A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Separation of Rat Epidermis and Dermis with Thermolysin to Detect Site-Specific Inflammatory mRNA and Protein

5.1K views

DOI:

10.3791/59708

September 29th, 2021

* These authors contributed equally

In This Article

Summary

Presented here is a protocol for the separation of epidermis from dermis to evaluate inflammatory mediator production. Following inflammation, rat hind paw epidermis is separated from the dermis by thermolysin at 4 °C. The epidermis is then used for mRNA analysis by RT-PCR and protein evaluation by western blot and immunohistochemistry.

Abstract

Easy-to-use and inexpensive techniques are needed to determine the site-specific production of inflammatory mediators and neurotrophins during skin injury, inflammation, and/or sensitization. The goal of this study is to describe an epidermal-dermal separation protocol using thermolysin, a proteinase that is active at 4 °C. To illustrate this procedure, Sprague Dawley rats are anesthetized, and right hind paws are injected with carrageenan. Six and twelve hours after injection, rats with inflammation and naïve rats are euthanized, and a piece of hind paw, glabrous skin is placed in cold Dulbecco's Modified Eagle Medium. The epidermis is then separated at the basement membrane from the dermis by thermolysin in PBS with calcium chloride. Next, the dermis is secured by microdissection forceps, and the epidermis is gently teased away. Toluidine blue staining of tissue sections show that the epidermis is separated cleanly from the dermis at the basement membrane. All keratinocyte cell layers remain intact, and the epidermal rete ridges along with indentations from dermal papillae are clearly observed. Qualitative and real-time RT-PCR is used to determine nerve growth factor and interleukin-6 expression levels. Western blotting and immunohistochemistry are finally performed to detect amounts of nerve growth factor. This report illustrates that cold thermolysin digestion is an effective method to separate epidermis from dermis for evaluation of mRNA and protein alterations during inflammation.

Introduction

Evaluation of inflammatory mediators and neurotrophic factors from the skin can be limited due to the heterogeneity of cell types found in the inflamed dermis and epidermis1,2,3. Several enzymes, chemical, thermal, or mechanical techniques involving separation of the two layers or for performing cell dissociation for evaluation have been reviewed recently4. Acid, alkali, neutral salt, and heat can divide the epidermis from dermis quickly, but cellular and extracellular swelling often occurs5,6. Trypsin, pancreatin, elastase, keratinase, collagenase, pronase, dispase, and thermolysin are enzymes that have been used for epidermal-dermal separation4,7. Trypsin and other broad scale proteolytic enzymes are active at 37–40 °C but must be monitored carefully to prevent dissociation of epidermal layers. Dispase cleaves the epidermis at the lamina densa, but requires 24 h for separation in the cold4,8 or shorter timepoints at 37 °C4,9. A limiting feature of all these techniques is the potential disruption of tissue morphology and loss of integrity of mRNA and protein.

To maintain the integrity of mRNA and protein, a skin separation method should be carried out in the cold for a short period of time. In evaluating skin separation techniques for inflammation studies, thermolysin is an effective enzyme to separate the epidermis from dermis at cold temperatures4. Thermolysin is active at 4 °C, cleaves epidermal hemidesmosomes from the lamina lucida, and separates the epidermis from dermis within 1–3 h4,8,10. The goal of this report is to optimize the use of thermolysin for separation of inflamed rat epidermis from dermis to detect mRNA and protein levels for inflammatory mediators and neurotrophic factors. Several preliminary reports have been presented11,12,13,14,15. The objective of this manuscript is to describe an optimal skin separation technique using thermolysin and demonstrate the detection of 1) markers of inflammation, 2) interleukin-6 (IL-6) mRNA, and 3) nerve growth factor (NGF) mRNA and protein in the epidermis of rats with carrageenan-induced inflammation (C-II)16,17. A preliminary report using the complete Freund’s adjuvant model indicates that NGF mRNA and protein levels increase early during inflammation15. In mice, skin sensitization with the topical application of oxazolone causes an early rise in the IL-6 mRNA using in situ hybridization36. Both IL-6 and NGF have been implicated in C-II18,19, but there have been no reports describing mRNA or protein levels for IL-6 or NGF specifically from the epidermis during the acute stages of C-II.

