A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

Summary

This article presents a protocol to investigate the effect of individual mosquito gut bacteria, including isolation and identification of mosquito midgut cultivable microbes, antibiotic depletion of mosquito gut bacteria, and reintroduce one specific bacteria species.

Abstract

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been conducted to investigate the effect of gut microbes as a whole; however, different microbes could exert distinct effects toward the host. This article provides the methodology to study the effect of each specific mosquito gut microbe and the potential mechanism.

This protocol contains two parts. The first part introduces how to dissect the mosquito midgut, isolate cultivable bacteria colonies, and identify bacteria species. The second part provides the procedure to generate antibiotic-treated mosquitoes and reintroduce one specific bacteria species.

Introduction

Mosquitoes are considered to be the most important vectors of human pathogenic diseases, transmitting over a hundred pathogens including Zika virus, Dengue virus, and Plasmodium parasites¹. When mosquitoes take a blood meal to acquire nutrients for oviposition, they can accidentally ingest pathogens from an infected host via the digestive tract². Importantly, the mosquito midgut, which plays a pivotal role in both blood meal digestion and pathogen entrance, harbors a highly dynamic microbiome³.

Several studies have characterized lab-reared and field-collected mosquito microbiota using either a culture-dependent method or a bacteria sequencing assay^4,5,6. Species including Pantoea, Serratia, Klebsiella, Elizabethkingia, and Enterococcus are commonly isolated from mosquitoes in various studies^5,7,8,9. Interestingly, mosquito gut microbiota fluctuates dynamically in both the community diversity and the amount of bacteria species, affected by the development stage, species, geographical origin, and feeding behavior⁴. Studies show that blood feeding dramatically increases the total bacterial load with rapid expansion of species from Enterobacteriaceae and a reduction in overall diversity^10,11. In addition, mosquito gut microbiota of the larval stage is usually eradicated when the insect undergoes metamorphosis during pupation and eclosion; thus, newly emerged adult mosquitoes need to repopulate their microbiota⁴.

Gut microbiota modulates insect physiology in various aspects, including nutrient absorption, immunity, development, reproduction, and vector competence¹². Axenic mosquito larvae fail to develop beyond the first instar while a bacteria oral supply rescues development, indicating that the mosquito gut microbe is essential for larval development^13,14. Besides, depletion of gut bacteria retards blood meal digestion and nutrient absorption, affects oocyte maturation, and decreases oviposition¹⁵. In addition, mosquitoes with gut microflora elicit higher immune responses compared to antibiotic-treated mosquitoes, with constantly elevated antimicrobial peptide expression against other pathogens to infect¹⁶. Antibiotics are usually orally administered to remove pan gut bacteria in these studies, and then experiments are conducted to compare the difference between axenic mosquitoes and mosquitoes with commensal microbes. However, the mosquito midgut harbors a diverse community of microbes, and each bacteria species could exert a distinct effect toward the host physiology.

Mosquito microbiota regulates vector competence with divergent effects. Colonization by Proteus isolated from field-derived mosquitoes of dengue-endemic areas confers upregulated antimicrobial peptide expression and resistance against dengue virus infection¹⁶. The entomopathogenic fungus Beauveria bassiana activates the Toll and JAK-STAT immune pathway against arbovirus infection¹⁷. By contrast, the fungus Talaromyces isolated from Aedes aegypti midgut facilitates dengue virus infection by modulating gut trypsin activity¹⁸. In addition, Serratia marcescens promotes arbovirus transmission through a secretory protein called SmEnhancin, which digests the mucin layer on the intestinal epithelium of mosquitoes¹⁹.

This procedure provides a systematic and intuitive method for dissection of the mosquito midgut, isolation of cultivable bacteria colonies, identification of the bacteria species, and reintroduction via oral feeding. It provides representative results of blood feeding with a commensal bacterium, Chryseobacterium meningosepticum, on mosquito ovary development and oviposition.

