Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

Summary

Macrophages, especially primary macrophages, are challenging to transfect as they specialize in detecting molecules of non-self origin. We describe a protocol that allows highly efficient transfection of primary macrophages with mRNA generated from DNA templates such as plasmids.

Abstract

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern recognition receptors (PRRs). Unfortunately, this also makes macrophages particularly challenging to transfect as the transfection reagent and the transfected nucleic acids are often recognized by the PRRs as non-self. Therefore, transfection often results in macrophage activation and degradation of the transfected nucleic acids or even in suicide of the macrophages. Here, we describe a protocol that allows highly efficient transfection of murine primary macrophages such as peritoneal macrophages (PM) and bone marrow-derived macrophages (BMDM) with mRNA in vitro transcribed from DNA templates such as plasmids. With this simple protocol, transfection rates of about 50-65% for PM and about 85% for BMDM are achieved without cytotoxicity or immunogenicity observed. We describe in detail the generation of mRNA for transfection from DNA constructs such as plasmids and the transfection procedure.

Introduction

Macrophages are phagocytic cells that specialize in detecting, ingesting and degrading microbes, apoptotic cells and cellular debris. Moreover, they help to orchestrate immune responses by secreting cytokines and chemokines and by presenting antigens to T cells and B cells. Macrophages also play important roles in numerous other processes, such as wound healing, atherosclerosis, tumorigenesis and obesity.

To be able to detect non-self molecules such as pathogen-associated molecular patterns (PAMPs) and out-of-place molecules such as damage-associated molecular patterns (DAMPs), macrophages are equipped with a large array of pattern recognit....

Protocol

Macrophage isolation from mice was performed in accordance with the Animal Protection Law of Germany in compliance with the Ethics Committee at the University of Cologne.

NOTE: Carry out all steps wearing gloves. Carry out all transfection steps under a laminar flow hood to prevent contamination of the cells. Before working with mRNA, clean all instruments such as pipettes and every surface with 70% ethanol and/or a RNAse-degrading surfactant (Table of Materials). Ensure that all reaction tubes are RNAse-free and sterile. Use only sterile, RNAase-free water for dilutions. Exclusively use pipette tips with f....

Results

We have successfully used this protocol to generate mRNA encoding for FLAG-tagged NEMO and IKKβ variants for transfection of primary macrophages¹⁶. The plasmids encoding for FLAG-tagged wild-type (NEMO^WT) and C54/347A mutant NEMO (NEMO^C54/374A) (see the Table of Materials) already contain a T7 promotor in the correct orientation (Figure 1A). Thus, we only had to linearize the plas.......

Discussion

Here we present a protocol for highly efficient transfection of usually hard-to-transfect primary macrophages with in vitro transcribed mRNA. Importantly, transfection of the macrophages using this protocol does not induce cell death or activate proinflammatory signaling indicating that neither the transfection reagent nor the transfected mRNA are recognized as non-self.

The quality of the mRNA is of key importance for successful transfection of macrophages using this protocol. Thus, great car.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
5-methyl-CTP (100 mM)	Jena Biosience	NU-1138S	stored at -20 °C
Antarctic phosphatase	New England BioLabs	M0289	stored at -20 °C
Antarctic phosphatase reaction buffer (10x)	New England BioLabs	B0289	stored at -20 °C
anti-NEMO/IKKγ antibody	Invitrogen	MA1-41046	stored at -20 °C
anti-β-actin antibody	Sigma-Aldrich	A2228	stored at -20 °C
Petri dishes 92,16 mm with cams	Sarstedt	821,473	stored at RT
CD11b Microbeads mouse and human	Miltenyi Biotec	130-049-601	stored at 4 °C
Cre recombinase + T7-Promotor forward primer	Sigma-Aldrich		5′-GAAATTAATACGACTCACTATA GGGGCAGCCGCCACCATGTCC AATTTACTGACCGTAC-3´, stored at -20 °C
Cre recombinase + T7-Promotor reverse primer	Sigma-Aldrich		5′-CTAATCGCCATCTTCCAGCAGG C-3′, stored at -20 °C
DNA purification kit: QIAquick PCR purification Kit	Qiagen	28104	stored at RT
eGFP + T7-Promotor forward primer	Sigma-Aldrich		5´-GAAATTAATACGACTCACTATA GGGATCCATCGCCACCATGGTG AGCAAGG-3´, stored at -20 °C
eGFP + T7-Promotor reverse primer	Sigma-Aldrich		5´-TGGTATGGCTGATTA TGATCTAGAGTCG-3´, stored at -20 °C
Fast Digest buffer (10x)	Thermo Scientific	B64	stored at -20 °C
FastDigest XbaI	Thermo Scientific	FD0684	stored at -20 °C
High-fidelity polymerase with proofreading: Q5 High-Fidelity DNA-Polymerase	New England Biolabs Inc	M0491S	stored at -20 °C
IKKβ + T7-Promotor forward primer	Sigma-Aldrich		5′-GAAATTAATACGACTCACTATA GGGTTGATCTACCATGGACTACA AAGACG-3′, stored at -20 °C
IKKβ + T7-Promotor reverse primer	Sigma-Aldrich		5′-GAGGAAGCGAGAGCT-CCATCTG-3′, stored at -20 °C
In vitro mRNA transcription kit: HiScribe T7 ARCA mRNA kit (with polyA tailing)	New England BioLabs	E2060	stored at -20 °C
LS Columns	Miltenyi Biotec	130-042-401	stored at RT
MACS MultiStand	Miltenyi Biotec	130-042-303	stored at RT
mRNA transfection buffer and reagent: jetMESSENGER	Polyplus transfection	409-0001DE	stored at 4 °C
Mutant IKKβ IKK-2S177/181E plasmid	Addgene	11105	stored at -20 °C
Mutant NEMOC54/347A plasmid	Addgene	27268	stored at -20 °C
pEGFP-N3 plasmid	Addgene	62043	stored at -20 °C
poly(I:C)	Calbiochem	528906	stored at -20 °C
pPGK-Cre plasmid			F.T. Wunderlich, H. Wildner, K. Rajewsky, F. Edenhofer, New variants of inducible Cre recombinase: A novel mutant of Cre-PR fusion protein exhibits enhanced sensitivity and an expanded range of inducibility. Nucleic Acids Res. 29, 47e (2001). stored at -20 °C
pseudo-UTP (100 mM)	Jena Biosience	NU-1139S	stored at -20 °C
QuadroMACS Separator	Miltenyi Biotec	130-090-976	stored at RT
Rat-anti-mouse CD11b antibody, APC-conjugated	BioLegend	101212	stored at 4 °C
Rat-anti-mouse F4/80 antibody, PE-conjugated	eBioscience	12-4801-82	stored at 4 °C
Recombinant M-CSF	Peprotech	315-02	stored at -20 °C
RNA purification kit: MEGAclear transcription clean-up kit	ThermoFisher Scientific	AM1908	stored at 4 °C
RNAse-degrading surfactant: RnaseZAP	Sigma-Aldrich	R2020	stored at RT
Ultrapure LPS from E.coli O111:B4	Invivogen		stored at -20 °C
Wild type IKKβ plasmid	Addgene	11103	stored at -20 °C
Wild type NEMO plasmid	Addgene	27268	stored at -20 °C