Purification of a High Molecular Mass Protein in Streptococcus mutans

Summary

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

Abstract

Elucidation of a gene's function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3′ end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Introduction

Analysis of a gene's function usually involves comparison of phenotypic traits of wild-type strains to strains in which the gene of interest has been disrupted.Once the gene-disrupted strain is produced, exogenous addition of the gene product allows functional restoration.

The most common method for obtaining purified gene products required for subsequent restoration assays is by performing heterologous expression in Escherichia coli¹. However, the expression of membrane proteins or high molecular mass proteins is often difficult using this system¹. In these cases, the target protein is usually isolated from the cells that natively synthesizes the protein through a complex series of steps, which may lead to loss of the gene product. To overcome these issues, a simple procedure has been developed for gene product purification following a gene disruption method², PCR-based DNA splicing method³ (designated two-step fusion PCR), and electroporation for genetic transformation in Streptococcus mutans. Addition of a polyhistidine tag (His-tag) to the C-terminus of the gene product facilitates its purification by immobilized metal affinity chromatography (IMAC).

To isolate the His-tag-expressing strain, the entire genomic DNA of the gene of interest (in this His-tag-expressing gene-disrupted strain) is replaced with an antibiotic-resistant marker gene. The procedure for generating the His-tag-expressing strainis nearly identical to that for generating a gene-disrupted strain as described previously^4,5. Therefore, the methods for gene disruption and gene product isolation should be performed as serial experiments for the functional analysis.

In the present work, a polyhistidine-coding sequence is attached to the 3′ end of the gtfC (GenBank locus tag SMU_1005) gene, encoding glucosyltransferase-SI (GTF-SI) in S. mutans⁶. Then, expression studies in a streptococcal species were performed. Achieving heterologous gtfC expression by E. coli is difficult, likely because of the high molecular mass of GTF-SI. This strain is named S. mutans His-gtfC. A schematic illustration depicting the organization of the gtfC and spectinomycin resistance gene cassette (spc^r)⁷ loci in wild-type S. mutans (S. mutans WT) and its derivatives is shown in Figure 1. The GTF-SI is a secretory protein that contributes to the development of cariogenic dental biofilm⁶. Under the presence of sucrose, an adherent biofilm is observed on a smooth glass surface in WT S. mutans strain but not in the S. mutans gtfC-disrupted strain (S. mutans ΔgtfC)^2,5. Biofilm formation is restored in S. mutans ΔgtfC upon exogenous addition of the recombinant GTF-SI. The strain, S. mutans His-gtfC, is then used to produce the recombinant GTF-SI.

Protocol

NOTE: Generation of S. mutans ∆gtfC, in which the entire coding region of the gtfC gene is replaced with spc^r, must be completed prior to performing these protocols. Refer to the published article for details on generation⁵.

1. Primer design

1. Prepare primers for the construction of S. mutans His-gtfC.
   NOTE: The primer sequences used in this protocol are shown in Table 1. Two-step fusion PCR method for the generation of S. mutans His-gtfC is schematically illustrated in Figure 2.
   1. Design primers (gtfC-reverse and spc^r-forward) for the attachment of His-tag-coding sequence, intervening between the gtfC gene and spc^r (Figure 2A).
      1. Include GS linker and His-tag-coding sequence into both gtfC-reverse and spc^r-forward primers, in which 24 bases at the 5’ regions are complementary to each other.
         NOTE: The amino acid sequence of the GS linker and His-tag (Gly-Gly-Gly-Gly-Ser-His-His-His-His-His-His) is attached to the C-terminus of GTF-SI through gene translation.
      2. Design a gtfC-forward primer to target the gtfC gene in the S. mutans WT genome >1 kb downstream of the gene and the spc^r-reverse primer to target the downstream flanking region of spc^r in the S. mutans ∆gtfC. Set the melting temperature⁸ (T_m) of the gtfC-forward and spc^r-reverse primers to match with the melting temperatures of the gtfC-reverse and spc^r-forward primers, respectively.
   2. Design nested primers (nested-forward and nested-reverse) for the second PCR (Figure 2B).
   3. Design primers (gtfC-forward and colony-reverse) specific for the genomic DNA of the transformant (Figure 2C; the primers are used for colony PCR).
      NOTE: The amplicons straddle the border between gtfC and spc^r. The gtfC-forward primer can be applied as the forward primer.
   4. Design primers (up-forward and down-reverse) for final confirmation of the generation of S. mutans His-gtfC (Figure 2C; the PCR product amplified by the primers is used for DNA sequencing).