Protocol

1. Midgut dissection and cultivable bacteria isolation

1. Prepare the mosquito for dissection.
   1. Collect the mosquitoes 7–9 days after emergence with an aspirator. Anesthetize the collected mosquitoes by subjecting them to a temperature of 4 °C for 3–5 min and keep the mosquitoes anesthetized in an ice-cold Petri dish until dissection.
2. Sterilize laboratory instruments and the mosquito surface.
   1. Sterilize the experiment bench, dissecting microscope, forceps, and glass slide by spraying 75% ethanol to avoid contamination by bacteria from the environment.
   2. Prepare a sterile Petri dish containing 75% ethanol and two Petri dishes containing sterile 1x phosphate buffered saline (1x PBS).
   3. Surface-sterilize the mosquito by dipping and shaking them in 75% ethanol for 3 min, and rinse twice with 1x PBS buffer in case the ethanol affects the dissected gut flora.
3. Dissect the mosquito midgut.
   1. Transfer the surface-sterilized mosquito onto the glass slide with a drop of sterile 1x PBS buffer. Dissect under the dissecting microscope.
   2. Under the lower magnification of the dissecting microscope, carefully remove the legs, wings, and head of the mosquito to prevent escape. Remove the last somite of the mosquito by cutting directly, rather than pulling it, to prevent the digestive tract from breaking.
   3. Clamp the mosquito's thorax and the end of the abdomen with forceps. Gently pull out the mosquito's digestive tract. The acquired digestive tract usually contains the crop, foregut, midgut, hindgut, and the Malpighian tubes.
   4. Adjust the dissecting microscope to a higher magnification. Remove the crop, foregut, hindgut, and the Malpighian tubes from the dissected digestive tract to get the midgut of the mosquito.
   5. Take care while removing the crop, as the crop inflates and resembles the midgut after the mosquito takes a sugar meal. The Malpighian tubes, a group of long and thin excretory tubes, are located at the boundary between the midgut and the hindgut.
4. Isolate gut bacteria.
   1. Transfer the dissected midgut to a sterile 1.5 mL tube with 200 µL of sterile 1x PBS buffer.
   2. Grind the midgut on a sterile bench thoroughly with a sterile pestle to allow complete releasing of gut bacteria to the buffer.
   3. Serial dilute the homogenate to three 10-fold dilutions. Add 50 µL of each dilution to the LB (Luria broth) agar plate, and then spread it on the plate. If the midgut contains a high concentration of gut flora, it is essential to make more serial dilutions to pick out single colonies.
   4. Incubate the plate at 37 °C for 1–2 days until single colonies are visible.
5. Species identification
   1. Pick single colonies and inoculate them respectively into a 150 mL conical flask containing 50 mL of LB broth medium.
   2. Shake the bacteria at 37 °C overnight.
   3. Extract total DNA by bacterial genomic DNA extraction kit. Amplify 16S rDNA by polymerase chain reaction (PCR).
      NOTE: There are multiple segments in 16S rDNA that are conserved. Based on these conserved regions, universal primers for bacteria can be designed to amplify 16S rDNA fragments of all bacteria. These primers are specific to bacteria, and the difference in the variable region of 16S rDNA can be used to distinguish different bacteria. Therefore, 16S rDNA is widely used for bacterial identification.
   4. Recover and purify DNA fragments from PCR products by agarose gel electrophoresis and a commercial gel recovery kit.
   5. Perform DNA sequencing on the purified DNA fragments to obtain bacterial gene sequences.
   6. Compare the 16S rRNA gene sequence with the bacterial sequence available in GenBank. Select the Bacteria and Archaea database.
      NOTE: Identification to the species level was defined as ≥99% 16S rDNA sequence similarity to the closest GenBank entry. The isolate was assigned to the corresponding genus when its 16S rDNA sequence similarity was <99% and ≥95%.

