Presented here is a simple protocol for the directed differentiation of hemogenic endothelial cells from human pluripotent stem cells in approximately 1 week.
Method Article
Presented here is a simple protocol for the directed differentiation of hemogenic endothelial cells from human pluripotent stem cells in approximately 1 week.
Blood vessels are ubiquitously distributed within all tissues of the body and perform diverse functions. Thus, derivation of mature vascular endothelial cells, which line blood vessel lumens, from human pluripotent stem cells is crucial for a multitude of tissue engineering and regeneration applications. In vivo, primordial endothelial cells are derived from the mesodermal lineage and are specified toward specific subtypes, including arterial, venous, capillary, hemogenic, and lymphatic. Hemogenic endothelial cells are of particular interest because, during development, they give rise to hematopoietic stem and progenitor cells, which then generate all blood lineages throughout life. Thus, creating a system to generate hemogenic endothelial cells in vitro would provide an opportunity to study endothelial-to-hematopoietic transition, and may lead to ex vivo production of human blood products and reduced reliance on human donors. While several protocols exist for the derivation of progenitor and primordial endothelial cells, generation of well-characterized hemogenic endothelial cells from human stem cells has not been described. Here, a method for the derivation of hemogenic endothelial cells from human embryonic stem cells in approximately 1 week is presented: a differentiation protocol with primitive streak cells formed in response to GSK3β inhibitor (CHIR99021), then mesoderm lineage induction mediated by bFGF, followed by primordial endothelial cell development promoted by BMP4 and VEGF-A, and finally hemogenic endothelial cell specification induced by retinoic acid. This protocol yields a well-defined population of hemogenic endothelial cells that can be used to further understand their molecular regulation and endothelial-to-hematopoietic transition, which has the potential to be applied to downstream therapeutic applications.
Endothelial cells (ECs) are a heterogeneous population of cells that perform multiple functions throughout the human body and in engineered tissues. In addition to supporting and regulating other cell types (i.e., cardiomyocytes1, osteoblastic cells2), these functions include forming a selective barrier between blood and tissues and assisting in tissue formation3. Differentiation of mature ECs during normal development requires diverse signaling pathways. Primordial ECs are derived from mesoderm progenitors, and are then specified toward mature arterial, venous, capillary and lymphatic phenotypes4. Additionally, a small subset of ECs in the extraembryonic yolk sac and embryonic Aorta-Gonad-Mesonephros (AGM) region are also specified to become hemogenic ECs, which give rise to hematopoietic stem and progenitor cells (HSPCs) that migrate to the fetal liver and fetal bone marrow, where they remain postnatally and generate all blood cell types throughout life4. The diverse range of EC phenotypes is essential for all tissue development and maintenance.
Thus, ECs and their derivatives are critical components of studies aimed at modeling, and elucidating mechanisms of, human development and/or disease, as well as regenerative medicine and tissue engineering applications5,6,7,8. However, the main limitation for these types of studies is the lack of availability of primary human ECs in the quantity required. It has been estimated that a minimum of 3 x 108 ECs would be required for the majority of therapeutic applications6. To solve this problem, the use of human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) has been proposed due to their diverse lineage potential and their ability to generate large numbers of progeny6,9.
Indeed, the usefulness of cells derived from hESCs or hiPSCs has been demonstrated in multiple studies focused on disease modeling and drug screening10,11,12. Organ-on-a-Chip (OOC) technology has been used to more faithfully recapitulate the physiology of the human body by integrating cells and tissues into three-dimensional scaffolds. Furthermore, connection of multiple individual OOCs (a so-called body- or human-on-a-chip, BOC/HOC) can be accomplished via microfluidics to allow for crosstalk between the organs of interest13,14,15. Supporting tissues, such as the vasculature, are critical components of OOCs and BOC/HOCs; incorporating vasculature allows for the transport of nutrients, oxygen, and paracrine factors throughout the tissues, thereby promoting the requisite tissue-specific microenvironment3,12. Thus, methods for deriving mature human ECs, such as arterial, venous, lymphatic, and hemogenic ECs, are crucial to advancing these tissue engineering approaches.