2. Genomic DNA Extraction from S. mutans

NOTE: Each S. mutans strain should be cultured in brain heart infusion (BHI) medium at 37 °C under anaerobic conditions. The mutant strains of S. mutans ∆gtfC and S. mutans His-gtfC are cultured in BHI supplemented with 100 µg/mL spectinomycin.

1. Streak S. mutans WT and S. mutans ∆gtfC separately onto each of the BHI agar plates. Incubate them overnight at 37 °C.
2. Pick single colonies of S. mutans WT or S. mutans ∆gtfC using a sterilized toothpick and inoculate into 1.5 mL of BHI broth. Incubate them overnight at 37 °C.
   NOTE: The colonies may be used as a source of template DNA for the first PCR (step 3.1).
3. Transfer 1 mL of each bacterial culture to a 1.5 mL microcentrifuge tube. Centrifuge the culture for 1 min at 15,000 x g.
4. Remove the supernatant and add 1 mL of the Tris-EDTA buffer (pH 8.0) to resuspend the cell pellet.
5. Centrifuge the suspension for 1 min at 15,000 x g. Remove the supernatant. Resuspend the cell pellet in 50 µL of Tris-EDTA buffer (pH 8.0).
6. Heat the suspension using a block incubator for 5 min at 95 °C. Centrifuge the suspension for 5 min at 15,000 x g.
7. Transfer the supernatant to a new 1.5 mL microcentrifuge tube (the supernatant will serve as template DNA for the first PCR).

3. PCR Amplification

NOTE: Table 1, Table 2, and Table 3 summarize the PCR primers, reagents, and amplification cycles, respectively.

1. Perform the first PCR using the S. mutans WT and S. mutans ∆gtfC genome as the PCR templates. Amplify the regions harboring the downstream part of the gtfC gene and those harboring spc^r using the primers described in step 1.1.1.2 (Figure 2A).
2. Electrophorese each PCR product on 1% agarose gel. Excise the desired DNA fragments of approximately 1,000 bp and 2,000 bp. Purify the fragments from the gels using silica membrane-based gel extraction method.
   NOTE: The basic procedures for PCR⁹, DNA gel electrophoresis¹⁰, and DNA purification¹¹ are detailed elsewhere.
3. Perform a second PCR using the products of the first PCR (approximately equimolar) as PCR templates with the nested-forward and nested-reverse primers (Figure 2B).
4. Electrophorese one-tenth of the PCR mixture on the agarose gel. Confirm the generation of the appropriate amplicon of approximately 3,000 bp.
5. Precipitate the remaining PCR product.
   NOTE: Purification of the PCR product is not necessary, because non-specific amplicons generated by the second PCR do not interfere with homologous recombination.
   1. Add nuclease-free water to the PCR mixture and bring the total volume to 100 µL, followed by 0.1 volume (10 µL) of 3 M sodium acetate (pH 5.2) and 2.5 volumes (250 µL) of absolute ethanol. Mix and store the mixture for 10 min at room temperature (RT).
   2. Centrifuge the sample for 20 min at 15,000 x g at 4 °C. Discard the supernatant. Add 1 mL of 70% ethanol to wash the DNA pellet.
   3. Centrifuge the sample for 5 min at 15,000 x g at 4 °C. Discard the supernatant. Air-dry and dissolve the DNA pellet with 10 µL of nuclease-free water.

