A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Conversion of Human Induced Pluripotent Stem Cells (iPSCs) into Functional Spinal and Cranial Motor Neurons Using PiggyBac Vectors

11.6K views

DOI:

10.3791/59321

May 1st, 2019

In This Article

Summary

This protocol allows rapid and efficient conversion of induced pluripotent stem cells into motor neurons with a spinal or cranial identity, by ectopic expression of transcription factors from inducible piggyBac vectors.

Abstract

We describe here a method to obtain functional spinal and cranial motor neurons from human induced pluripotent stem cells (iPSCs). Direct conversion into motor neuron is obtained by ectopic expression of alternative modules of transcription factors, namely Ngn2, Isl1 and Lhx3 (NIL) or Ngn2, Isl1 and Phox2a (NIP). NIL and NIP specify, respectively, spinal and cranial motor neuron identity. Our protocol starts with the generation of modified iPSC lines in which NIL or NIP are stably integrated in the genome via a piggyBac transposon vector. Expression of the transgenes is then induced by doxycycline and leads, in 5 days, to the conversion of iPSCs into MN progenitors. Subsequent maturation, for 7 days, leads to homogeneous populations of spinal or cranial MNs. Our method holds several advantages over previous protocols: it is extremely rapid and simplified; it does not require viral infection or further MN isolation; it allows generating different MN subpopulations (spinal and cranial) with a remarkable degree of maturation, as demonstrated by the ability to fire trains of action potentials. Moreover, a large number of motor neurons can be obtained without purification from mixed populations. iPSC-derived spinal and cranial motor neurons can be used for in vitro modeling of Amyotrophic Lateral Sclerosis and other neurodegenerative diseases of the motor neuron. Homogeneous motor neuron populations might represent an important resource for cell type specific drug screenings.

Introduction

Motor neuron (MN) degeneration plays a causative role in human diseases such as Amyotrophic Lateral Sclerosis (ALS) and Spinal Muscular Atrophy (SMA). Establishing suitable in vitro cell model systems that recapitulate the complexity of the human MN is an important step towards the development of new therapeutic approaches. Induced pluripotent stem cells (iPSCs), which are endowed with remarkable plurilineage differentiation properties, have now been derived from a number of patients affected by motor neuron diseases1,2. Additional iPSC lines carrying pathogenic mutations associated to MN diseases have been generated by gene editing, starting from control "healthy" pluripotent stem cells3. These lines represent useful tools for in vitro disease modeling and drug screening, provided that appropriate methods for iPSC differentiation into MNs are available. The rationale behind the development of this method is to provide the scientific community interested in MN diseases with a fast and efficient differentiation protocol giving rise to mature functional MNs. The first advantage of this method is its timeframe of execution. Another relevant point of strength comes from the elimination of any purification step. Finally, the protocol can be used to generate two distinct populations of motor neurons.

The possibility of generating different subtypes of MNs is particularly relevant for modeling of MN diseases. Not all MN subtypes are equally vulnerable in ALS and SMA and the onset of symptoms in different motor units greatly influences the prognosis. In ALS, spinal onset with symptoms starting in upper and lower limbs leads to death in about 3-5 years4. Conversely, bulbar onset, starting with degeneration of cranial MNs, has a worst prognosis. Moreover, the percentage of bulbar onset is significantly higher in patients with mutations in the RNA-binding proteins FUS and TDP-43 than in individuals with SOD1 mutations5. Almost the totality of alternative MN differentiation protocols relies on the activity of retinoic acid (RA), which confer a spinal character to differentiating iPSCs6,7,8. This limits the possibility of studying intrinsic factors, which could be protective in specific MN subtypes9,10.

Consistent with a previous work in mouse embryonic stem cells11, we have recently shown that in human iPSCs ectopic expression of Ngn2, Isl1 and Lhx3 (NIL) induces a spinal MN identity, while Ngn2 and Isl1 plus Phox2a (NIP) specify cranial MNs12. We have hence developed an efficient protocol, leading to the production of human MNs endowed with functional properties in a 12 days turnaround. The purpose of this method is to obtain, in a short time frame and without the need for purification (e.g., by FACS), cell populations highly enriched for MNs with spinal or cranial identity.