Multiple protocols have been published detailing steps for the derivation of human primordial or progenitor ECs from hESCs or hiPSCs5,16,17,18,19,20,21,22,23,24,25,26. Many of these protocols rely on embryoid body (EB) formation or co-culture of ESCs/iPSCs with a murine feeder layer of stromal cells. These strategies tend to be difficult and time consuming, with low EC yields and/or contamination of human ECs with murine cells. Protocols that rely strictly on 2D culture without the use of stromal cells often require long inductions, utilize complex combinations of growth factors and/or inhibitors for induction, have extended expansion periods following cell separation, or a combination of these factors. Advancing knowledge of signaling pathways and factors involved in the derivation of mature EC types in vivo provides the groundwork for a straightforward and robust in vitro differentiation protocol.
Previously, key roles for Notch and Retinoic Acid (RA) signaling pathways in the specification of murine arterial and hemogenic ECs, respectively, during development were identified. The Notch signaling pathway plays multiple roles in the specification and maintenance of the arterial EC phenotype. Work using the murine retinal vascularization model identified a pathway in which fluid shear stress induces a Notch-Cx37-p27 signaling axis, promoting G1 cell cycle arrest, which enables arterial EC specification27. Cell cycle states have been hypothesized to play a role in cell fate decisions by providing distinct windows of opportunity in which cells are receptive to certain signals that can induce gene expression and phenotypic changes28. This Notch-mediated G1 arrest enabled the expression of genes enriched in arterial ECs, including ephrinB2, Cx40, DLL4, Notch1, and Notch 4 (reviewed in29,30). It has also been shown that hemogenic EC specification is promoted in vivo via RA signaling31,32. Additional studies identified that, downstream of RA signaling, expression of c-Kit and Notch upregulate p27, which enables hemogenic specification in the murine yolk sac and AGM33. Murine hemogenic ECs can be minimally identified by expression of both endothelial (i.e., CD31, KDR) and hematopoietic (i.e., c-Kit, CD34) markers4. Finally, hemogenic ECs undergo an endothelial-to-hematopoietic transition (EHT) to form HSPCs, which can give rise to all blood cell types4,34,35.
Recent work tested whether this same signaling hierarchy can promote human hemogenic EC specification. To do so, a serum- and feeder-free 2D culture protocol to derive hemogenic ECs from hESCs was developed, and these hemogenic ECs were characterized on a single cell level as CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45-. This study also took advantage of the Fluorescent Ubiquitination Cell Cycle Indicator (FUCCI) reporter, which identifies different cell cycle states, using H9-hESCs that express the FUCCI reporter construct (H9-FUCCI-hESC)36. In studies with these cells, it was demonstrated that RA promotes early G1 cell cycle arrest in ECs, and early G1 state enables hemogenic specification in vitro37. Herein, a detailed protocol for the differentiation of these human hemogenic endothelial cells and assays confirming their identity are provided. This straightforward method provides a useful means of generating this specialized subset of ECs for future studies of mechanisms of human blood cell development.
1. Reagents and reagent preparation
NOTE: A list of reagents is provided in Table of Materials.
2. Cell culture and passaging of hESCs
3. Differentiation of hESCs to primordial endothelial cells
4. FACS purification of primordial endothelial cells
5. Assay to confirm primordial endothelial cell phenotype
6. Differentiation of hESCs to hemogenic endothelial cells
NOTE: Differentiate the cells to day 4 primordial ECs, as described above in sections 3.1-3.6.
7. FACS-isolation of hemogenic endothelial cells
8. Colony forming unit assay
A schematic outlining the specification of primordial ECs and hemogenic ECs from hESCs, and a representative image of cells 24 h after plating are shown in Figure 1. Following specification, primordial ECs and hemogenic ECs are FACS purified on days 5 and 8, respectively. Primordial ECs are defined as CD31+ CD45- and hemogenic ECs are defined as CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45-. A representative flow cytometric gating strategy for primordial ECs and hemogenic EC purification is shown in Figure 2. Cells are initially gated based on the negative expression of CD45 and positive expression of CD31 to obtain purified primordial ECs (Figure 2A). To obtain purified hemogenic ECs, cells are initially gated as in Figure 2A and are then further purified based on positive or negative expression of (in order) VE-Cadherin (CDH5), c-Kit (KIT), CD34, and KDR (Figure 2B).