4. Cell Transformation

1. Prepare competent S. mutans WT to introduce the second PCR product by following the steps described in the previous publication⁵. Store the cells at -80 °C.
   NOTE: For this experiment, the competent S. mutans WT cells have already been preserved in -80 °C to generate S. mutans ∆gtfC.
2. Mix 5 μL of the concentrated second PCR product to the 50 μL aliquot of ice-cold competent cells frozen previously. Add the mixture into electroporation cuvettes. Give a single electric pulse (1.8 kV, 2.5 ms, 600 Ω, 10 µF) to the cells using the electroporation apparatus.
3. Resuspend the cells in 500 μL of BHI broth. Immediately, spread 10–100 μL of the suspension onto BHI agar plates containing spectinomycin. Incubate the plates for 2–6 days at 37 °C until colonies have grown sufficiently to be picked up.

5. Verification of Genome Recombination and Storage

1. Perform colony PCR, using gtfC-forward and colony-reverse primers to screen for the recombination. Electrophorese each colony PCR product on an agarose gel. Confirm the DNA fragment of approximately 1,500 bp.
2. Pick one of the positive colonies using a sterilized toothpick and subculture the cells overnight in 2 mL of BHI broth containing spectinomycin.
3. Mix 0.8 mL of bacterial culture with 0.8 mL of sterile 50% glycerol and stock at -80 °C or -20 °C.
4. Transfer the remaining 1 mL of cell suspension to a 1.5 mL microcentrifuge tube. Repeat steps 2.3–2.7 to extract the genomic DNA from the cells.
5. Perform PCR using the up-forward and down-reverse primers and genomic DNA as a template. Repeat step 3.2 to purify the amplified DNA product from the gels.
6. Determine the DNA sequence of the purified amplicon by DNA sequencing.
   NOTE: Make sure to confirm the generation of S. mutans His-gtfC by DNA sequencing.