The thermolysin technique is inexpensive and straightforward to perform. Furthermore, thermolysin separation of the epidermis from dermis allows for mRNA, western blot, and immunohistochemical analysis of inflammatory mediators and neurotrophic factors during the process of inflammation15. Investigators should be able to easily use this technique in both preclinical and clinical studies of skin inflammation.

Access restricted. Please log in or start a trial to view this content.

Protocol

This protocol follows the animal care guidelines of Oklahoma State University Center for Health Sciences IACUC (#2016-03).

1. Carrageenan-induced inflammation (C-II)

  1. Anesthetize male and/or female Sprague Dawley rats (200–250 g; 8–9 weeks old) with isoflurane (or injectable anesthetic).
  2. Check the depth of anesthesia by touching the cornea and lightly pinching the left hind paw. When the animal is appropriately anesthetized, no corneal or paw response will be observed.
  3. Subcutaneously inject the right glabrous, hind paw with 100 µL of 1% (w/v) λ-carrageenan diluted in phosphate-buffered saline (PBS) and allow the rat to fully recover from anesthesia20.
    1. Make sure that appropriate controls are used, such as naïve rats without isoflurane in this report. Preliminary studies indicate that naïve rats with or without isoflurane have the same basal expression of epidermal IL-6 and NGF.
      NOTE: Naïve rats are preferred controls for inflammation studies since subcutaneous saline or PBS cause a local inflammation23,37.
  4. At the 6-12 h time points, euthanize the rats with CO2 and measure hind paw metatarsal thickness with calipers. Cut 1 mm x 2 mm pieces of glabrous hind paw skin with a sharp scalpel. If there is hair on the skin, shave the area before cutting 1 mm x 2 mm pieces of skin.
    NOTE: Make sure that the appropriate timepoints are chosen according to the specific studies.
  5. Using microdissection forceps, transfer the skin into 1 mL of cold Dulbecco's Modified Eagle Medium (DMEM) in a microcentrifuge tube on ice and keep cold for 15–60 min.

2. Thermolysin separation of epidermis and dermis

  1. Prepare and activate thermolysin.
    1. Prepare a solution of thermolysin, by adding 5 mg of Geobacillus stearothermophilus to 10 mL of PBS, at pH = 8 (concentration 500 µg/mL).
    2. Prepare a 1 M solution of calcium chloride (CaCl2 anhydrous) by adding 1.11 g into 10 mL of distilled H2O.
    3. To prevent autolysis of thermolysin, add 10 µL of calcium chloride to 10 mL of thermolysin solution. The calcium chloride final concentration will be 1 mM.
    4. Aliquot 1 mL of activated thermolysin into 10 wells of a 24 well cell culture plate on ice.
  2. Use thermolysin enzyme digestion to separate the epidermis from dermis.
    1. Using microdissection forceps, transfer one skin sample into each well of activated thermolysin. Make sure not to immerse the skin in the thermolysin solution.
    2. Gently tap the skin on the side of the well to assist in releasing the skin sample from the forceps to float on the thermolysin solution.
    3. Float the skin into the thermolysin solution with the stratum corneum (outer epidermis) side up and dermis facing down. It is critical that the dermis faces down, or the effective separation will not take place.
      NOTE: The amount of time for thermolysin incubation must be determined empirically by the end-user. Glabrous, hind paw skin from Sprague Dawley rats (200–250 g; 8–9 weeks old) often requires 2.0–2.5 h for separation. Incubation time is expected to vary with species and age.
    4. After the appropriate incubation time in thermolysin, use microdissection forceps to transfer one skin sample into a well of a 6 well cell culture plate with 7–8 mL of cold (4 °C) DMEM. This allows more room for separation of the epidermis from the dermis.
    5. Immerse the skin into the DMEM.
    6. Gently brush the epidermis with the forceps around the perimeter of the skin until the near-translucent epidermis is observed at the borders. If this cannot be achieved, return the skin sample to the thermolysin solution for another 15–30 min.
    7. Once the epidermis noticeably separates from the dermis, then carefully hold both the epidermis and dermis with microdissection forceps and very slowly pull the epidermis from the dermis.
    8. Evaluate the translucence of the isolated epidermis and make sure it is optically consistent. See Figure 2 for an example of a 1 mm x 2 mm sample of rat epidermis. If there is a variation in the translucence, then proper separation has not occurred.
  3. Inactivate thermolysin using ethylenediaminetetraacetic acid (EDTA) in the separated pieces of epidermis and dermis.
    CAUTION: The thermolysin that remains in the epidermis and dermis is still active and can damage the layers if not inactivated.
    1. Prepare a 0.5 M EDTA stock solution. To do so, slowly add 0.93 g EDTA into 5 mL of double-distilled water. Add sodium hydroxide to the solution until it clears. Ensure that the pH of the solution is ~8.0.
    2. Make a 5 mM EDTA solution in DMEM. Add 0.25 mL of 0.5 M EDTA stock solution to 25 mL of DMEM.
    3. Place the separated epidermis and dermis into the 5 mM EDTA/DMEM solution at 4 °C for 30 min to deactivate thermolysin’s activity.
  4. Evaluate the epidermis with tinctorial histology8,9,10.
    1. Fix a portion of the epidermis in a 10% neutral formalin, 4% paraformaldehyde, or 0.25% paraformaldehyde with 0.8% picric acid solution for 1 h at room temperature (RT) with agitation.
    2. Place the fixed epidermis in 10% sucrose in PBS for 1 h at RT with agitation.
    3. Freeze the epidermis in a tissue embedding matrix for sectioning. Cut 14 µm cross-sections using a cryostat and thaw-mount sections onto gelatin-coated glass microscope slides.
    4. Dry sections on a slide warmer and stain with a working solution of toluidine blue (TB; 10% TB in 1% sodium chloride) for 90 s. Appose coverslips with an aqueous mounting medium.
    5. Observe the epidermis with brightfield microscopy at 50x–250x.
      NOTE: If proper separation has occurred, the epidermis will be divided cleanly from the dermis and the five layers will be detected: stratum basale, stratum spinosum, stratum granulosum, stratum lucidum, and stratum corneum. An example of separated rat skin epidermis can be seen in Figure 3.