To assess the potential of H9-Fucci-hES-derived primordial CD31+ CD45- endothelial cells, isolated via FACS at day 5 of differentiation (protocol section 4), to give rise to endothelial subtypes, the purified cells are seeded onto plates coated with either the Notch ligand DLL4 to induce arterial specification, or PBS (control), and incubated for 24 h in a 37 °C, 5% CO2 incubator. The cells are then lysed with RNA lysis buffer, the RNA extracted, and reverse transcribed to cDNA, and qPCR is performed to compare gene expression levels in the DLL4-treated vs. control cells. As expected, endothelial cells grown on DLL4 have increased expression of the Notch-responsive gene HEY2, as well as the arterial-associated genes EFNB2, GJA5, and GJA4. Additionally, these cells also have decreased expression of the venous transcription factor NR2F2 (Figure 3A). Alternatively, to determine the effect of DLL4 treatment on cell cycle state, the FACS purified CD31+ CD45- cells are incubated on plates coated with either DLL4 or PBS for 24 h, lifted, and analyzed based on the expression of hCdt1(30/120)-mCherry (late G1) and hGem(1/110)-mVenus (S/G2/M). Consistent with the findings that Notch signaling promotes late G1 cell cycle arrest27, a greater percentage of primordial ECs are arrested in late G1 after growth in the presence of DLL4, compared to control cells (Figure 3B,C).
To verify the hematopoietic potential of hemogenic endothelial cells, the CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45- endothelial cells isolated through FACS (methods in section 7) are seeded in a methylcellulose-based medium formulated for growth of hematopoietic progenitor cells in colony-forming unit (CFU) assays and are allowed to grow for 14 days. CFU-E erythroid colonies and blast-forming unit (BFU)-E erythroid colonies are counted on day 8 (Figure 4A,B), and CFU-GM granulocyte/macrophage and GFU-GEMM (granulocyte, erythroid, macrophage, and megakaryocyte) multipotent hematopoietic progenitor colonies are counted on day 14 (Figure 4C and D). Per 1,000 hemogenic ECs plated, approximately 20 CFU are generated (Figure 4F). Cells with endothelial cell morphology can also be seen in the cultures (Figure 4E); these are the hemogenic endothelial cells that give rise to multi-lineage hematopoietic progenitors on a single cell level37.

Figure 1: Protocol for the specification of primordial and hemogenic ECs. (A) Schematic diagram of the differentiation protocol. Embryonic stem cells are plated on Day -1 on matrix protein-coated plates and are allowed to attach overnight. The cells are then treated on Days 0 and 1 with GSK3i inhibitor (CHIR99021) and bFGF, respectively, to induce primitive streak and mesoderm specification, respectively. Beginning on Day 2, the cells are treated with a combination of BMP4 and VEGF-A to promote primordial EC development. Primordial ECs (red circle) are FACS purified on Day 5. Alternatively, to generate hemogenic ECs, the medium above the primordial ECs is exchanged on Day 5 to fresh hemogenic differentiation medium containing BMP4, VEGF-A, and RA. This medium is replaced daily until Day 8, when hemogenic ECs (red star) are FACS purified. (B) Colonies on Day 0 of differentiation, scale bar= 100 μm. Panel A has been modified from Qiu et al.37 with permission from Elsevier. Please click here to view a larger version of this figure.

Figure 2: FACS analysis of hemogenic ECs derived from hESCs. Representative flow cytometric gating strategy for the purification of (A) primordial ECs and (B) hemogenic ECs. Note that since hemogenic ECs are derived from primordial ECs, the flow cytometry gating strategy for CD45 and CD31 is identical for both cell populations. Shown in the top row of each panel (sample) are cells that were differentiated to hemogenic ECs as described in protocol section 6 and stained with antibodies as described in protocol section 7.3.8. Shown in the bottom row of each panel (control) are unstained cells that were differentiated for 8 days without RA treatment. Please click here to view a larger version of this figure.