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Maintenance of Human iPSCs

  1. Preparation of matrix-coated plates
    1. Thaw one 5 mL vial of matrix (see Table of Materials) at 4 °C overnight. The original matrix stocks come at different stock concentrations and aliquots are made according to the dilution factor indicated on the datasheet, specific for the individual lot. It is important to keep the vial and tubes ice cold to prevent premature gelling of the matrix. Dispense matrix into aliquots in pre-chilled cryotubes on ice. Freeze unused aliquots at -20 °C.
    2. Place one aliquot on ice for about 2 h to thaw.
    3. Dilute the aliquot of matrix with 20 mL of cold DMEM/F12 in a 50 mL conical tube.
    4. Mix well and dispense 1 mL of diluted matrix into 35 mm dishes (equivalent amounts per surface area of other dishes).
    5. Keep the dishes containing diluted matrix for 1 h at room temperature to allow coating.
      NOTE: Dishes, sealed with parafilm, can be stored at 4 °C for up to 2 weeks.
  2. Preparation of the stock solution (20 mL) and 1x working aliquots of the gentle cell dissociation reagent (see Table of Materials).
    1. Dissolve powder to 10 mg/mL in PBS (Ca2+/Mg2+ free).
    2. Filter sterilize through a 0.22 μm filter membrane.
    3. Prepare 20 aliquots (1 mL each) and store at -20 °C.
    4. Before use, dilute one aliquot in PBS (Ca2+/Mg2+ free) to 1 mg/mL (1x working aliquots).
      NOTE: 1x working aliquots can be stored at 4 °C for up to 2 weeks.
  3. Passaging human iPSCs.
    1. Before starting: If stored at 4 °C, pre-warm matrix-coated plates in the incubator at 37 °C for 20-30 min. Pre-warm at room temperature the amount of human iPSC medium (see Table of Materials) needed. Pre-warm the DMEM/F12.
    2. Aspirate culture medium.
    3. Rinse iPSCs with PBS (Ca2+/Mg2+ free).
    4. Add 1x gentle dissociation solution (0.5 mL for a 35 mm dish). Incubate at 37 °C until the edges of the colonies begin to detach from the plate, usually 3-5 min.
    5. Aspirate the gentle dissociation solution, being careful not to detach iPSC colonies.
    6. Wash the cells with DMEM/F12 (2 mL for a 35 mm dish) and aspirate being careful not to detach the cells. Repeat this step one more time.
    7. Add human iPSC medium (1 mL for a 35 mm dish).
    8. Gently detach the colonies off with a cell lifter and transfer to a 15 mL tube.
    9. Gently break cell clumps by pipetting up and down with a P1000 pipettor 3-4 times.
    10. Aspirate the supernatant from the matrix-coated plate(s).
    11. Seed the cells in the appropriate culture volume of human iPSC medium. The split ratio can vary from line to line and is about 1:4-1:8. Change the medium daily.

2. Generation of NIL and NIP Inducible iPSC Lines

  1. Cell transfection.
    1. Rinse the cells with PBS (Ca2+/Mg2+ free).
    2. Add cell dissociation reagent (see Table of Materials) (0.35 mL for a 35 mm dish) and incubate at 37 °C until single cells are separated (5-10 min).
    3. Gently complete cell separation by pipetting up and down with a P1000 pipettor 3-4 times.
    4. Collect in a 15 mL tube and add PBS (Ca2+/Mg2+ free) to 10 mL. Count the cells.
    5. Pellet 106 cells and resuspend in 100 μl of Buffer R (included in the cell electroporation kit, see Table of Materials).
    6. Add plasmid DNA for transfection: 4.5 μg of transposable vector (epB-Bsd-TT-NIL or epB-Bsd-TT-NIP12) and 0.5 μg of the piggyBac transposase plasmid13.
    7. Transfect with the cell electroporation system (see Table of Materials) according to manufacturer’s instructions and as previously described3 with the following parameters: 1,200 V voltage, 30 ms width, 1 pulse. Seed the cells in human iPSC medium supplemented with 10 μM Y-27632 (ROCK inhibitor, see Table of Materials) in a 6 mm matrix-coated dish.
  2. Selection with antibiotics.
    1. Two days after transfection, add 5 μg/mL blasticidin to the culture medium.
    2. Most of the non-transfected cells will die within 48 h of blasticidin selection. Keep the cells in blasticidin for at least 7-10 days to counter-select the cells that have not integrated the transgenes in the genome.
    3. Maintain stably transfected cells as a mixed population, composed of cells with different number of transgenes and different integration sites, or isolate single clones.
    4. Prepare an additional dish to check for effective expression of the transgenes, upon 1 μg/mL doxycycline induction, by RT-PCR with transgene-specific primers for Ngn2 (Forward: TATGCACCTCACCTCCCCATAG; Reverse: GAAGGGAGGAGGGCTCGACT), as previously described12.
    5. At this stage, freeze stocks of the novel NIL- and NIP-iPSC lines in freezing medium for human iPSCs (see Table of Materials).