3. Protein extraction and western blot analysis

  1. Perform western blotting on the separated tissue samples using previously published protocol21.
  2. Homogenize the epidermis in 50 μL of lysis buffer (25mM Tris HCl, pH = 7.4, 150 mM NaCl, 1 mM EDTA, 5% glycerol, and 1% Triton X-100) containing a phosphatase and protease inhibitor cocktail.
  3. Centrifuge samples at a max speed for 15 min at 4 °C and evaluate the supernatant for protein concentration using a protein assay kit.
  4. Load equal concentrations of protein (30 µg) onto SDS gels, perform electrophoresis, and then transfer proteins to nitrocellulose or PVDF membranes.
  5. Block membranes with 5% milk for 2 h and incubate overnight in primary antibody (mouse anti-NGF, E12, 1:1000).
  6. Wash 3x with PBS with 0.3% tween for 10 min each and incubate with a labeled secondary antibody (e.g., alkaline phosphatase labeled rabbit anti-mouse IgG).
  7. Use a scanning system to evaluate western blot signal (e.g., ECF substrate and an imaging platform).

4. Immunohistochemistry

  1. Place tissue samples in a fixative for optimal immunoreactivity: 0.96% (w/v) picric acid and 0.2% (w/v) formaldehyde in 0.1 M sodium phosphate buffer, pH = 7.321,22,23 for 4 h at RT. Transfer to 10% sucrose in PBS overnight at 4 °C.
  2. Perform standard immunohistochemistry on the tissue sections21,22,23.
  3. Embed the epidermis from animals into a single frozen block in embedding matrix and cut 10–30 µm sections on a cryostat. Mount the sections on gelatin-coated, glass microscope slides and dry at 37 °C for 2 h.
  4. Wash sections for three, 10 min rinses in PBS and incubate for 24–96 h in primary antisera, [e.g., mouse anti-NGF (E12, 1:2000)] and rabbit anti-protein gene product 9.9 (PGP 9.5, 1:2000) diluted in PBS containing 0.3% (w/v) Triton X-100 (PBS-T) PBS-T with 0.5% bovine serum albumin (BSA) and 0.5% polyvinylpyrrolidone (PVP).
  5. After primary antiserum incubation, rinse sections three times for 10 min in PBS and incubate 1 h at RT in Alexa Fluor 488 donkey anti-rabbit IgG (1:1000) and Alexa Fluor 555 donkey anti-mouse IgG (1:1000) diluted in PBS-T.
  6. Rinse sections three times in PBS for 10 min and affix coverslips with non-fading mounting medium to retard fading of immunofluorescence.

