A protocol is presented using synthetic biology techniques to synthesize a set of bacterial biosensors for the analysis of gunshot residue, and to test the functioning of the devices for their intended use using fluorescence spectroscopy.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
A protocol is presented using synthetic biology techniques to synthesize a set of bacterial biosensors for the analysis of gunshot residue, and to test the functioning of the devices for their intended use using fluorescence spectroscopy.
MicRoboCop is a biosensor that has been designed for a unique application in forensic chemistry. MicRoboCop is a system made up of three devices that, when used together, can indicate the presence of gunshot residue (GSR) by producing a fluorescence signal in the presence of three key analytes (antimony, lead, and organic components of GSR). The protocol describes the synthesis of the biosensors using Escherichia coli (E. coli), and the analytical chemistry methods used to evaluate the selectivity and sensitivity of the sensors. The functioning of the system is demonstrated by using GSR collected from the inside of a spent cartridge casing. Once prepared, the biosensors can be stored until needed and can be used as a test for these key analytes. A positive response from all three analytes provides a presumptive positive test for GSR, while each individual device has applications for detecting the analytes in other samples (e.g., a detector for lead contamination in drinking water). The main limitation of the system is the time required for a positive signal; future work may involve studying different organisms to optimize the response time.
A biosensor is any analytical device that uses biological components (such as proteins, nucleic acids, or whole organisms) that produce a response that can be used for the detection of a chemical substance or analyte. As an example, the coal mining industry used a biosensor for much of the 20th century to detect the presence of toxic mine gases: the canary in the coal mine1. The biological organism's (canary's) response (death or distress) to a chemical analyte (carbon monoxide) was observed by the miners in order to protect the workers. In a more modern and sophisticated example, bacteria can be altered using synthetic biology techniques to respond to the presence of a certain chemical analyte by exhibiting a specific response, such as the expression of a fluorescent protein.
Synthetic biology is a broad term that refers to the construction of biological devices and systems that do not exist naturally, or the re-design of existing biological systems for a specific purpose2. Synthetic biology is distinguished from genetic engineering by a standard methodology and the existence of standardized parts (standard synthetic biology genetic elements) that can be used to synthesize devices and systems. A part is introduced into the genome of a device, an organism such as a bacterium, to express a certain trait that will serve as an indication of function. For example, in many synthetic devices, the expression of a fluorescent protein is introduced into a single celled organism as a reporter protein. Multiple devices can be combined into a system. The genomes of microorganisms such as bacteria are easy to manipulate in this manner. Numerous examples of biosensors specific to a wide range of chemical analytes have been reported in the literature over the last decade3,4.
In this work, the MicRoboCop system is presented as an example of a biosensor designed using synthetic biology techniques with novel applications in forensic and environmental chemistry. MicRoboCop is a system of three separate devices that, when combined, will allow Escherichia coli to express red fluorescent protein (RFP) in the presence of gunshot residue (GSR) that has been collected from a person’s hands or a surface. Each of the three devices responds to a specific chemical analyte that is known to be a component of GSR5. The three analytes to which the system responds are I. 2,4,6-trinitrotoluene (TNT) and related compounds, II. lead (in the form of lead ions), and III. antimony (also in the form of ions).
GSR consists of many different chemical substances, but the three usually used to identify a residue as GSR are barium, lead, and antimony5. The standard evidentiary test for the identification of GSR is to use scanning electron microscopy (SEM) with energy dispersive X-ray fluorescence (EDX)5. SEM-EDX allows analysts to identify the unique morphology and the elemental components of GSR. Presently, there are few widely used binary presumptive tests available. One recently published presumptive test uses ion-mobility spectroscopy (IMS), which is specialized equipment that might not be available in many labs6. There are also a few color “spot” tests that can be used, though they are typically used for distance determination or for GSR identification on bullet holes and wounds5. Additionally, there has been some limited attention in the literature to electrochemical tests for GSR that employ voltammetric analysis, which has the advantage of potentially being field portable, or anodic stripping voltammetry, which is an extremely sensitive method for metallic elements7. There is very little mention in the literature of biosensors designed specifically for the purpose of detecting GSR, though some biosensors for other forensic applications have been published8.