3. Motor Neuron Differentiation

  1. Dissociate the cells with cell dissociation reagent as described (steps 2.1.1.-2.1.3.). Collect dissociated cells in a 15 mL tube and dilute with 5 volumes of DMEM/F12. Pellet the cells and resuspend in human iPSC medium supplemented with 10 μM ROCK inhibitor. Count the cells and seed on matrix-coated dishes at a density of 62,500 cells/cm2.
  2. The day after, replace the medium with DMEM/F12, supplemented with 1x stable L-glutamine analogue, 1x non-essential amino acid (NEAA) cell culture supplement and 0.5x penicillin/streptomycin, and containing 1 μg/mL doxycycline. This is considered as day 0 of differentiation. On day 1, refresh the medium and doxycycline.
  3. On day 2, change the medium to Neurobasal/B27 medium (Neurobasal Medium supplemented with 1x B27, 1x stable L-glutamine analogue, 1x NEAA and 0.5x penicillin/streptomycin), containing 5 μM DAPT, 4 μM SU5402 and 1 μg/mL doxycycline (see Table of Materials). Refresh the medium and doxycycline every day until day 5.
  4. Day 5: Cells dissociation with cell dissociation reagent (see Table of Materials).
    1. Rinse the cells with PBS (Ca2+/Mg2+ free).
    2. Add cell dissociation reagent (0.35 mL for a 35 mm dish) and incubate at 37 °C until the entire cell monolayer separates from the dish. Note that single cells will not be separated during incubation.
    3. Add 1 mL of DMEM/F12 and collect the cells in a 15 mL tube.
    4. Gently complete cell separation by pipetting up and down with a P1000 pipettor 10-15 times.
    5. Add 4 mL of DMEM/F12 and count the cells.
    6. At this stage, freeze motor neuron progenitors in cell freezing medium (see Table of Materials), according to manufacturer instructions.
    7. Pellet the cells and resuspend in Neuronal Medium (Neurobasal/B27 medium supplemented with 20 ng/mL BDNF, 10 ng/mL GDNF and 200 ng/mL L-ascorbic acid, see Table of Materials) supplemented with 10 μM ROCK inhibitor.
    8. Seed the cells on poly-ornithine/laminin- or alternatively on matrix-coated supports at the density of 100,000 cells/cm2. Use µ-Slide plastic supports with polymer coverslip (see Table of Materials) for immunostaining analysis.
  5. On day 6, change the medium with fresh Neuronal Medium devoid of ROCK inhibitor. On the next days, refresh half of the medium every 3 days. Culture medium must be changed very carefully in order to prevent detachment from the surface.