5. RNA isolation and cDNA synthesis

  1. Perform standard reverse transcriptase polymerase chain reaction (RT-PCR) on the skin samples21. Isolate total RNA using a phenol, guanidine isothiocyanate solution.
  2. Carry out complementary DNA synthesis by Moloney murine leukemia virus reverse transcriptase.
  3. Use the following primer sequences for NGF and IL-6 amplification:
    NGF (Sense) - GTGGACCCCAAACTGTTTAAGAAACGG
    NGF (Antisense) – GTGAGTCCTGTTGAAGGAGATTGTACCATG
    IL-6 (Sense) - GCAATTCTGATTGTATGAACAGCGATGATGC;
    IL-6 (Antisense) – GTAGAAACGGAACTCCAGAAGACCAGAG
  4. Compare the levels of NGF and IL-6 mRNA to β-actin housekeeping gene:
    β-ACTIN (Sense) - TGCGTGACATTAAAGAGAAGCTGTGCTATG
    β-ACTIN (Antisense) – GAACCGCTCATTGCCGATAGTGATGA
  5. Evaluate with qualitative RT-PCR using thermal cycler and quantitative real-time PCR (qRT-PCR) using a qRT-PCR system.

Access restricted. Please log in or start a trial to view this content.

Results

Carrageenan injection into the rat hind paw caused classic symptoms of inflammation such as redness and edema16,17. The swelling of the hind paw was measured with mechanical calipers20. A baseline value of the thickness of the paw was obtained for each rat before carrageenan treatment and measured again at 6 h and 12 h. Paw thickness was increased significantly compared to the baseline values (Figure 1).

<...

Access restricted. Please log in or start a trial to view this content.

Discussion

The study determined that the epidermis of rat hind paw glabrous skin was easily separated from dermis using thermolysin (0.5 mG/mL) in PBS with 1 mM calcium chloride at 4 °C for 2.5 h. Histological evaluation indicated that the epidermis was separated from the dermis at the basement membrane and that the epidermal rete ridges were intact. Thermolysin is an extracellular metalloendopeptidase produced by Gram-positive (Geo)Bacillus thermoproteolyticus24. Its activity is stable...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors have no disclosures.

Acknowledgements

Funding for this research was provided by National Institutes of Health NIH-AR047410 (KEM)

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
λ-carrageenanMillipore Sigma22049Subcutaneous injection of carrageenan induces inflammation
7500 Fast Real-Time PCR SystemThermo Fisher Scientific4351107For RT-PCR analysis
Calcium chloride (CaCl2), anhydrousMillipore Sigma499609Prevents autolysis of thermolysin
Crystal Mount Aqueous Mounting MediumMillipore SigmaC0612Aqueous mounting medium after toluidine blue staining
Donkey anti-Mouse Alexa Fluor 555Thermo Fisher ScientificA-31570Secondary antibody for immunohistochemistry
Donkey anti-Rabbit IgG, Alexa Fluor 488Thermo Fisher ScientificA-21206Secondary antibody for immunohistochemistry
Dulbecco's Modified Eagle MediumThermo Fisher Scientific11966-025To maintain tissue integrity
Ethylenediaminetetraacetic acidMillipore SigmaE6758Stops thermolysin reaction
Moloney Murine Leukemia Virus (M-MLV) Reverse transcriptasePromegaM1701For complementary DNA synthesis
Mouse anti-NGF Antibody (E-12)Santa Cruz Biotechnologysc-365944For neurotrophin immunohistochemistry
ProLong Gold Antifade MountantThermo Fisher ScientificP36930To retard immunofluorescence quenching
Rabbit anti-PGP 9.5Cedarlane LabsCL7756APFor intraepidermal nerve staining
SAS Sprague Dawley RatCharles RiverStrain Code 400Animal used for inflammation studies
Shandon M-1 Embedding MatrixThermo Fisher Scientific1310TSTissue embedding matrix for tinctorial- and immuno-histochemistry
SimpliAmp Thermal CyclerThermo Fisher ScientificA24811For RT-PCR analysis
SYBR Select Master MixThermo Fisher Scientific4472908For RT-PCR analysis
ThermolysinMillipore SigmaT7902From Geobacillus stearothermophilus
Toluidine BlueMillipore Sigma89640For tinctorial staining for brightfield microscopy
TRIzol ReagentThermo Fisher Scientific15596026For total RNA extraction for RTPCR