6. Purification of Polyhistidine-tagged GTF-SI

1. Streak S. mutans His-gtfC onto a spectinomycin-containing BHI agar plate. Incubate them overnight at 37 °C.
2. Pick up a single colony using a sterilized toothpick and subculture cells in 3 mL of BHI broth. Incubate overnight at 37 °C.
3. Prepare two conical flasks with 1 L of BHI broth without spectinomycin. Inoculate 1 mL of the overnight culture suspension into 1 L of the BHI broth. Incubate overnight at 37 °C.
4. Concentrate proteins from the culture supernatant by ammonium sulfate precipitation.
   NOTE: Extract from cell bodies if a target protein is intracellular. The basic procedures for ammonium sulfate precipitation are detailed elsewhere¹².
   1. Centrifuge the bacterial culture suspension for 20 min at 10,000 x g at 4 °C. Recover the culture supernatant into a 3 L glass beaker.
   2. Add 1,122 g of ammonium sulfate to 2 L of the supernatant (80% saturation) with vigorous stirring using a magnetic stirrer. Allow the precipitate to form for 4 h or more at 4 °C with stirring.
      NOTE: The precipitate formation can be continued overnight.
   3. Centrifuge the ammonium sulfate-precipitated solution at 15,000 x g for 20 min at 4 °C. Decant the supernatant.
   4. Collect the precipitate with a spatula and transfer into a 200 mL glass beaker. Resuspend the pellets in 35 mL of binding buffer (50 mM NaH₂PO₄, 300 mM NaCl, 5 mM imidazole, pH 8.0).
   5. Dialyze the suspension against 2,500 mL of the binding buffer using a regenerated cellulose dialysis tubing, at 4 °C, with stirring. Replace the dialysis solution after 2 h and continue dialysis overnight.
   6. Replace the dialysis solution again. Continue to dialyze for an additional 2 h.
5. Centrifuge the dialyzed suspension at 20,000 x g for 10 min at 4 °C. Filter the supernatant through a membrane filter using suction filtration equipment. Transfer the filtrate to a 75 cm² flask.
6. Fractionate the polyhistidine-tagged GTF-SI from the filtrated suspension by immobilized metal affinity chromatography (IMAC).
   1. Transfer 2 mL of the Ni-charged IMAC resin slurry (approximately 1 mL of resin) to a chromatographic column whose outlet is fitted to a silicone tube. Remove the storage solution by the gravity flow.
      CAUTION: Do not allow the resin to dry out throughout the IMAC.
   2. Add 3 mL of distilled water into the column to wash the resin. Add 5 mL of the binding buffer to equilibrate the resin.
   3. Shut off the flow with a Hoffmann pinch cock. Add 5 mL of the filtered suspension from step 6.5 to make the slurry.
   4. Add all the slurry to the remaining filtered suspension. Swirl the mixture gently for 30 min at 4 °C.
   5. Load the mixture back on the column. Remove the suspension by the gravity flow. Wash the IMAC resin with 20 mL of binding buffer.
      NOTE: Adjust the flow rate to approximately 2 mL/min with a Hoffmann pinch cock throughout the subsequent IMAC.
   6. Elute the recombinant GTF-SI with 20 mL of the elution buffer (50 mM NaH₂PO₄, 300 mM NaCl, 500 mM imidazole, pH 8.0).
      NOTE: The protocol can be paused here. The eluate should be stored at 4 °C. IMAC resin can be reused. Refer to the instructions for the IMAC resin.
7. Replace the elution buffer with the storage buffer (50 mM phosphate buffer, pH 6.5) and concentrate the recombinant GTF-SI solution to approximately 1 mL using a centrifugal ultrafiltration unit. Store the recombinant GTF-SI solution at 4 °C.
   NOTE: Confirm the polyhistidine-tagged GTF-SI purification using SDS-PAGE¹³ and western blotting¹⁴ by employing a horseradish peroxidase-conjugated anti-polyhistidine monoclonal antibody. Addition of CHAPS (final concentration, 0.1%) to the eluent may be required to avoid nonspecific adsorption to the unit, depending on the target protein.

7. Functional Restoration by Recombinant GTF-SI

1. Streak each S. mutans strain onto a BHI agar plate individually. Incubate the plates overnight at 37 °C.
2. Using a sterilized toothpick, pick up a single colony to inoculate into 2 mL of BHI broth. Incubate overnight at 37 °C.
3. Use 20 μL of the overnight culture of S. mutans ∆gtfC to inoculate 2 mL of BHI broth containing 1% sucrose without antibiotics in a glass test tube. Add the GTF-SI or an equivalent volume of the vehicle to the S. mutans ∆gtfC culture, and culture the cells with the tube placed in an inclined position overnight.
   NOTE: Sterilize the GTF-SI solution with a sterile syringe filter and determine protein concentration using a bicinchoninic acid protein assay¹⁵ before use.
4. Agitate the culture suspensions with a vortex mixer for 10 s. Decant the suspensions. Wash the test tubes with a sufficient amount of distilled water.
5. Stain the biofilms on the tube wall with 1 mL of 0.25% Coomassie brilliant blue (CBB).
6. Decant the staining solution after 1 min. Wash the test tubes with a sufficient amount of distilled water. Air-dry the test tubes.

