampicillin-LB agar plate16. Confirm the correct clones by DNA sequencing.

2. Modification of a Baculovirus Expression Vector with the Insect Hemolin Signal Peptide for Plant Protein Secretion Expression

  1. Synthesize a DNA fragment containing a 5' BglII cutting site13, the insect hemolin secretion signal sequence, and a multi-cloning site with NotI, BamHI, EcoRI, StuI, SalI, SpeI, XbaI, PstI, and XhoI (Figure 1B).
  2. Digest 4 µg of the DNA with BglII and XhoI, and 4 µg of an expression vector DNA with BamHI and XhoI14. Mix 10 units of each restriction enzyme with the DNA in a 1x concentration reaction buffer (50 mM potassium acetate, 20 mM Tris-acetate, 10 mM magnesium acetate, and 100 µg/mL BSA, pH 7.9 at 25 °C) and incubate the mixture at 37 °C for 4 h.
    1. Purify the excised DNA fragment and the linearized vector DNA by a DNA gel extraction kit15.
  3. Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-µL ligation reaction mixture containing 1x T4 DNA ligase reaction buffer (50 mM Tris-HCl, 10 mM MgCl2, 1 mM ATP, and 10 mM DTT, pH 7.5 at 25 °C) and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 °C for 16 h.
  4. Transform 5 µL of the ligation mixture into 100 µL of DH5α competent cells and select the colonies on an ampicillin-LB agar plate. Pick up 5 - 10 colonies and grow each colony in a 2-mL LB medium containing 100 µg/mL of ampicillin at 220 rpm and 37 °C in a shaking incubator for 16 h.
  5. Extract plasmid DNA with a DNA miniprep kit17 and confirm the clones by DNA sequencing with a primer AGTATTTTACTGTTTTCGTAACAG.
  6. PCR-amplify A. thaliana Pollen Receptor Kinase 3 (PRK3) gene fragment encoding residues 20 - 237 from a synthetic PRK3 gene construct (forward primer: CATG GCGGCCGC CTACAAAACGTTAGTGAATCGGAACC, reverse primer: CGC GGATCC CTA GTG GTG ATG GTG GTG GTG TGAAGGTTTCTCATCGCATTCTATATTC). Amplify the DNA for 30 cycles in a DNA polymerase reaction buffer containing a 0.5 mM dNTP mix, 0.2 µM primers, 0.1 µg of template DNA, 0.4 mM MgCl2, and 1 reaction unit of the DNA polymerase.
    1. For the PCR cycle steps, set the initial denaturation at 95 °C for 30 s, and then 30 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s within each cycle, and the final extension at 72 °C for 5 min.
  7. Digest both the PCR fragment and the modified vector with NotI and BamHI restriction endonuclease enzymes. Ligate the gene fragment with the linearized vector. Mix 100 ng of the linearized vector DNA with 400 ng of the digested DNA fragment in a 10-µL ligation reaction mixture containing T4 DNA ligase reaction buffer and 5 units of T4 DNA ligase. Incubate the reaction mixture at 16 °C for 16 h.
  8. Transform 5 µL of the ligation mixture into 100 µL of DH5α competent cells following a standard transformation protocol and select the resulting colonies on an ampicillin-LB agar plate16. Confirm the correct clones by DNA sequencing.