4. Immunostaining Analysis

  1. Cell fixation. Rinse the cells with PBS (with Ca2+/Mg2+) and incubate for 15 min in 4% paraformaldehyde in PBS (with Ca2+/Mg2+) at room temperature.
    CAUTION: Paraformaldehyde is toxic and suspected to cause cancer. Avoid contact with skin and eyes and handle under a chemical fume hood.
  2. Permeabilize with PBS (with Ca2+/Mg2+) containing 0.1% Triton X-100 for 5 min at room temperature.
  3. Incubate for 30 min at room temperature in antibody blocking solution (ABS: 3% BSA in PBS with Ca2+/Mg2+).
  4. Incubate for 1 h at room temperature with primary antibodies in ABS: anti-TUJ1 (1:1000; rabbit) and anti-Oct4 (1:200; mouse) or anti-CHAT (Anti-Choline Acetyltransferase; 1:150; goat). See Table of Materials.
  5. Incubate for 45 min at room temperature with appropriate donkey secondary antibody pair in ABS: anti-mouse Alexa Fluor 647 (1:250), anti-rabbit Alexa Fluor 594 (1:250) and anti-goat Alexa Fluor 488 (1:250). See Table of Materials.
  6. Incubate in 0.4 μg/mL DAPI for 5 min at room temperature to label nuclei.
  7. Mount the cells with Mounting Medium (see Table of Materials) for imaging at a fluorescence microscope.

5. Functional Characterization via Patch-clamp Recordings

  1. Prepare the HEPES-equilibrated external solution (NES) as following: 140 mM NaCl, 2.8 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 10 mM HEPES, and 10 mM glucose. Set the osmolarity between 290-300 mΩ. Adjust the pH to 7.3 using 1N NaOH and store the solution at 4 °C.
  2. Prepare the internal solution: 140 mM K-gluconate, 2 mM NaCl, 5 mM BAPTA, 2 mM MgCl2, 10 mM HEPES, 2 mM Mg-ATP, 0.3 mM Na-GTP. Adjust the pH to 7.3 with 1M KOH and check that the osmolarity is set at around 290 mΩ. Freeze the solution at -20 °C in small aliquots.
  3. Before running the experiments, pre-warm the NES solution in a water bath to about 28-30 °C.
  4. Pull some borosilicate micropipettes (ID 0.86 mm; OD 1.5 mm) bearing a tip resistance: 5-6 MΩ and fill with the intracellular solution before mounting into the pipette holder.
    NOTE: Remember to chloride silver wires of the recording electrode and reference electrode in bleach for at least 30 min in order to form a uniform layer of AgCl on the wire surface.
  5. Transfer the Petri dish in the recording chamber and let the chamber with the NES solution at 1-2 mL/min. Let the flow passing through an inline heater set at temperature of 30 °C in order to keep the solution warm.
  6. Place electrophysiological recording chamber under an upright microscope. Record membrane currents with the patch-clamp amplifier and acquire data with an appropriate software.
  7. Open the amplifier control software, and set the signal gain at value 1 and the Bessel filter at 10 kHz. Ensure that the Bessel filter is 2.5 times lower than the sampling frequency.
  8. Set the experimental protocols for voltage-clamp and current-clamp experiments in the recording software.
  9. In the protocol setting, tick episodic stimulation mode and set the sampling frequency at 25 kHz. Then, move to the waveform tab and type the voltage or current step amplitude and length as follow.
  10. For the voltage-gated sodium currents, use 15 voltage steps (50 ms duration each) from -100 mV to +40 mV (10 mV increment). Run the protocol after imposing to the patched cell a holding potential of -60 mV through the amplifier. Similarly, the voltage-gated potassium currents are evoked by voltage steps (250 ms duration each) from -30 mV to +50 mV (10 mV increment) holding the recorded cell to -40 mV.
  11. For investigating the firing properties of iPSC-derived cranial and spinal MNs, clamp cells, in current-clamp mode, at a membrane potential of -70 mV and use 4 current pulses (1 s duration each) of increasing amplitude (from +20 pA to +80 pA; 20 pA increment).
  12. Acquire for each cell voltage-activated currents, evoked firing activity and three passive properties as whole-cell capacitance (Cm), cell membrane resistance (Rm) and Resting Membrane Potential (RMP).

Access restricted. Please log in or start a trial to view this content.

Results

A schematic description of the differentiation method is shown in Figure 1. Human iPSCs (WT I line3) were transfected with epB-Bsd-TT-NIL or epB-Bsd-TT-NIP, generating, upon blasticidin selection, stable and inducible cell lines12, hereafter referred to as iPSC-NIL and iPSC-NIP, respectively. Differentiating cells were characterized for the expression of the pluripotency marker OCT4 and the pan-neuronal marker TUJ1. Immunostaining analysis show...

