This paper describes a detailed protocol for using DNA-based tension probes to image the receptor forces applied by immune cells. This approach can map receptor forces >4.7pN in real-time and can integrate forces over time.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
This paper describes a detailed protocol for using DNA-based tension probes to image the receptor forces applied by immune cells. This approach can map receptor forces >4.7pN in real-time and can integrate forces over time.
Mechanical forces transmitted at the junction between two neighboring cells and at the junction between cells and the extracellular matrix are critical for regulating many processes ranging from development to immunology. Therefore, developing the tools to study these forces at the molecular scale is critical. Our group developed a suite of molecular tension sensors to quantify and visualize the forces generated by cells and transmitted to specific ligands. The most sensitive class of molecular tension sensors are comprised of nucleic acid stem-loop hairpins. These sensors use fluorophore-quencher pairs to report on the mechanical extension and unfolding of DNA hairpins under force. One challenge with DNA hairpin tension sensors is that they are reversible with rapid hairpin refolding upon termination of the tension and thus transient forces are difficult to record. In this article, we describe the protocols for preparing DNA tension sensors that can be "locked" and prevented from refolding to enable "storing" of mechanical information. This allows for the recording of highly transient piconewton forces, which can be subsequently "erased" by the addition of complementary nucleic acids that remove the lock. This ability to toggle between real-time tension mapping and mechanical information storing reveals weak, short-lived, and less abundant forces, that are commonly employed by T cells as part of their immune functions.
Immune cells defend against pathogens and cancer cells by continuously crawling and scanning the surfaces of target cells for antigens, studding their surface1,2. Antigen recognition is initiated upon binding between the T cell receptor (TCR) and the peptide-major histocompatibility complex MHC (pMHC) complex expressed on the surface of target cells. Because TCR-pMHC recognition occurs at the junction between two mobile cells, it has long been suspected of experiencing mechanical forces. Moreover, this led to the mechanosensor model of TCR activation, which suggests that TCR forces contribute to its function3,4. To understand when, where, and how mechanical forces contribute to T cell function, it is imperative to develop tools to visualize the molecular forces transmitted by T cells. Traditionally, methods such as traction force microscopy (TFM) and micropillar arrays are used to investigate cellular forces5,6. However, the force sensitivity of TFM and micropillar arrays is at the nanonewton (nN) scale and thus is often insufficient to study the molecular piconewton (pN) forces transmitted by cell receptors7. To improve the force and spatial resolution for detection, our lab pioneered the development of molecular tension probes, which were initially synthesized using polyethylene glycol (PEG) polymers7. Molecular tension probes are comprised of an extendible molecular "spring" (PEG, protein, DNA) flanked by a fluorophore and quencher and are anchored on a surface. Forces applied to the terminus of the probe lead to its extension, separating the fluorophore and quencher, and thus generating a strong fluorescence signal (Figure 1A)8,9,10.
Over the past decade we have developed a library of different classes of molecular tension probes with spring elements made from nucleic acids11, proteins10, and polymers8. Among these, the DNA-based tension probes provide the highest signal to noise ratio and the greatest force sensitivity, which is easily tuned from a few pN up to ~20 pN11. We have used these real-time DNA tension probes to study the molecular forces generated by many diverse cell types, including fibroblasts, cancer cells, platelets, and immune cells11,12,13. This manuscript will describe protocols to synthesize and assemble DNA tension probes on a surface to map molecular receptor forces with pN force resolution using a conventional fluorescence microscope. While the current procedure includes chemical modifications to the nucleic acid to introduce the fluorescent reporter (Figure 1B), it is important to note that many of the modification and purification steps can be outsourced to custom DNA synthesis companies. Therefore, DNA tension probes technology is facile, and accessible to the broader cell biology and mechanobiology communities.
Briefly, to assemble DNA tension sensors, a DNA hairpin is hybridized to a fluorescent ligand strand on one arm and a quencher anchor strand on the other arm and then immobilized on a glass substrate (Figure 1C, real-time tension). In the absence of mechanical force, the hairpin is closed, and thus the fluorescence is quenched. However, when the applied mechanical force is greater than the F1/2 (the force at equilibrium that leads to a 50% probability of unfolding), the hairpin mechanically melts, and a fluorescent signal is generated.