3. Production and Amplification of Baculovirus Constructs Harboring the Recombinant Protein Expression Cassette

  1. Use 100 ng of the construct plasmid to transform 40 µL of DH10Bac competent cells following the protocol of the baculovirus expression system1. Incubate the transformation plates at 37 °C for 48 h.
  2. Pick up two white colonies from each transformation plate, inoculate each colony into 2 mL of LB medium containing 50 µg/mL kanamycin, 7 µg/mL gentamicin, and 10 µg/mL tetracycline. Follow the protocol of the baculovirus expression system1 to extract and verify the bacmid DNA. Aliquot each DNA in two tubes with 20 µL each, and store the tubes at -20 °C.
    NOTE: The following steps require an aseptic operation.
  3. Grow a monolayer of Sf9 cells in the culture media with 10% fetal bovine serum (FBS) and 100 µg/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics at 27 °C to 80% confluence in a 6-well plate. Estimate the percentage of confluence based on the percentage of covered area on the tissue culture plate.
  4. Prepare the following solutions in two sterile 1.5-mL centrifuge tubes.
    1. Tube 1: For each transfection, dilute 20 µL of bacmid DNA into 100 µL of unsupplemented Sf9 cell culture medium without antibiotics. Mix the dilution gently by flicking the side of the tube.
    2. Tube 2: For each transfection, dilute 8 µL of lipid transfection reagent into 100 µL of unsupplemented Sf9 cell culture medium without antibiotics. Mix the dilution thoroughly by pipetting up and down for 6x.
  5. Combine the two solutions, mix them gently by pipetting slowly up and down for 3x, and incubate them for 20 - 40 min at room temperature.
  6. Wash each well of the Sf9 monolayer cells 2x with 3 mL of unsupplemented Sf9 cell culture medium without antibiotics. For each transfection, add 0.8 mL of unsupplemented Sf9 cell culture medium without antibiotics to each tube containing the lipid-DNA mixture. Mix the contents of the tubes gently by pipetting slowly up and down for 3x. Aspirate the wash media from the plates and overlay the samples with the transfection mixture.
  7. After the addition of the transfection mixture, incubate the transfected plate for 5 h at 27 °C. Replace the transfection media with the complete Sf9 cell culture medium containing 10% FBS and 100 µg/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics. Incubate the transfected plate at 27 °C for 4 d.
  8. Harvest and amplify the recombinant baculovirus.
    1. Collect the supernatant of the infected plate in a sterile 15-mL conical tube after 4 d of incubation. Spin the supernatant at 1010 x g for 5 min to remove the cell debris. Discard the pellet and decant the supernatant to a clean tube and store it at 4 °C for up to 1 year.
      NOTE: This is the P0 virus. It can be aliquoted and stored at -80 °C for a longer period of time.
    2. To amplify each recombinant virus, grow a monolayer of Sf9 cells on a 150-mm plate to 80% confluence. Aspirate the media from the plate, add 2 mL of the P0 virus to the cells adherent to the plate and incubate the plate for 1 h in a 27 °C incubator. Rock the plate every 15 min to mix the medium with the cells.
      1. Add 25 mL of complete Grace's media containing 10% FBS and 100 µg/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics. Incubate the plate for 3 d in a 27 °C incubator to obtain the P1 passage virus.
    3. Collect the supernatant of the infected plate in a sterile 50-mL conical tube and spin at 1010 x g for 5 min to remove the cell debris. Decant the supernatant to a clean tube and store it at 4 °C for up to 1 year.
      NOTE: The P1 virus can be aliquoted and stored at -80 °C for a longer period of time.
    4. To amplify the virus from P1 to P2 passage, grow a monolayer of Sf9 cells on a 150-mm plate to 90% confluence, aspirate the media of the plate, add 2 mL of the P1 virus to the plate, and incubate it for 1 h in a 27 °C incubator.
    5. Repeat steps 3.8.2 and 3.8.3 to obtain the P2 and P3 passages of the viruses. Do not store the P3 virus for more than 2 months.