Access restricted. Please log in or start a trial to view this content.

Discussion

This protocol allows to efficiently convert human iPSCs into spinal and cranial motor neurons thanks to the ectopic expression of lineage-specific transcription factors. These transgenes are inducible by doxycycline and stably integrated in the genome thanks to a piggyBac transposon-based vector. In a mixed population, one or several copies of the piggyBac vector will be randomly integrated into the genome of individual cells, increasing the risk of genome integrity alterations. Moreover, a progressive selection of iPSC ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have nothing to disclose

Acknowledgements

The authors wish to thank the Imaging Facility at Center for Life Nano Science, Istituto Italiano di Tecnologia, for support and technical advice. We are grateful to members of the Center for Life Nano Science for helpful discussion. This work was partially supported by a grant from AriSLA (pilot grant 2016 "StressFUS") to AR.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
5-BaptaSigma-AldrichA4926-1Gchemicals for electrophysiological solutions
AccutaseSigma-AldrichA6964-100ML Cell dissociation reagent
anti-CHATEMD Millipore AB144PAnti-Choline Acetyltransferase. Primary antibody used in immunostaining assays. RRID: AB_2079751; Lot number: 2971003
anti-goat Alexa Fluor 488 Thermo Fisher Scientific A11055Secondary antibody used for immonofluorescence assays. RRID: AB_2534102; Lot number: 1915848
anti-mouse Alexa Fluor 647Thermo Fisher Scientific A31571Secondary antibody used for immonofluorescence assays. RRID: AB_162542; Lot number: 1757130
anti-Oct4 BD Biosciences611202Primary antibody used in immunostaining assays. RRID: AB_398736; Lot number: 5233722
anti-Phox2bSanta Cruz Biotechnology, Inc.sc-376997Primary antibody used in immunostaining assays. Lot number: E0117
anti-rabbit Alexa Fluor 594 Immunological SciencesIS-20152-1Secondary antibody used for immonofluorescence assays
anti-TUJ1 Sigma-Aldrich T2200Primary antibody used in immunostaining assays. RRID: AB_262133
B27Miltenyi Biotec130-093-566Serum free supplement for neuronal cell maintenance
BambankerNippon GeneticsNGE-BB02Cell freezing medium, used here for motor neuron progenitors
BDNFPreproTech450-02Brain-Derived Neurotrophic Factor
BlasticidinSigma-Aldrich203350Nucleoside antibiotic that inhibits protein synthesis in prokaryotes and eukaryotes
BSASigma-AldrichA2153Bovine Serum Albumin. Blocking agent to prevent non-specific binding of antibodies in immunostaining assays
CaCl2Sigma-AldrichC3881chemicals for electrophysiological solutions
Clampex 10 softwareMolecular DevicesClampex 10Membrane currents recording system
Corning Matrigel hESC-qualified MatrixCorning354277Reconstituted basement membrane preparation from the Engelbreth-Holm-Swarm (EHS) mouse sarcoma. Used for adhesion of iPSC to plastic and glass supports
CRYOSTEM ACF FREEZING MEDIABiological Industries05-710-1EFreezing medium for human iPSCs
D-GlucoseSigma-AldrichG5146chemicals for electrophysiological solutions
DAPI powderRoche102362760014′,6-diamidino-2-phenylindole. Fluorescent stain that binds to adenine–thymine rich regions in DNA used for nuclei staining in immonofluorescence assays
DAPTAdipoGenAG-CR1-0016-M005Gamma secretase inhibitor
DispaseGibco17105-041Reagent for gentle dissociation of human iPSCs
DMEM/F12Sigma-AldrichD6421-500MLBasal medium for cell culture