Representative Results

Figure 3 shows the size of each amplicon from the first PCR (Figure 3A) and second PCR (Figure 3B). The size of each amplicon corresponded with the predicted size, as described in Table 1. Figure 4A shows S. mutans colonies transformed with the second PCR product and plated on the BHI agar plates containing spectinomycin. Colony PCR products were then run on the agarose gel (Figure 4B). Each amplicon was of the predicted size, as described in Table 1. Figure 5 shows images of SDS-PAGE and western blot. Protein purified with IMAC was observed as a single band by SDS-PAGE (Figure 5A). Western blot was performed using the anti-polyhistidine antibody to confirm that the observed band was the expected polyhistidine-tagged protein (Figure 5B) of 160 kDa. Figure 6 shows the sucrose-derived biofilm-forming ability of each S. mutans strain. Only S. mutans WT and S. mutans His-gtfC could form an adherent biofilm on the tube wall in the presence of 1% sucrose. This was not observed in S. mutans ΔgtfC (Figure 6A). However, the addition of the recombinant GTF-SI restored the adherent biofilm formation ability in S. mutans ΔgtfC (Figure 6B).

Figure 1: Organization of gtfC and spc^r loci in the S. mutans UA159 genome and its derivatives. A schematic illustration of the His-tag between gtfC and spc^r. The lengths of the genes and gaps are not to scale. Shaded pentagon: SMU_1004; solid pentagon: SMU_1006. This figure has been modified from a previous publication². Please click here to view a larger version of this figure.

Figure 2: Strategy for two-step fusion PCR. A schematic illustration of S. mutans His-gtfC construction. The lengths of the genes and gaps are not to scale. The primer-binding sites in the template are indicated by patterns. (A) The regions harboring part of the gtfC gene in the S. mutans WT genome and harboring spc^r in the S. mutans ΔgtfC genome were amplified using the first PCR. (B) The second PCR was performed with nested primers using the two fragments that were amplified by the first PCR as templates, and a DNA construct for homologous recombination was obtained. (C) The mutant strain was generated upon homologous recombination in the bacteria. This figure has been modified from a previous publication². Please click here to view a larger version of this figure.

Figure 3: Agarose gel electrophoresis of first and second PCR products. (A) Products of the first PCR of a part of gtfC (gtfC; left image) and the region harboring spcr (spcr; right image) are shown. The single electrophoretic image is divided to label the marker bands. (B) The second PCR products amplified with the nested primers are shown. Each arrowhead indicates the predicted size of each PCR product. M = molecular marker. Please click here to view a larger version of this figure.

Figure 4: Colony PCR to screen generation of S. mutans His-gtfC. (A) S. mutans colonies transformed by the second PCR product are shown. Colony ID is indicated by circled numbers. (B) Agarose gel electrophoresis of the colony PCR products is shown. Circled lane number corresponds to the colony ID in Figure 4A. M = molecular marker. Please click here to view a larger version of this figure.

Figure 5: Confirmation of polyhistidine-tagged GTF-SI purification. (A) Representative SDS-PAGE image is shown. (B) Representative western blot image is shown. A nitrocellulose membrane on which GTF-SI was transferred was probed with a horseradish peroxidase-conjugated anti-polyhistidine monoclonal antibody. Immunoreactive bands were visualized using a chemiluminescence reaction. The arrowheads indicate the predicted size of the recombinant GTF-SI. M: molecular marker; 1 = sample prior to IMAC; 2 = sample obtained by IMAC. Please click here to view a larger version of this figure.

Figure 6: Functional restoration by addition of the recombinant GTF-SI. (A) The ability of sucrose-derived adherent biofilm formation is shown for each S. mutans strain. (B) The ability of forming adherent biofilms was restored in S. mutans ΔgtfC by addition of recombinant GTF-SI (25 µg). WT = S. mutans WT; ΔgtfC = S. mutans ΔgtfC; His-gtfC = S. mutans His-gtfC. Please click here to view a larger version of this figure.