4. Protein Expression, Purification with NiNTA, and Crystallization

  1. Culture 1 L of Hi5 insect cells in the culture media with 100 µg/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics to a density of 2 x 106 at 100 rpm in a 27 °C incubator shaker. Spin down the cells at 570 x g for 5 min, decant the supernatant, resuspend the cells in 20 mL of the freshly produced P3 virus, and keep it at room temperature for 1 h. Gently shake the spin bottle to resuspend the cells 1x every 15 min.
  2. Transfer the cells to 1 L of culture media with 100 µg/mL (or 100 I.U./mL) penicillin-streptomycin antibiotics, culture the cells at 100 rpm in a 27 °C incubator shaker for 72 h. Spin down the cells at 1,010 x g for 5 min and collect the supernatant.
  3. Use pH indicator strips to adjust the pH of the supernatant to 8.0 by adding either 0.1 M HCl or 0.1 M NaOH and add binding buffer at a final concentration, containing 20 mM Tris buffer at pH 8.0, 100 mM NaCl, and 5 mM imidazole. Add a certain amount of NiNTA resin (10 - 40 mL) based on the estimated yield of the expressed His-tagged recombinant protein.
    1. Mix the solution on a magnetic stir with low speed at 4 °C for 1 h. Wash the resin and elute the bound protein following the standard NiNTA purification protocol18.
  4. Subject the purified protein to ion exchange and gel filtration chromatography, as well as other protein purification methods, to yield a homogeneous sample.
    NOTE: For the TDR ectodomain, 20 mM Tris, pH 8, 100 mM NaCl were used as gel filtration buffer. For the PRK3 ectodomain, 20 mM bis-Tris, pH 6, 100 mM NaCl were used as the preferred gel filtration buffer.

Access restricted. Please log in or start a trial to view this content.

Results

As shown in Figure 1, two modified pFastBac1 baculovirus expression vectors were used to express the secreted proteins with either the GP67 or the hemolin signal sequence to replace the intrinsic signal sequence of the target gene. The viral GP67 and the insect hemolin genes have been demonstrated to have high secretion expression levels in the cells. Fusion proteins with either of these two signal sequences are expected to have greatly improved secretion exp...

Access restricted. Please log in or start a trial to view this content.

Discussion

Given the diversity in size and stability of the thousands of proteins present in the biological systems, it is often empirical for a research laboratory to decide which heterologous expression system has to be chosen for the expression of a specific protein. The E. coli expression system is often the first choice for protein expression due to the short life cycle of the bacteria, low cost of the culture media, and relative ease to scale up19. For the expression of large eukaryotic protei...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose.

Acknowledgements

This work was supported by the new faculty startup funds from North Carolina State University for Guozhou Xu.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Incubator shakerVWRModel Excella E2527 oC