DoxycyclineSigma-AldrichD9891-1G Used to induce expression of transgenes from epB-Bsd-TT-NIL and epB-Bsd-TT-NIP vectors
DS2U WiCellUWWC1-DS2UCommercial human iPSC line
E.Z.N.A Total RNA Kit Omega bio-tekR6834-02Kit for total extraction of RNA from cultured eukaryotic cells
GDNFPreproTech450-10Glial-Derived Neurotrophic Factor
Gibco Episomal hiPSC LineThermo Fisher ScientificA18945Commercial human iPSC line
GlutamaxThermo Fisher Scientific35050038An alternative to L-glutamine with increased stability. Improves cell health.
HepesSigma-AldrichH4034chemicals for electrophysiological solutions
iScript Reverse Transcription Supermix for RT-qPCR Bio-Rad1708841Kit for gene expression analysis using real-time qPCR
iTaqTM Universal SYBR Green Supermix Bio-Rad172-5121 Ready-to-use reaction master mix optimized for dye-based quantitative PCR (qPCR) on any real-time PCR instrument
K-GluconateSigma-AldrichG4500chemicals for electrophysiological solutions
KClSigma-AldrichP9333chemicals for electrophysiological solutions
L-ascorbic acidLKT LaboratoriesA7210Used in cell culture as an antioxidant
LamininSigma-Aldrich11243217001Promotes attachment and growth of neural cells in vitro
Laser scanning confocal microscope Olympus iX83 FluoView1200Confocal microscope for acquisition of immunostaining images
Mg-ATPSigma-AldrichA9187chemicals for electrophysiological solutions
MgCl2Sigma-AldrichM8266chemicals for electrophysiological solutions
Mounting Medium Ibidi50001Mounting solution used for confocal microscopy and immunofluorescence assays
Multiclamp patch-clamp amplifierMolecular Devices700BMembrane currents recording system
Na-GTPSigma-AldrichG8877chemicals for electrophysiological solutions
NaClSigma-Aldrich71376chemicals for electrophysiological solutions
NEAAThermo Fisher Scientific11140035Non-Essential Amino Acids. Used as a supplement for cell culture medium, to increase cell growth and viability.
Neon 100 μL KitThermo Fisher ScientificMPK10096Cell electroporation kit
Neon Transfection SystemThermo Fisher ScientificMPK5000Cell electroporation system
Neurobasal MediumThermo Fisher Scientific21103049Basal medium designed for long-term maintenance and maturation of neuronal cell populations without the need for an astrocyte feeder layer
NutriStem-XF/FF Biological Industries05-100-1AHuman iPSC culture medium
ParaformaldehydeElectron Microscopy Sciences157-8Used for cell fixation in immunostaining assays
PBSSigma-AldrichD8662-500MLDulbecco's Phosphate Buffer Saline, with Calcium, with Magnesium
PBS Ca2+/Mg2+ freeSigma-AldrichD8537-500MLDulbecco's Phosphate Buffer Saline, w/o Calcium, w/o Magnesium
Penicillin/Streptomycin Sigma-AldrichP4333-100MLPenicillin/Streptomicin solution used to prevent cell culture contamination from bacteria.
poly-ornithineSigma-AldrichP4957Promotes attachment and growth of neural cells in vitro
SU5402Sigma-AldrichSML0443-5MGSelective inhibitor of vascular endothelial growth factor receptor 2 (VEGFR-2)
Triton X-100 Sigma-AldrichT87874-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol, t-Octylphenoxypolyethoxyethanol, Polyethylene glycol tert-octylphenyl ether. Used for cell permeabilization in immunostaining assays
Upright microscopeOlympusBX51VIMicroscope for electrophysiological recording equipped with CoolSnap Myo camera 
Y-27632  (ROCK inhibitor)Enzo Life SciencesALX-270-333-M005 Cell-permeable selective inhibitor of Rho-associated, coiled-coil containing protein kinase (ROCK). Increases iPSC survival
μ-Slide 8 Well Ibidi80826Support for high–end microscopic analysis of fixed cells