2. Antibiotic treatment and bacterium reintroduction

1. Prepare the antibiotic solution.
   1. Weigh the required amount of sucrose, penicillin, and streptomycin to prepare a 10% sucrose solution including 20 units of penicillin and 20 µg of streptomycin per mL.
2. Feed mosquitoes with the antibiotic solution.
   1. Anesthetize the mosquitoes in 4 °C for 3–5 min. Transfer the mosquitoes to a paper cup. Cover the top with gauze and enwind the gauze with tape to prevent mosquitoes from escaping.
   2. Dip sterile cotton balls into the antibiotic solution and place them carefully on the mosquito cup. Squeeze the cotton balls before use to prevent mosquitoes from drowning in the dripping cotton balls.
   3. Cover the cotton balls with a 10 cm Petri dish to prevent moisture evaporation. Replace the cotton balls twice a day for three consecutive days.
3. Confirm the effectiveness of the antibiotic treatment.
   1. According to the above method, dissect the midgut of antibiotic-treated mosquitoes.
   2. Transfer the dissected midguts to a sterile 1.5 mL tube with 200 µL of sterile 1x PBS buffer.
   3. Grind midguts in a sterile bench thoroughly with a sterile pestle to allow complete release of gut bacteria to the buffer.
   4. Extract the gut microbial DNA by bacterial genomic DNA extraction kit.
   5. Perform bacterial quantitation by real-time quantitative PCR (qPCR) on genomic DNA using universal eubacteria primers (16S rRNA F: TCCTACGGGAGGCAGCAGT and R: GGACTACCAGGGTATCTAATCCTGTT).
4. Preparation of bacterial suspension
   1. Measure the bacterial solution with a spectrophotometer. Add 1 OD (OD600) bacterial suspension into a 1 mL tube. Centrifuge the suspension at 5,000 x g for 5 min at 4 °C.
   2. Discard the supernatant and add 1 mL of sterile 1x PBS buffer to 1.5 mL tube for suspension precipitation.
   3. Centrifuge at 5,000 x g for 5 min at 4 °C; discard the supernatant.
   4. Repeat steps 2.4.2 and 2.4.3.
   5. Add 200 µL of sterile 1x PBS buffer to the bacterial precipitation.
   6. Add 600 µL of 10% sucrose solution, 200 µL of 10 mm ATP (which acts as a phagostimulant), and 200 µL of bacterial suspension into a sterile 1.5 mL tube. Mix by vortexing. Alternatively, suspend bacterial pelleted in heat-inactivated blood.
   7. Preparation of heat-inactivated blood
      1. Collect fresh blood with an anticoagulant tube.
      2. Take 2–3 mL of fresh blood. Centrifuge at 1,000 x g for 10 min at 4 °C to separate plasma and blood cells. Note that the blood will be lost during the centrifugation and washing process; there is a need to calculate the usage in advance.
      3. Collect the plasma into a new 1.5 mL tube and heat-inactivate at 56 °C for 1 h.
      4. Add 500 µL of sterile 1x PBS buffer to 1.5 mL tube for suspension of blood cells. Centrifuge at 1,000 x g for 10 min at 4 °C and then discard the supernatant.
      5. Repeat step 2.4.7.4 twice.
      6. Resuspend blood cells with heat-inactivated plasma to obtain heat-inactivated blood.
      7. Follow steps 2.4.1 to 2.4.4 to get 1 OD bacterial pelleted.
      8. Resuspend the bacteria pelleted with 1 mL of heat-inactivated blood.
5. Feed the mosquito with bacteria suspension.
   1. Starve the mosquitoes for 24 h, allowing antibiotics to metabolize before feeding bacteria.
   2. Assemble the membrane-feeding system.
   3. Seal the sterilized feeder unit with a parafilm, alternatively a collagen membrane.
   4. Put on a plastic ring and fix it with parafilm to avoid breaking due to friction during feeding.
   5. Slowly add the prepared bacterial solution to the feeder unit. Note that only one well of the two-well feeder unit can be filled with the solution and cover the feeder unit only from the reagent dropping side.
   6. Connect the feeder unit to a feeding system preheated to 37 °C, which simulates human temperature to attract mosquitoes. Place the feeding device on a paper cup filled with mosquitoes and feed for 90 min.
   7. After feeding, anesthetize the mosquitoes by subjecting them to a temperature of 4 °C for 3–5 min and keep the mosquitoes anesthetized in an ice-cold Petri dish.
   8. Pick the fully engorged mosquitoes for further studies.