IncubatorVWRModel 200527 oC
CentrifugeBECKMANModel J-6with a swing bucket rotor
Herculase II Fusion DNA PolymeraseAgilent600677-51For PCR amplification of DNA
Thermal CyclerBIO-RADModel C1000 TouchFor PCR amplification of DNA
Incubator shakerNew Brunswick ScientificModel I 24For growing baceria culture
Customer DNA synthesisGENSCRIPT
BamHI (HF)New England BiolabsR3136SRestriction Endonuclease
BglIINew England BiolabsR0144SRestriction Endonuclease
NotI (HF)New England BiolabsR3189SRestriction Endonuclease
XhoINew England BiolabsR0146SRestriction Endonuclease
T4 DNA ligaseNew England BiolabsM0202TDNA ligation
QIAquick Gel Extraction KitQiagen28704DNA purification from Agorase gel
QIAprep Spin Miniprep KitQiagen27104Plasmid DNA purification from bacteria culture
AgaroseThermo Fisher Scientific15510-019For DNA gel electropherosis
MAX Efficiency DH5α competen cellInvitrogen18-258-012For transformation of DNA ligation mixture
Lennox L LB BrothResearch Product International Corp.L24066-5000.0For making bacteria culture
Ampicillin sodium saltThermo Fisher Scientific11593-019Antibiotics
Kanamycin SulfateThermo Fisher Scientific15160-054Antibiotics
TetracyclineThermo Fisher Scientific64-75-5Antibiotics
GentamicinThermo Fisher Scientific15710-064Antibiotics
MAX Efficiency DH10Bac competent cellsThermo Fisher Scientific10361-012For making bacmid DNA
S.O.C. MediumThermo Fisher Scientific15544-034For DNA transformation
CellFECTIN II ReagentThermo Fisher Scientific10362-101Insect cell transfection reagent
Bac-to-Bac Expression SystemThermo Fisher Scientific10359-016Baculovirus-insect cells expression kit
Bluo-galThermo Fisher Scientific15519-028For isolation of recominant Bacmid DNA
IPTGThermo Fisher Scientific15529-019For isolation of recominant Bacmid DNA
pFastBac1Thermo Fisher Scientific10360014Baculorirus expression vector
Sf9 cellsThermo Fisher Scientific11496015Sf9 monolayer cells
Hi5 cellsThermo Fisher ScientificB85502High Five insect cells
Grace’s insect medium, unsupplementedThermo Fisher Scientific11595030Sf9 cell transfection minimum medium
Grace’s insect medium, supplementedThermo Fisher Scientific11605102Sf9 monolayer cell culture complete medium
Sf-900 II SFMThermo Fisher Scientific10902104Sf9 suspension cell culture medium without FBS
Express Five SFMThermo Fisher Scientific10486025Hi5 cell culture medium
Penicillin-StreptomycinThermo Fisher Scientific15140122100 ml (10,000 I.U./ml)
L-Glutamine (200 mM)Thermo Fisher Scientific25030081100 ml
FBS CertifiedThermo Fisher Scientific16000-044500 ml
6-well platesThermo Fisher Scientific08-772-1BFlat-bottom
150 mm platesThermo Fisher Scientific353025100/case
1.5 ml Microcentrifuge TubesUSA Scientific1415-2500500 tubes/bag
15 ml conical screw cap centrifuge tubesUSA Scientific1475-051125 tubes/bag
50 ml conical screw cap centrifuge tubesUSA Scientific1500-121125 tubes/bag
Ni-NTA SuperflowQiagen30430NiNTA resin
pH-indicator stripsEMD Millipore Corporation1.09535.0001pH 0 - 14