Building on the real-time DNA tension sensor, we also describe protocols to map accumulated forces, which is particularly useful for studying interactions between receptors on immune cells and their natural ligand. This is because immune receptors often display short-lived bonds3,14. Accumulated forces are imaged using a "locking" strand that preferentially binds to open DNA hairpins and allows for the storage of fluorescence signals associated with mechanical pulling events (Figure 1C, locked tension). The locking strand is designed to bind a cryptic binding site that is exposed upon mechanically induced melting of the hairpin and lock the hairpin in the open state by blocking hairpin refolding, thus storing the tension signal, and generating an accumulated tension map. Moreover, the locking strand is designed with an eight-nucleotide toehold, which enables a toehold-mediated strand displacement reaction with its full complement, the "unlocking" strand. With the addition of the unlocking strand, the bound locking strand is stripped off the hairpin construct, erasing the stored tension signal and resetting the hairpin back to the real-time state.

Figure 1: Scheme of the state-of-art molecular tension probes. (A) General design of real-time molecular tension probe, (B) Strands for the DNA-based tension probe construct, and (C) engineered DNA-based tension probes and their toggling between real-time state and locked state. Please click here to view a larger version of this figure.
The main protocol consists of four major sections - oligonucleotide preparation, surface preparation, imaging, and data analysis. This protocol has been successfully demonstrated by our lab and others in naïve and activated OT-1 CD8+ T cells, OT-II CD4+ cells, as well as hybridomas, and can be applied to interrogate different immune cell receptors including T cell receptor, programmed cell death receptor (PD1), and lymphocyte function-associated antigen 1 (LFA-1) forces. OT-1 CD8+ naïve T cells are used as an example cell line in this paper.
Access restricted. Please log in or start a trial to view this content.
The OT-1 transgenic mice are housed at the Division of Animal Resources Facility at Emory University. All the experiments were approved and performed under the Institutional Animal Care and Use Committee (IACUC) protocol.
1. Oligonucleotide preparation
2. Surface preparation
NOTE: The preparation of DNA hairpin tension probe substrates takes two days. The DNA hairpin tension probe will be functionalized onto glass coverslips.
3. Imaging cell receptor forces
4. Data analysis
NOTE: Image analysis is performed using Fiji software, and the quantitative analysis is performed using analysis software.
Access restricted. Please log in or start a trial to view this content.
Here we show representative surface quality control images (Figure 4). A high-quality surface should have a clean background in RICM channel (Figure 4B), and uniform fluorescence intensity in Cy3B channel (Figure 4C). With the same imaging equipment and identical fluorescence imaging acquisition conditions, the background fluorescence intensity should be consistent and reproducible each time when conducting experiments with DNA prob...
Access restricted. Please log in or start a trial to view this content.
With the detailed procedures provided here, one can prepare DNA hairpin tension probe substrates to map and quantify the receptor tension produced by immune cells. When cells are plated onto the DNA hairpin tension probe substrate, they land, attach, and spread as the receptors sense the ligands both chemically and mechanically, the latter of which is detected by our probes. However, in some cases cells may fail to spread (Figure 7A) or fail to produce tension signal. This is often a consequ...
Access restricted. Please log in or start a trial to view this content.
The authors declare no conflict of interest.
This work was supported by NIH Grants R01GM131099, NIH R01GM124472, and NSF CAREER 1350829. We thank the NIH Tetramer Facility for pMHC ligands. This study was supported, in part, by the Emory Comprehensive Glycomics Core.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 3-hydroxypicolinic acid (3-HPA) | Sigma | 56197 | maldi-TOF-MS matrix |
| mPEG-SC | Biochempeg | MF001023-2K | surface prep |