The biological elements for each device in the MicRoboCop system, and the plasmid construction, are illustrated in Figure 1. The curved arrow in Figure 1b represents the promoter region that is activated in the presence of the analyte, the oval is the ribosomal binding site that allows translation of the reporter protein, the gray box labeled RFP is the gene that expresses red fluorescent protein, and the red octagon is the transcription termination site. All three devices will be used together as a system to detect GSR. Each device with a specific promoter (SbRFP, PbRFP, and TNT-RFP) will be incubated with the sample that is being tested and fluorescence of RFP will be measured. RFP will only be expressed if the appropriate chemical analyte is present and activates the promoter region. Three devices that respond to some of the chemical substances present in GSR have been designed and are presented in this work.
The promoters used in the three MicRoboCop devices are an arsenic and antimony sensitive promoter, SbRFP9,10, a lead sensitive promoter, PbRFP11,12 and a TNT sensitive promoter, TNT-RFP13. Because a search in the literature revealed no promoter designed to respond to barium, the TNT promoter was selected instead since this promoter is sensitive to a number of structurally related compounds (in particular, 2,4-dinitrotoluene and dinitrobenzene) that are known to be a part of the organic compounds left behind in GSR. This promoter has successfully been used to specifically detect minute quantities of TNT and 2,4-dinitrotoluene (2,4-DNT) in buried land mines13. Using the three devices together as a system, a positive test for GSR will produce fluorescence in all three devices. A fluorescence signal in only one or two devices will indicate another environmental source of the analyte(s) or in the case of the TNT promoter, activation by a compound that is not an organic compound left behind in GSR. By using all three devices together, the possibility of a false positive results due to environmental sources is minimized. Lead-free ammunition, which is gaining in popularity, still represents only about 5% of ammunition sales in the United States; hence, false negative results due to the absence of lead may be a possibility but there is still utility in a sensor that uses lead as a marker for GSR14. In addition to this specific forensic application, each device can be used separately for purposes of detecting environmental contaminants.
The protocols presented include the synthetic biology techniques used to create the devices (sensor bacteria) and the analytical techniques to check the function of the devices and analyze the fluorescence signals obtained. The protocol also includes collection of forensic evidence in the form of hand wiping to collect GSR from the hands of a suspect or swabbing to collect GSR from a surface. Results from the lead sensor device are presented as example results, along with a demonstration of a positive test for GSR using a spent cartridge casing.
Access restricted. Please log in or start a trial to view this content.
NOTE: Synthesis of E. coli expressing RFP is presented.
1. Preparation of plasmid DNA from E. coli
2. Restriction enzyme digestion
3. Ligation and transformation
4. Colony PCR
5. DNA Sequencing
6. Preparation of E. coli cultures
7. Titrating E. coli to check function of device
NOTE: Once the sensors have been titrated to check function, this step does not need to be repeated. A positive control in the form of addition of lead, antimony, and 2,4-DNT or 1,3-dinitrobenzene (1,3-DNB) can check the function of the devices for each use without the need for the full titration.
8. Using E. coli as chemical sensor for GSR
9. Fluorescence analysis using portable spectrometer (see Table of Materials)
10. Fluorescence analysis using 96-well plate reader (see Table of Materials)
11. Data analysis
Access restricted. Please log in or start a trial to view this content.
Fluorescence spectra for the RFP variant used in this work are shown in Figure 2. These data are from the PbRFP device as it responds to lead and the TNT-RFP device as it responds to two analytes, 2,4-DNT and 1,3-DNB. This figure shows the spectrum of a negative control (no analyte added), and the spectra at two different levels of analyte added. The maximum fluorescence signal for the RFP variant used was observed at 575 nm (excitation wavelength 500 nm). The data in
Access restricted. Please log in or start a trial to view this content.
Modifications and troubleshooting
The experiment described in Table 4 can be modified in any way appropriate to the sensors that have been designed. The most important aspect of a chemical sensor is to evaluate its sensitivity and specificity. It is beneficial to ensure that a wide range of concentrations of the analyte is analyzed to determine the useful analytical range of the sensor. It is also worth determining a maximum level of analyte for the cells. Bec...
Access restricted. Please log in or start a trial to view this content.
The authors have no competing financial interests or other conflicts of interest to disclose.
