In case of TTC28-LINE-1, there is more than one PAS within a 1 kb window downstream of its cognate PAS, hence the region between the TTC28-LINE-1 PAS and strongest PAS at 811 bp downstream was considered as the unique tag for TTC28-LINE-1. Three inverse PCR primer pairs were designed at this unique tag that correspond to different PASs present14. We selected three restriction enzymes: (i) NsiI that cuts 5´ upstream of TTC28-LINE-1 and 3´ outside the unique tag, and (ii) SacI and (iii) PstI that cut 5´ within the LINE-1 in its far 5´ end, and 3´ outside the unique tag. These generate restriction fragments of 10,288 bp, 5,699 bp, and 6,305 bp respectively.
In order to demonstrate this method, we performed LDI-PCR on DNA extracted from MCF7 cell line. This breast cancer cell line has been previously reported to display TTC28-LINE-1 activity16. For simplicity, we made a circular DNA template using one restriction enzyme, SacI, out of three and performed an LDI-PCR using one primer pair out of three (Table 1) to detect de novo LINE-1 insertions stemming from TTC28-LINE-1.
Good quality of DNA extracted from MCF7 cell line was ensured by agarose gel electrophoresis (Figure 2). Intact high molecular weight DNA shows that the genomic DNA is of optimum quality for this assay. If a smear is visible instead, this indicates poor quality of the extracted DNA, which in turn will hamper downstream procedures.
Figure 3 shows a representative result of a gradient PCR experiment, aimed at determining the optimal annealing temperature of the TTC28-LINE-1 inverse primer pair. Blood genomic DNA digested with SacI, followed by self-ligation to form a circular DNA template, was used for this reaction. A highly specific PCR product of expected size (5,649 bp) at 62, 64 and 66 °C shows that the optimum annealing temperature for this primer pair lies within the range of 62−66 °C.
We generated a circular DNA template by digesting MCF7 genomic DNA with the SacI restriction enzyme followed by self-ligation. Figure 4 shows that TTC28-LINE-1 3´ transduction occurs in MCF7 cell lines: de novo insertions can be detected as LDI-PCR products of varying sizes along with a native PCR product of known size (5,649 bp). To identify genomic coordinates of the de novo target sites, PCR amplicons can be sequenced (see protocol section 4).

Figure 1: Overview of LDI-PCR to detect LINE-1 3´ transduction. A circular DNA template is generated by first digesting (I) it with a restriction enzyme and self-ligating (II) it. This step is followed by inverse PCR (III) with inverse PCR primers targeted to the unique tag of the LINE-1 of interest (sequence between LINE-1's own weaker PAS, in pink, and stronger PAS downstream, in red). Please click here to view a larger version of this figure.

Figure 2: Quality assessment of extracted DNA. 100 ng of DNA extracted from the MCF7 cell line and blood from a normal individual, which will be used as a control sample, were run alongside 1 µL and 2 µL of λ DNA/HindIII marker labelled as M. Please click here to view a larger version of this figure.

Figure 3: Gradient PCR to determine optimal annealing temperature for inverse PCR primers (Table 1). LDI-PCR using inverse primer pairs at annealing temperature ranging from 56 to 66 °C shows a distinct PCR product at 62−66 °C. Green arrow indicates the selected annealing temperature for future experiments. Circular DNA template generated by digesting blood genomic DNA from a normal individual with SacI followed by self-ligation was used for this optimization step. M, marker (1 kb plus DNA ladder). Please click here to view a larger version of this figure.

Figure 4: LDI-PCR to identify LINE-1 3´ transduction stemming from TTC28-LINE-1. Circular DNA templates generated by digesting MCF7 and blood (from normal individual) genomic DNA with SacI followed by self-ligation were amplified by inverse primers in optimum annealing temperature. "Native" PCR product, marked with asterisk, of expected size (5,649 bp) was detected in both MCF7 DNA and normal blood DNA, while MCF7 also produced additional PCR products of varying sizes, indicating de novo LINE-1 retrotransposition. M, marker (1 kb DNA ladder). Please click here to view a larger version of this figure.
| Primer name | Sequence (5´→ 3´) |
| L1_001 (rev) | TTCACTAAGCATGTATGTGGAAAAC |
| L1_002 (fwd) | CCCAAAATATACCCAATTACTGGCA |
Table 1: Inverse PCR primer pair designed for the unique tag of TTC28-LINE-114.
Supplemental File. Please click here to download this file.