Primer pairs	Sequence (5′ to 3′)			Expected band size (bp)
1st PCR
gtfC-forward gtfC-reverse A,B	TAAAGGTTATGTTTATTATTCAACGAGTGGTAACC ATGATGATGATGATGACTACCACCACCTCCAAATCTAAAGAAATTGTCAA			1,090
spcr-forward A,C spcr-reverse	GGTGGTAGTCATCATCATCATCATCATTAAATCGATTTTCGTTCGTGAAT TTAAGAGCAAGTTTAAGATAGAACATGTTACTCAC			2,232
2nd PCR
Nested-forward Nested-reverse	TGGTATTATTTCGATAATAACGGTTATATGGTCAC GCCATACTTAGAGAAATTTCTTTGCTAAATTCTTG			3,179
Verification of recombination
Colony PCR
gtfC-forward Colony-reverse	TAAAGGTTATGTTTATTATTCAACGAGTGGTAACC CCACTCTCAACTCCTGATCCAAACATGTAAGTACC			1,482
Final verification
Up-forward Down-reverse	TACGGCCGTATCAGTTATTACGATGCTAACTCTGG TTGTCCACTTTGAAGTCAACGTCTTGCAAGGCATG			6,173

Table 1: Primers used in the protocol. ^AThe underlined sequences of 'gtfC-reverse and spc^r-forward' are complementary, and the bold-typed sequencescode for the His-tag (gtfC-reverse; ATGATGATGATGATG, spc^r-forward; CATCATCATCATCATCAT) and GS linker (gtfC-reverse; ACTACCACCACCTCC, spc^r-forward; GGTGGTAGT). ^BThe DNA stop codon of gtfC has been removed. ^CA DNA stop codon (TAA) has been added immediately after the polyhistidine-coding sequences.

Reagent	Concentration of stock solution	Volume	Final concentration
DNA polymerase premix	2x	25 μL	1x
Forward primer	5 µM	2 μL	0.2 µM
Reverse primer	5 µM	2 μL	0.2 µM
Template DNA	Variable	Variable	Variable
Deionized water	-	Up to 50 μL	-

Table 2: PCR reagents: For the first PCR, 2 µL of the DNA template was added. For the second PCR, 0.5-2 µL of first PCR amplicon was added to the reaction mixture. For colony PCR, bacterial cells were directly added to the reaction mixture.

Step	Temperature	Time	Number of cycles
Initial denaturation	98 °C	2 min	1
Denaturation Annealing Extension	98 °C 50 °C 72 °C	10 s 5 s Amplicon-dependent (1 min/1 kbp)	35
Final extension	72 °C	Amplicon-dependent (1 min/1 kbp)	1

Table 3: PCR amplification cycles.

Discussion

The design of primers is the most critical step in the protocol. The sequences of the gtfC-reverse and spc^r-forward primers were automatically determined based on the sequences of both the 3′ end region of gtfC and the 5′ end region of spc^r. Each primer includes 24 complementary bases that encode a GS linker and a His-tag-coding sequence at their 5' regions. Disruption of the native regulatory sequences located in the upstream flanking regions can be avoided by the addition of His-tag-coding sequences to the 3′ end. The DNA stop codon must be removed from the gtfC-reverse primer and added to the spc^r-forward primer. Moreover, the gtfC-forward and spc^r-reverse should be designed to amplify flanking regions of approximately 1 kb upstream and downstream of the target region of homologous recombination in the S. mutans WT genome, respectively. Addition of long flanking sequences improves the efficiency of homologous recombination. The nested primers were designed to be used instead of the outermost primer pair (gtfC-forward and spc^r-reverse) in this protocol. Inclusion of nested primers is required for the second PCR, as detailed elsewhere⁵.

Transformation by electroporation is efficient¹ and procedures for competent cell preparation preceding electroporation are also much simpler compared to the alternative methods^16,17,18, although an electroporation apparatus is required. It is strongly recommended to prepare competent S. mutans WT anew in case of missing colonies on the plate after electroporation. Although incubation for a couple of hours after electroporation may improve transformation efficiency, the extra incubation does not affect success of the transformation. Cells in the log growth phase should be used for the competent cell preparation, as described previously⁵.