References

  1. Choi, J. E., Di Nardo, A. Skin neurogenic inflammation. Seminars in Immunopathology. 40 (3), 249-259 (2018).
  2. Manti, S., Brown, P., Perez, M. K., Piedimonte, G. The role of neurotrophins in inflammation and allergy. Vitamins and Hormones. 104, 313-341 (2017).
  3. Schäkel, K., Schön, M. P., Ghoreschi, K. Pathogenesis of psoriasis. Zeitschrift für Dermatologie, Venerologie, und verwandte Gebiete. 67 (6), 422-431 (2016).
  4. Zou, Y., Maibach, H. I. Dermal-epidermal separation methods: research implications. Archives of Dermatological Research. 310 (1), 1-9 (2018).
  5. Baumberger, J. Methods for the separation of epidermis from dermis and some physiologic and chemical properties of isolated epidermis. Journal of the National Cancer Institute. 2, 413-423 (1942).
  6. Felsher, Z. Studies on the adherence of the epidermis to the corium. Journal of Investigative Dermatology. 8, 35-47 (1947).
  7. Einbinder, J. M., Walzer, R. A., Mandl, I. Epidermal-dermal separation with proteolytic enzymes. Journal of Investigative Dermatology. 46, 492-504 (1966).
  8. Rakhorst, H. A., et al. Mucosal keratinocyte isolation: a short comparative study on thermolysin and dispase. International Association of Oral and Maxillofacial Surgeons. 35 (10), 935-940 (2006).
  9. Tschachler, E., et al. Sheet preparations expose the dermal nerve plexus of human skin and render the dermal nerve end organ accessible to extensive analysis. Journal of Investigative Dermatology. 122 (1), 177-182 (2004).
  10. Walzer, C., Benathan, M., Frenk, E. Thermolysin treatment-a new method for dermo-epidermal separation. Journal of Investigative Dermatology. 92, 78-81 (1989).
  11. Anderson, M. B., Miller, K. E., Schechter, R. Evaluation of rat epidermis and dermis following thermolysin separation: PGP 9.5 and Nav 1.8 localization. Society for Neuroscience Abstract. 584 (9), (2010).
  12. Ibitokun, B. O., Anderson, M. B., Miller, K. E. Separation of corneal epithelium from the stroma using thermolysin: evaluation of corneal afferents. Society for Neuroscience Abstract. , 584(2010).
  13. Nawani, P., Anderson, M., Miller, K. E. Structure-property relationship of skin. Oklahoma Center for Neuroscience Symposium Abstract. , # 17 (2011).
  14. Anderson, M. B., Miller, K. E. Intra-epidermal nerve fiber reconstruction and quantification in three-dimensions. Society for Neuroscience Abstract. 220, 23(2017).
  15. Gujar, V. K. E., Miller, K. E. Expression of nerve growth factor in adjuvant-induced arthritis (AIA): A temporal study. Society for Neuroscience Abstract. 220, 23(2017).
  16. Vinegar, R., et al. to carrageenan-induced inflammation in the hind limb of the rat. Federation Proceedings. 46 (1), 118-126 (1987).
  17. Fehrenbacher, J. C., Vasko, M. R., Duarte, D. B. Models of inflammation: Carrageenan- or complete Freund's Adjuvant (CFA)-induced edema and hypersensitivity in the rat. Current Protocols in Pharmacology. , Chapter 5, Unit 5.4 (2012).
  18. Li, K. K., et al. exerts its anti-inflammatory effects associated with suppressing ERK/p38 MAPK and Heme Oxygenase-1 activation in lipopolysaccharide-stimulated RAW 264.7 macrophages and carrageenan-induced mice paw edema. International Immunopharmacology. 54, 366-374 (2018).
  19. Sammons, M. J., et al. Carrageenan-induced thermal hyperalgesia in the mouse: role of nerve growth factor and the mitogen-activated protein kinase pathway. Brain Research. 876 (1-2), 48-54 (2000).
  20. Hoffman, E. M., Miller, K. E. Peripheral inhibition of glutaminase reduces carrageenan induced Fos expression in the superficial dorsal horn of the rat. Neuroscience Letters. 472 (3), 157-160 (2010).
