We describe a strategy for how to use RNA samples from unreferenced Pacific oyster specimens, and evaluate the genetic material by comparison with publicly available genome data to generate a virtually sequenced cDNA library.
Method Article
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Chemicals: | |||
| 1% Triton X-100 | Solarbio | 9002-93-1 | *Alternative distributors possible |
| 2,5-Dihydroxybenzoic acid | Alfa Aesar | 490-79-9 | *Alternative distributors possible |
| Acetonitrile | Merck | 75-05-8 | *Alternative distributors possible |
| Agarose for molecular biology | Biowest Chemicals | 111860 | *Alternative distributors possible |
| Ampicilin | Solarbio | 69-52-3 | *Alternative distributors possible |
| Chloroform | Lingfeng, Shanghai | 67-66-3 | *Alternative distributors possible |
| DEPC water | Thermo Scientific | R0601 | |
| Ethanol | Jinhuada, Guangzhou | 64-17-5 | *Alternative distributors possible |
| Guanidinium thiocyanate-phenol reagent | Invitrogen | 15596018 | TRIzol reagent |
| Imidazole | Energy Chemical | 288-32-4 | *Alternative distributors possible |
| Isopropyl alcohol | Nanjing Chemical Reagent | 67-63-0 | *Alternative distributors possible |
| Isopropyl β-D-thiogalactopyranoside | Solarbio | 367-93-1 | *Alternative distributors possible |
| Kanamycin | Solarbio | 25389-94-0 | *Alternative distributors possible |
| LB Agar | Thermo Fisher | 22700025 | *Alternative distributors possible |
| LB Broth | Thermo Fisher | 10855021 | *Alternative distributors possible |
| Methanol | Jinhuada, Guangzhou | 67-56-1 | *Alternative distributors possible |
| MgCl2 hexahydrate | Xilong Huagong | 7791-18-6 | *Alternative distributors possible |
| NaCl | Xilong Huagong | 7647-14-5 | *Alternative distributors possible |
| NAD+ | Duly Biotech | 53-84-9 | *Alternative distributors possible |
| Phenyl-methylsulfonyl fluoride | Macklin | 329-98-6 | *Alternative distributors possible |
| Tris | Solarbio | 77-86-1 | *Alternative distributors possible |
| UDP-glucose | Wuhu Nuowei Chemicals | 28053-08-9 | *Alternative distributors possible |
| UDP-glucuronic acid | SIGMA | 63700-19-6 | *Alternative distributors possible |
| Tools/Instruments: | |||
| MALDI-TOF mass spectrometer | Bruker | Autoflex | *Alternative distributors possible |
| Metal block heater | Long Yang Scientific Instruments | Thermoshaker HB20 | *Alternative distributors possible |
| PCR thermocycler | Hema | 9600 | *Alternative distributors possible |
| Enzyme and Kits: | |||
| 10×Ligation buffer | Thermo Scientific | B69 | *Alternative distributors possible |
| 5×PrimeSTAR buffer | Takara | 9158A | |
| Alkaline phosphatase | ThermoFisher FastAP | EF0654 | *Alternative distributors possible |
| COX forward primer | Genscript | ATGTCAACAAATCATTTAGACATTG | |
| COX reverse primer | Genscript | ACTTGACCAAAAACATAAGACATG | |
| Cutsmart Buffer | NEB | B7204S | *Alternative distributors possible |
| dNTP mix | Invitrogen | 18427088 | |
| MgUGD forward primer | Genscript | ACATATGACCCTGTCCAAGATCTGTTGT | |
| MgUGD reverse primer | Genscript | ACTCGAGACTCTGTGAGGCGGTGGAG | |
| MgUXS forward primer | Genscript | CCATATGGCAGAATCCTCACAATCAC | |
| MgUXS reverse primer | Genscript | ACTCGAGCACATTTTTGAATTTGCAGACGT | |
| ND forward primer | Genscript | ATGAGATGGCAATTATTTTTTAAT | |
| ND reverse primer | Genscript | ATGTATTTTGGAAAAATCTCCAC | |
| PCR Cleanup Kit | AxyGen | AP-PCR-250 | *Alternative distributors possible |
| pET-30a(+) vector | Merck Millipore | 69909 |
Access restricted. Please log in or start a trial to view this content.
Request permission to reuse the text or figures of this JoVE article
Request Permission