Figure 3: DLL4-induction of H9-Fucci CD31+ CD45- primordial endothelial cells results in late G1 arrest and increased arterial gene expression. (A) DLL4 treatment of CD31+ CD45- H9-hESC- derived primordial endothelial cells expressing the Fucci construct purified at day 5 of differentiation results in increased expression of arterial genes (i-iii) and the Notch responsive gene Hey2 (v), which is accompanied by a concomitant decrease in the expression of the venous gene NR2F2 (iv). (B) Representative FACS plots showing the cell cycle state distribution of 5,000 H9-Fucci-derived CD31+ CD45- grown on PBS (control) or DLL4 for 24 h. (C) DLL4 induction results in a 15% increase in cells in the late G1 phase compared to control. Data are the average of triplicate samples from the same experiment shown in panel (B). Error bars indicate standard deviation. Please click here to view a larger version of this figure.

Figure 4: Analysis of hematopoietic potential of hemogenic ECs derived from hESCs. Representative images showing morphology of H1-hESC derived (A) CFU-E erythroid colony (scale bar = 35 μm), (B) BFU-E erythroid colony (scale bar = 75 μm), (C) CFU-GM granulocyte/macrophage colony, (D) CFU-GEMM multipotent hematopoietic progenitor colony, and (E) CFU-GM granulocyte/macrophage colony with underlying endothelial cells (ECs) (red arrows). (F) number and distribution of CFUs formed per 1,000 plated hemogenic endothelial cells. Scale bar = 100 μm in (C-E). Additional images of CFUs differentiated using this protocol can be found in Qiu et al.37. Panel F has been modified from Qiu et al.37 with permission from Elsevier. Please click here to view a larger version of this figure.
| Name | Forward | Reverse |
| EFNB2 | TATGCAGAACTGCGATTTCCAA | TGGGTATAGTACCAGTCCTTGTC |
| EPHB4 | CGCACCTACGAAGTGTGTGA | GTCCGCATCGCTCTCATAGTA |
| GJA5 | CCGTGGTAGGCAAGGTCTG | ATCACACCGGAAATCAGCCTG |
| GJA4 | ACACCCACCCTGGTCTAC | CACTGGCGACATAGGTGCC |
| HEY2 | GCCCGCCCTTGTCAGTATC | CCAGGGTCGGTAAGGTTTATTG |
| NR2F2 | GGACCACATACGGATCTTCCAA | ACATCAGACAGACCACAGGCAT |
Table 1: qPCR primer information
Herein, the steps for producing hemogenic endothelial cells from human embryonic stem cells in approximately 1 week using a murine feeder- and serum-free 2D culture system (Figure 1) are outlined. This protocol expands on a method described by Sriram et al. (2015) to obtain primordial ECs38. The primordial nature and specification potential of the CD31+ CD45- ECs is demonstrated by culturing these cells on DLL4-coated plates and observing gene expression changes consistent with arterial specification (Figure 3). Additionally, the gain of arterial identity is associated with late G1 cell cycle arrest (Figure 3), which is consistent with previous studies27. After culturing primordial ECs for an additional 3 days in the presence of 0.5 μM RA, 25 ng/mL BMP4, and 50 ng/mL VEGF-A, it was possible to generate and FACS-isolate hemogenic ECs (Figure 2) that are capable of giving rise to CFU-erythroid, BFU-erythroid, CFU-granulocyte/macrophage, and CFU-granulocyte, erythrocyte, macrophage, and megakaryocyte colonies (Figure 4). Using this method in a recently published study, gene expression changes over an 8-day time period consistent with loss of pluripotency, primitive streak, and mesoderm induction, acquisition of endothelial cell identity, and finally hematopoietic identity were observed37. Furthermore, RA treatment induced early G1 cell cycle arrest to enable hemogenic EC specification37.