  21. Crosby, H. A., Ihnat, M., Spencer, D., Miller, K. E. Expression of glutaminase and vesicular glutamate transporter type 2 immunoreactivity in rat sacral dorsal root ganglia following a surgical tail incision. Pharmacy and Pharmacology International Journal. 2 (3), 00023(2015).
  22. Hoffman, E. M., Schechter, R., Miller, K. E. Fixative composition alters distributions of immunoreactivity for glutaminase and two markers of nociceptive neurons Nav1.8 and TRPV1, in the rat dorsal ganglion. Journal of Histochemistry and Cytochemistry. 58 (4), 329-344 (2010).
  23. Hoffman, E. M., Zhang, Z., Schechter, R., Miller, K. E. Glutaminase increases in rat dorsal root ganglion neurons after unilateral adjuvant-induced hind paw inflammation. Biomolecules. 6 (1), 10(2016).
  24. van den Burg, B., Eijsink, V. Thermolysin and related Bacillus metallopeptidases. Handbook of Proteolytic Enzymes. , Volume 1, Chapter 111 540-553 (2013).
  25. Matthews, B. W. Thermolysin. Encyclopedia of Inorganic and Bioinorganic Chemistry. , (2011).
  26. Hybbinette, S., Boström, M., Lindberg, K. Enzymatic dissociation of keratinocytes from human skin biopsies for in vitro cell propagation. Experimental Dermatology. 8 (1), 30-38 (1999).
  27. Glade, C. P., et al. Multiparameter flow cytometric characterization of epidermal cell suspensions prepared from normal and hyperproliferative human skin using an optimized thermolysin-trypsin protocol. Archives of Dermatological Research. 288 (4), 203-210 (1996).
  28. Sato, J. D., Kan, M. Media for culture of mammalian cells. Current Protocols in Cell Biology. , Chapter 1: Unit 1.2 (2001).
  29. Gragnani, A., Sobral, C. S., Ferreira, L. M. Thermolysin in human cultured keratinocyte isolation. Brazilian Journal of Biology. 67 (1), 105-109 (2007).
  30. Germain, L., et al. Improvement of human keratinocyte isolation and culture using thermolysin. Burns. 19 (2), 99-104 (1993).
  31. Michel, M., et al. Characterization of a new tissue-engineered human skin equivalent with hair. In Vitro Cellular & Developmental Biology. Animal. 35 (6), 318-326 (1999).
  32. Fassina, G., et al. Autolysis of thermolysin. Isolation and characterization of a folded three-fragment complex. European Journal of Biochemistry. 156 (2), 221-228 (1986).
  33. Petho, G., Reeh, P. W. Sensory and signaling mechanisms of bradykinin, eicosanoids, platelet-activating factor, and nitric oxide in peripheral nociceptors. Physiological Reviews. 92 (4), 1699-1775 (2012).
  34. Djouhri, L., et al. Time course and nerve growth factor dependence of inflammation-induced alterations in electrophysiological membrane properties in nociceptive primary afferent neurons. Journal of Neuroscience. 21 (22), 8722-8733 (2001).
  35. Denk, F., Bennett, D. L., McMahon, S. B. Nerve growth factor and pain mechanisms. Annual Review of Neuroscience. 40, 307-325 (2017).
  36. Flint, M. S., Dearman, R. J., Kimber, I., Hotchkiss, S. A. Production and in situ localization of cutaneous tumour necrosis factor alpha (TNF-alpha) and interleukin 6 (IL-6) following skin sensitization. Cytokine. 10 (3), 213-219 (1998).
  37. Crosby, H. A., Ihnat, M., Miller, K. E. Evaluating the toxicity of the analgesic glutaminase inhibitor 6-diazo-5-oxo-L-norleucine in vitro and on rat dermal skin fibroblasts. MOJ Toxicology. 1 (1), 00005(2015).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Epidermal Dermal SeparationThermolysin DigestionSkin Inflammation ModelNerve Growth FactorInterleukin 6 ExpressionWestern BlottingImmunohistochemistryToluidine Blue StainingCarrageenan Induced InflammationSprague Dawley Rats