Results

The midguts of mosquitoes treated with antibiotics and without antibiotics were taken out for DNA extraction, and qPCR was performed with universal bacterial primers. Figure 1 shows the expression of bacterial 16S rRNA in the control group and antibiotic treatment group. The results show that about 98% of the gut bacteria have been removed, and the gut sterilization of penicillin and streptomycin was successful.

With the methods described, bacteria strains were isolated and id...

Discussion

Research on host-microbe interactions have found that different gut microbes affect their host physiology via divergent mechanisms. This article introduces the method to investigate the respective role of mosquito gut microbe, including dissecting mosquito midgut, culturing cultivable gut bacteria, antibiotic treatment, and reintroducing the bacteria of interest.

For successful antibiotic treatment, the following details must be considered in conducting the experiment. In this protocol, mosqui...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Adenosine 5′-triphosphate disodium salt hydrate	Sigma	A2383	Adenosine 5′-triphosphate disodium salt hydrate has been used to prepare adenosine triphosphate (ATP) standard solutions
Aedes aegypti			Female mosquitoes
Anticoagulant tube	BD Vacutainer	363095	Collect fresh blood
Centrifuge tube	Sangon Biotech	F601620-0010	1.5 ml, Natural, Graduated, Sterile
Cotton balls
Disposable Tissue Grinding Pestle	Sangon Biotech	F619072-0001	70 mm Long, Conical, Blue, Sterile
Ethanol absolute	Paini		Dilute it to 75% ethanol
Forceps	RWD	F11029	Dissection
Hemotek Membrane Feeding System	Hemotek		Components of the feeding system, including  Hemotek temperature controller, feeder-housing assembly, metal feeder assembled.
Incubator shaker		ZQZY-78AN
Inoculation Loops	Sangon Biotech	F619312-0001	10 μl, Yellow
LB Agar Powder	Sangon Biotech	A507003	Tryptone 10.0 g, Yeast Extract 5.0 g, NaCl 10.0 g, Agar 15.0 g.
LB Broth Powder	Sangon Biotech	A507002	Tryptone 10.0 g, Yeast Extract 5.0 g, NaCl 10.0 g.
Microscope	Zeiss	Stemi508
Paper cup			Place mosquito
Parafilm	Sangon Biotech	F104002	4 inx 125 ft
Petri dish	Sangon Biotech	F611203
Penicillin G procaine salt hydrate	Sangon Biotech	A606248	White powder. Soluble in water, soluble in methanol, slightly soluble in water, ethanol
Single Channal Pipettor	Gilson
Streptomycin sulfate	Sangon Biotech	A610494	Streptomycin sulfate is a glucosamine antibiotic that interferes with the synthesis of prokaryotic proteins.
Sucrose	Sangon Biotech	A502792	Soluble in water, ethanol and methanol, slightly soluble in glycerol and pyridine.
TIANamp Bacteria DNA Kit	TIANGEN	DP302	Extract DNA
Utility Fabric-Mosquito Netting White
Vortex mixer	Scintic Industries	S1-0246
1.5ml EP tube	Sangon Biotech	F600620
10X PBS buffer	Sangon Biotech	E607016	This product is a 10X solution. Please dilute it 10 times before use. The pH value is 7.4.