References

  1. Contreras-Gomez, A., Sanchez-Miron, A., Garcia-Camacho, F., Molina-Grima, E., Chisti, Y. Protein production using the baculovirus-insect cell expression system. Biotechnology Progress. 30, 1-18 (2014).
  2. Khan, S., Ng, M. L., Tan, Y. J. Expression of the severe acute respiratory syndrome coronavirus 3a protein and the assembly of coronavirus-like particles in the baculovirus expression system. Methods in Molecular Biology. 379, 35-50 (2007).
  3. Possee, R. D., King, L. A. Baculovirus Transfer Vectors. Methods in Molecular Biology. 1350, 51-71 (2016).
  4. Vaughn, J. L., Goodwin, R. H., Tompkins, G. J., McCawley, P. The establishment of two cell lines from the insect Spodoptera frugiperda (Lepidoptera; Noctuidae). In Vitro. 13, 213-217 (1977).
  5. Hink, W. F. Established insect cell line from the cabbage looper, Trichoplusia ni. Nature. 226, 466-467 (1970).
  6. Davis, T. R., et al. Comparative recombinant protein production of eight insect cell lines. In Vitro Cellular & Development Biology - Animal. 29A, 388-390 (1993).
  7. Wickham, T. J., Nemerow, G. R. Optimization of growth methods and recombinant protein production in BTI-Tn-5B1-4 insect cells using the baculovirus expression system. Biotechnology Progress. 9, 25-30 (1993).
  8. Davis, T. R., Trotter, K. M., Granados, R. R., Wood, H. A. Baculovirus expression of alkaline phosphatase as a reporter gene for evaluation of production, glycosylation and secretion. Nature Biotechnology. 10, 1148-1150 (1992).
  9. Murphy, C. I., et al. Enhanced expression, secretion, and large-scale purification of recombinant HIV-1 gp120 in insect cell using the baculovirus egt and p67 signal peptides. Protein Expression and Purification. 4, 349-357 (1993).
  10. Sun, S. C., Lindstrom, I., Boman, H. G., Faye, I., Schmidt, O. Hemolin: an insect-immune protein belonging to the immunoglobulin superfamily. Science. 250, 1729-1732 (1990).
  11. Li, Z., Chakraborty, S., Xu, G. Differential CLE peptide perception by plant receptors implicated from structural and functional analyses of TDIF-TDR interactions. PLoS One. 12, e0175317(2017).
  12. Chakraborty, S., Pan, H., Tang, Q., Woolard, C., Xu, G. The Extracellular Domain of Pollen Receptor Kinase 3 is structurally similar to the SERK family of co-receptors. Scientific Reports. 8, 2796(2018).
  13. Khorana, H. G. Total synthesis of a gene. Science. 203, 614-625 (1979).
  14. Bahl, C. P., Marians, K. J., Wu, R. A general method for inserting specific DNA sequences into cloning vehicles. Gene. 1, 81-92 (1976).
  15. Xu, W., Zhang, Y. Isolation and Characterization of Vaccine-Derived Polioviruses, Relevance for the Global Polio Eradication Initiative. Methods in Molecular Biology. 1387, 213-226 (2016).
  16. Hanahan, D. Studies on transformation of Escherichia coli with plasmids. Journal of Molecular Biology. 166, 557-580 (1983).
  17. Zhang, S., Cahalan, M. D. Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit. Journal of Visualized Experiments. (6), 247(2007).
  18. Reddy, B. G., et al. Expression and purification of the alpha subunit of the epithelial sodium channel, ENaC. Protein Expression and Purification. 117, 67-75 (2016).
  19. Harris, T. J., Emtage, J. S. Expression of heterologous genes in E. coli. Microbiological Sciences. 3, 28-31 (1986).
  20. Kaur, J., Kumar, A., Kaur, J. Strategies for optimization of heterologous protein expression in E. coli: Roadblocks and reinforcements. International Journal of BIological Macromolecules. 106, 803-822 (2018).
  21. Guo, Y., Yang, F., Tang, X. An Overview of Protein Secretion in Yeast and Animal Cells. Methods in Molecular Biology. 1662, 1-17 (2017).
  22. Blight, M. A., Chervaux, C., Holland, I. B. Protein secretion pathway in Escherichia coli. Current Opinion in Biotechnology. 5, 468-474 (1994).
  23. Idiris, A., Tohda, H., Kumagai, H., Takegawa, K. Engineering of protein secretion in yeast: strategies and impact on protein production. Applied Microbiology and Biotechnology. 86, 403-417 (2010).
  24. Wormald, M. R., Dwek, R. A. Glycoproteins: glycan presentation and protein-fold stability. Structure. 7, R155-R160 (1999).
  25. Geisler, C., Mabashi-Asazuma, H., Jarvis, D. L. An Overview and History of Glyco-Engineering in Insect Expression Systems. Methods in Molecular Biology. 1321, 131-152 (2015).
  26. Li, Z., Chakraborty, S., Xu, G. X-ray crystallographic studies of the extracellular domain of the first plant ATP receptor, DORN1, and the orthologous protein from Camelina sativa. Acta Crystallographica Section F: Structural BIology and Crystallization Communications. 72, 782-787 (2016).
  27. Aricescu, A. R., Owens, R. J. Expression of recombinant glycoproteins in mammalian cells: towards an integrative approach to structural biology. Current Opinion in Structural Biology. 23, 345-356 (2013).
  28. Reuter, L. J., Bailey, M. J., Joensuu, J. J., Ritala, A. Scale-up of hydrophobin-assisted recombinant protein production in tobacco BY-2 suspension cells. Plant Biotechnology Journal. 12, 402-410 (2014).
  29. Dohi, K., et al. Inducible virus-mediated expression of a foreign protein in suspension-cultured plant cells. Archives of Virology. 151, 1075-1084 (2006).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Insect Cell ExpressionSignal Peptide SequencesProtein PurificationX ray CrystallographyCryo EM AnalysisSf9 Cell CultureBacmid DNA PreparationRecombinant Virus Amplification