References

  1. Dimos, J. T., et al. Induced Pluripotent Stem Cells Generated from Patients with ALS Can Be Differentiated into Motor Neurons. Science (New York, NY). 321 (5893), 1218(2008).
  2. Ebert, A. D., et al. Induced pluripotent stem cells from a spinal muscular atrophy patient. Nature. 457 (7227), 277-280 (2009).
  3. Lenzi, J., et al. ALS mutant FUS proteins are recruited into stress granules in induced Pluripotent Stem Cells (iPSCs) derived motoneurons. Disease models & mechanisms. 8 (7), 755-766 (2015).
  4. Wijesekera, L. C., Leigh, P. N. Amyotrophic lateral sclerosis. Orphanet journal of rare diseases. 4 (3), 1-22 (2009).
  5. Yan, J., et al. Frameshift and novel mutations in FUS in familial amyotrophic lateral sclerosis and ALS/dementia. Neurology. 75 (9), 807-814 (2010).
  6. Boulting, G. L., et al. A functionally characterized test set of human induced pluripotent stem cells. Nature biotechnology. 29 (3), 279-286 (2011).
  7. Amoroso, M. W., et al. Accelerated high-yield generation of limb-innervating motor neurons from human stem cells. The Journal of neuroscience: the official journal of the Society for Neuroscience. 33 (2), 574-586 (2013).
  8. Maury, Y., et al. Combinatorial analysis of developmental cues efficiently converts human pluripotent stem cells into multiple neuronal subtypes. Nature biotechnology. 33 (1), 89-96 (2015).
  9. Allodi, I., et al. Differential neuronal vulnerability identifies IGF-2 as a protective factor in ALS. Scientific reports. 6, 25960(2016).
  10. Kaplan, A., et al. Neuronal matrix metalloproteinase-9 is a determinant of selective neurodegeneration. Neuron. 81 (2), 333-348 (2014).
  11. Mazzoni, E. O., et al. Synergistic binding of transcription factors to cell-specific enhancers programs motor neuron identity. Nature neuroscience. 16 (9), 1219-1227 (2013).
  12. De Santis, R., Garone, M. G., Pagani, F., de Turris, V., Di Angelantonio, S., Rosa, A. Direct conversion of human pluripotent stem cells into cranial motor neurons using a piggyBac vector. Stem Cell Research. 29, 189-196 (2018).
  13. Yusa, K., Zhou, L., Li, M. A., Bradley, A., Craig, N. L. A hyperactive piggyBac transposase for mammalian applications. Proceedings of the National Academy of Sciences of the United States of America. 108 (4), 1531-1536 (2011).
  14. Sances, S., et al. Modeling ALS with motor neurons derived from human induced pluripotent stem cells. Nature Neuroscience. 16 (4), 542-553 (2016).
  15. Miller, J. D., et al. Human iPSC-based modeling of late-onset disease via progerin-induced aging. Cell stem cell. 13 (6), 691-705 (2013).
  16. Lenzi, J., et al. Differentiation of control and ALS mutant human iPSCs into functional skeletal muscle cells, a tool for the study of neuromuscolar diseases. Stem Cell Research. 17 (1), 140-147 (2016).
  17. Zhang, Y., et al. Rapid Single-Step Induction of Functional Neurons from Human Pluripotent Stem Cells. Neuron. 78 (5), 785-798 (2013).
  18. Theka, I., et al. Rapid generation of functional dopaminergic neurons from human induced pluripotent stem cells through a single-step procedure using cell lineage transcription factors. Stem cells translational medicine. 2 (6), 473-479 (2013).
  19. Pawlowski, M., et al. Inducible and Deterministic Forward Programming of Human Pluripotent Stem Cells into Neurons, Skeletal Myocytes, and Oligodendrocytes. Stem Cell Reports. 8 (4), 803-812 (2017).
  20. Li, X., et al. Fast Generation of Functional Subtype Astrocytes from Human Pluripotent Stem Cells. Stem Cell Reports. 11 (4), 998-1008 (2018).
  21. Nehme, R., et al. Combining NGN2 Programming with Developmental Patterning Generates Human Excitatory Neurons with NMDAR-Mediated Synaptic Transmission. Cell reports. 23 (8), 2509-2523 (2018).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Human iPSCsMotor Neuron DifferentiationNgn2 Isl1 Lhx3Ngn2 Isl1 Phox2aSpinal Motor NeuronsDoxycycline InductionCholine AcetyltransferaseAction Potential Firing