| (3-Aminopropyl)triethoxysilane | Acros | AC430941000 | surface prep |
| 10x Red blood cell lysis buffer | Biolegend | 00-4333-57 | buffer |
| 8.8 nm gold nanoparticles, tannic acid | Nanocomposix | customized order | surface prep |
| Atto647N NHS ester | Sigma | 18373-1MG-F | fluorophore, oligo prep |
| Attofluor Cell Chamber, for microscopy | Thermo Fisher Scientific | A7816 | imaging |
| BD Syringes only with Luer-Lok | BD bioscience | 309657 | cells |
| biotinylated anti-mouse CD3e | ebioscience | 13-0031-82 | antibody/ligand |
| Biotinylated pMHC ovalbumin (SIINFEKL) | NIH Tetramer Core Facility at Emory University | NA | antibody/ligand |
| bovine serum albumin | Sigma | 735078001 | block non-specific interactions |
| Cell strainers | Biologix | 15-1100 | cells |
| Coverslip Mini-Rack, teflon | Thermo Fisher Scientific | C14784 | surface prep |
| Cy3B NHS ester | GE Healthcare | PA63101 | fluorophore, oligo prep |
| Dulbecco's phosphate-buffered saline (DPBS) | Corning | 21-031-CM | buffer |
| ethanol | Sigma | 459836 | surface prep |
| Hank’s balanced salts (HBSS) | Sigma | H8264 | buffer |
| hydrogen peroxide | Sigma | H1009 | surface prep |
| LA-PEG-SC | Biochempeg | HE039023-3.4K | surface prep |
| Midi MACS (LS) startup kit | Miltenyi Biotec | 130-042-301 | cells |
| mouse CD8+ T cell isolation kit | Miltenyi Biotec | 130-104-075 | cells |
| Nanosep MF centrifugal devices | Pall laboratory | ODM02C35 | oligo prep |
| No. 2 round glass coverslips | VWR | 48382-085 | surface prep |
| NTA-SAM | Dojindo Molecular Technologies | N475-10 | surface prep |
| P2 gel | Bio-rad | 1504118 | oligo prep |
| sufuric acid | EMD Millipore Corporation | SX1244-6 | surface prep |
| Sulfo-NHS acetate | Thermo Fisher Scientific | 26777 | surface prep |
| Equipment | |||
| Agilent AdvanceBio Oligonucleotide C18 column, 4.6 x 150 mm, 2.7 μm | 653950-702 | oligonucleotide preparation | |
| Barnstead Nanopure water purifying system | Thermo Fisher | water | |
| CFI Apo 100× NA 1.49 objective | Nikon | Microscopy | |
| Cy5 cube | CHROMA | Microscopy | |
| evolve electron multiplying charge coupled device (EMCCD) | Photometrics | Microscopy | |
| High-performance liquid chromatography | Agilent 1100 | oligonucleotide preparation | |
| Intensilight epifluorescence source | Nikon | Microscopy | |
| Matrix-assisted laser desorption/ionization time-of-flight mass spectrometer (MALDI-TOF-MS) | Voyager STR | oligonucleotide preparation | |
| Nanodrop 2000 UV-Vis Spectrophotometer | Thermo Fisher | oligonucleotide preparation | |
| Nikon Eclipse Ti inverted microscope | Nikon | Microscopy | |
| Nikon Perfect Focus System | Nikon | Microscopy | |
| NIS Elements software | Nikon | Microscopy | |
| quad band TIRF 405/488/561/647 cube | CHROMA | Microscopy | |
| RICM cube | CHROMA | Microscopy | |
| TIRF launcher with 488 nm (50 mW), 561 nm (50 mW), and 640 nm | Coherent | Microscopy | |
| TRITC cube | CHROMA | Microscopy | |
| oligo name | 5' modification / 3' modification | sequence (5' to 3') | Use |
| 15mer amine locking strand | 5' modification: no modification 3' modification: /3AmMO/ | AAA AAA CAT TTA TAC CCT ACC TA | locking real-time tension signal |
| 15mer Atto647N locking strand | 5' modification: Atto647N 3' modification: /3AmMO/ | AAA AAA CAT TTA TAC CCT ACC TA | locking real-time tension signal |
| 15mer non-fluoresccent locking strand | 5' modification: no modification 3' modification: no modification | A AAA AAC ATT TAT AC | locking real-time tension signal for quantitative analysis |
| 4.7 pN hairpin strand | 5' modification: no modification 3' modification: no modification | GTGAAATACCGCACAGATGCGT TTGTATAAATGTTTTTTTCATTTAT ACTTTAAGAGCGCCACGTAGCC CAGC | hairpin probe |
| amine ligand strand | 5' modification: /5AmMC6/ 3' modification: /3Bio/ | CGCATCTGTGCG GTA TTT CAC TTT | hairpin probe |
| BHQ2 anchor strand | 5' modification: /5ThiolMC6-D/ 3' modification: /3BHQ_2/ | TTTGCTGGGCTACGTGGCGCTCTT | hairpin probe |
| Cy3B ligand strand | 5' modification: Cy3B 3' modification: /3Bio/ | CGCATCTGTGCG GTA TTT CAC TTT | hairpin probe |
| unlocking strand | 5' modification: no modification 3' modification: no modification | TAG GTA GGG TAT AAA TGT TTT TTT C | unlocking accumulated tension signal |
Access restricted. Please log in or start a trial to view this content.