The authors wish to acknowledge the students at Longwood University in BIOL 324 (Genetics) and the students in CHEM 403 (Advanced Chemical Laboratory Problem Solving) who were involved in the initial preparation and testing of the antimony and lead biosensors. The idea for MicRoboCop was conceived at the GCAT SynBIO workshop (summer 2014), which is funded by NSF and Howard Hughes Medical Institute and hosted by the University of Maryland Baltimore County. The authors also acknowledge funding received from Longwood University’s Cook-Cole College of Arts and Sciences and the GCAT SynBio Alumni Grant.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 1,3-dinitrobenzene, 97% | Aldrich | D194255-25G | |
| 2,4-dinitrotoluene, 97% | Aldrich | 101397-5G | |
| Agar | Fisher Scientific | BP1423-500 | |
| Ampicillin | Fisher Scientific | BP1760-5 | |
| Antimony, Reference Standard Solution (1000ppm ±1%/Certified) | Fisher Scientific | SA450-100 | Standard in dilute HNO3 |
| Cut Smart Buffer | New England BioLabs | B7204S | |
| Duplex Buffer | Integrated DNA Technologies | 11-01-03-00 | |
| EcoRI-HF Restriction Enzyme | New England BioLabs | R3101S | |
| Ethanol, HPLC grade, denatured | Acros Organics | AC611050040 | Solvents do not need to be HPLC grade, ACS or reagent grade will work. |
| Eurofins Genomics SimpleSeq DNA Sequencing Kits | Eurofins Genomics | SimpleSeq Kit Standard | |
| Forward primer for colony PCR | Integrated DNA Technologies | 5’- GCCGCTTGAATTCGTCATATAT-3’ | |
| Forward primer for DNA sequencing | Integrated DNA Technologies | 5’- GTAAAACGACGGCCAGTG-3’ | |
| IBI Science High Speed Plasmid Mini-kit | IBI Scientific | IB47101 | |
| LB Broth, Miller | Fisher Scientific | BP1426-500 | |
| Lead, Reference Standard Solution (1000ppm ±1%/Certified) | Fisher Scientific | SL21-100 | Standard in dilute HNO3 |
| LeadOff Disposable Cleaning and Decon Wipes | Hygenall | 45NRCN | Sold in canisters or individually wrapped, any alcohol based wipe will work. |
| Methanol, HPLC grade | Fisher Scientific | A452-4 | Solvents do not need to be HPLC grade, ACS or reagent grade will work. |
| NEB 5-alpha Competent E. coli cells | New England BioLabs | C2987I | |
| NheI-HF Restriction Enzyme | New England BioLabs | R3131S | |
| Nuclease free water | New England BioLabs | B1500S | |
| OneTaq 2X Master Mix with Standard Buffer | New England BioLabs | M0482S | |
| Plasmids from the registry of standard biological parts used for synthetic biology | Registry of Standard Biological Parts | http://parts.igem.org/Main_Page | |
| Promoter Sequences | Integrated DNA Technologies | Sb promoter: 5’-GCATGAATTCA GTCATATATGTTTTTGACTTATCC GCTTCGAAGAGAGAGACACTACCT GCAACAATCGCTAGCGCAT-3’ 3’-CGTACTTAAGCTCACTATA TACAAAAACTGAATAGGCGAAGC TTCTCTCTCTGTGATGGACGTTG TTAGCGATCGCGTA-5’ Pb promoter: 5’-GCATGAATTCG TCTTGACTCTATAGTAACTAAGGG TGTATAATCGGCAACGCG AGCTAGCGCAT-3’ 3’-CGTACTTAAGCAGAA CTGAGATATCATTGATCTCCCACA TCTTAGCCGTTGCGCTGCGATCGC GTA-5’ TNT promoter: 5’GCATTCTAGAT CAATTTATTTGAACAAGGCGGTCA ATTCTCTTCGATTTTATCTCTCGT AAAAAAACGTGATACTCATCACAT CGACGAAACAACGTCACTTATACA AAAATCACCTGCGAGAGATTAATT GAATTCGCAT3’ 3’CGTAAGATCTAGTTAA ATAAACTTGTTCCGCCAGTTAAGA GAAGCTAAAATAGAGAGCATTTTT TTGCACTATGAGTAGTGTAGCTGC TTTGTTGCAGTGAATATGTTTTTA GTGGACGCTCTCTAATTAACTTAA GCGTA5’ | |
| Reverse primer for colony PCR | Integrated DNA Technologies | 5’- GCCGCTTGAATTCGTCTAGACT- 3’ | |
| Reverse primer for DNA sequencing | Integrated DNA Technologies | 5’- GGAAACAGCTATGACCATG-3’ | |
| T4 DNA Ligase | New England BioLabs | M0202S |
Access restricted. Please log in or start a trial to view this content.