Since the amount of recombinant protein depends on the native expression of the gene, scale-up culture may be required in cases of proteins with lower expression.The method presented here is limited by the application of the functional restoration assay. The addition of gene of interest cannot be applied to intracellular proteins exogenously. However, the developed method presents considerable advantages in terms of facility, efficiency, and cost (e.g., no enzymatic reactions other than PCR) when working with the extracellular target protein. Additionally, the purification of the recombinant protein and confirmation of actual gene expression can be performed simply using common His-tag applications, as shown in Figure 5.

The present method, including gene disruption and gene product isolation, may be adapted for future use in other species as serial experiments for the functional analysis of a gene of interest.

Materials

Name	Company	Catalog Number	Comments
Agarose	Nippon Genetics	NE-AG02	For agarose gel electrophoresis
Anaeropack	Mitsubishi Gas Chemical	A-03	Anaerobic culture system
Anti-His-Tag monoclonal antibody	MBL	D291-7	HRP-conjugated
BCA protein assay kit	Thermo Fisher Scientific	23227	Measurement of protein concentration
Brain heart infusion broth	Becton, Dickinson	237500	Bacterial culture medium
CBB R-250	Wako	031-17922	For biofilm staining
Centrifugal ultrafiltration unit	Sartorius	VS2032	Buffer replacement and protein concentration
Centrifuge	Kubota	7780II
Chromatographic column	Bio-Rad	7321010	For IMAC
Dialysis membrane clamp	Fisher brand	21-153-100
Dialysis tubing	As One	2-316-06
DNA polymerase	Takara	R045A	High-fidelity DNA polymerase
DNA sequencing	Eurofins Genomics
ECL substrate	Bio-Rad	170-5060	For western blotting
EDTA (0.5 M pH 8.0)	Wako	311-90075	Tris-EDTA buffer preparation
Electroporation cuvette	Bio-Rad	1652086	0.2 cm gap
Electroporator	Bio-Rad	1652100
EtBr solution	Nippon Gene	315-90051	For agarose gel electrophoresis
Gel band cutter	Nippon Genetics	FG-830
Gel extraction kit	Nippon Genetics	FG-91202	DNA extraction from agarose gel
Imager	GE Healthcare	29083461	For SDS-PAGE and western blotting
Imidazole	Wako	095-00015	Binding buffer and elution buffer preparation
Incubator	Nippon Medical & Chemical Instruments	EZ-022	Temperature setting: 4 °C
Incubator	Nippon Medical & Chemical Instruments	LH-100-RDS	Temperature setting: 37 °C
Membrane filter	Merck Millipore	JGWP04700	0.2 µm diameter
Microcentrifuge	Kubota	3740
NaCl	Wako	191-01665	Preparation of binding buffer and elution buffer
NaH2PO4·2H2O	Wako	192-02815	Preparation of binding buffer and elution buffer
NaOH	Wako	198-13765	Preparation of binding buffer and elution buffer
(NH4)2SO4	Wako	015-06737	Ammonium sulfate precipitation
Ni-charged resin	Bio-Rad	1560133	For IMAC
PCR primers	Eurofins Genomics	Custom-ordered
Protein standard	Bio-Rad	161-0381	For SDS-PAGE and western blotting
Solvent filtration apparatus	As One	FH-1G
Spectinomycin	Wako	195-11531	Antibiotics; use at 100 μg/mL
Sterile syringe filter	Merckmillipore	SLGV004SL	0.22 µm diameter
Streptococus mutans ΔgtfC	Stock strain in the lab.		gtfC replaced with spcr
Streptococus mutans UA159	Stock strain in the lab.		S. mutans ATCC 700610, Wild-type strain
Sucrose	Wako	196-00015	For biofilm development
TAE (50 × )	Nippon Gene	313-90035	For agarose gel electrophoresis
Thermal cycler	Bio-Rad	PTC-200
Tris-HCl (1 M, pH 8.0)	Wako	314-90065	Tris-EDTA buffer preparation