Recently, Ohta et al. (2019) described a protocol for the differentiation of hemogenic ECs from hPSCs39. However, the protocol described above offers significant advantages: 1) this method does not require the formation of spheroids; 2) this protocol utilizes a standard 37 °C, 5% CO2 incubator rather than a hypoxic incubator, eliminating the need for dedicated specialty equipment; and 3) this protocol utilizes only one medium (pluripotent stem cell differentiation medium supplemented with PFHM), a cost-saving advantage, whereas the Ohta protocol requires two mediums for induction. Another recently published study by Galat et al. (2017) described a protocol in which CHIR99021 induction was utilized to generate a population of CD34+ hemogenic endothelial cells40. These cells also expressed CD31 and were capable of giving rise to endothelial cells when cultured under monolayer conditions or cells expressing myeloid and lymphoid markers after co-culturing with OP9 or OP9-DLL4 cells, respectively, in the presence of additional cytokines. The requirement for additional co-culture could lead to potential contamination of desired cell populations with murine cells. Additionally, although Ohta et al. and Galat et al. utilized a hemogenic induction period that was shorter than the one described here (4 days and 5 days, respectively vs. 8 days), both defined hemogenic ECs as CD34+, whereas this protocol utilized a more stringent definition: CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45-. While CD34 is recognized as a marker of hematopoietic cells, it is also expressed by other non-hematopoietic cell types, such as mesenchymal stromal cells and endothelial cells41. The definition of hemogenic ECs in this protocol (CD31+ KDR+ c-Kit+ CD34+ VE-Cadherin- CD45-) is therefore more rigorous and represents a more defined population.
One limitation to the use of hESCs or hiPSCs in therapeutic applications is the large number of cells required, and standard 2D derivation methods are primarily restricted to small-scale differentiations. Utilizing hiPSC lines, Olmer et al. (2018) demonstrated the feasibility of scaling up production of functional CD31+ ECs that expressed both arterial (DLL4) and venous (EPHB4) cell markers utilizing either suspension culture or a stirred-tank bioreactor6. Importantly, they showed that they were able to obtain 1.18 x 107 CD31+ ECs that co-express CD34 and KDR from a single flask containing 20 mL suspension culture. In order to obtain the requisite 3 x 108 ECs necessary for the majority of therapeutic applications, just over two 500 mL flasks would be required6. Future experiments should explore the application of scaling techniques to the protocol presented here for large-scale production of hemogenic ECs.
The author has nothing to disclose.
This work was partially supported by NIH grants HL128064 and U2EB017103. Further support was provided by CT Innovations 15-RMB-YALE-04 grant.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 15 cm dishes | Corning | 430599 | tissue culture treated |
| 35 mm dishes | Corning | 430165 | tissue culture treated |
| 6-well plates | Corning | 3516 | tissue culture treated |
| Antimicrobial reagent Brand Name: Normocin | Invitrogen | ant-nr-1 | |
| bFGF | R&D systems | 233-FB-025 | use at 50 ng/mL |
| BMP4 | BioLegend | 595202 | use at 25 ng/mL |
| Bovine Serum Albumin (BSA) | Fisher Scientific | BP1600-1 | |
| Cell Detatchment Solution Brand Name: Accutase | Stemcell Technologies | 7920 | |
| Dimethyl Sulfoxide (DMSO) | Sigma Aldrich | D2650-100mL | |
| Dispase | Stemcell Technologies | 7913 | |
| DLL4 | R&D systems | 1506-D4/CF | recombinant human; use at 10 μg/mL |
| DMEM:F12 | Gibco | 11320-033 | |
| Dulbecco's Phosphate Buffered Saline (PBS) | Gibco | 14190144 | |
| Endothelial cell growth medium Brand Name: EGM-2 Endothelial Cell Growth Medium-2 BulletKit (EGM-2) | Lonza | CC-3162 | |
| FACS tubes | Corning | 352235 | polystyrene round bottom with filter cap |
| Fetal Bovine Serum (FBS) | Gemini Bio | 100-106 | |
| Fibronectin | ThermoFisher Scientific | 33016015 | use at 4 μg/cm2 |
| GSK3i/CHIR99021 | Stemgent | 04-0004-02 | 10 mM stock; use at 5 μM |
| Hanks Balanced Salt Solution (HBSS) | Gibco | 14175-095 | |
| Hydrochloric Acid (HCl) | Fisher Scientific | A144S-500 | |
| Matrix protein Brand Name: Matrigel | Corning | 356230 | Growth factor reduced. Refer to the Certificate of Analysis for the lot to determine the protein (Matrigel) concentration. This concentration is required to calculate the volume of Matrigel that contains 1 mg of protein. |
| Methylcellulose-based medium Brand Name: MethoCult H4435 Enriched | Stemcell Technologies | 4435 | |
| Pluripotent stem cell differentiation medium Brand Name: STEMdiff APEL 2 | Stemcell Technologies | 5270 | |
| Pluripotent stem cells: H1, H9, H9-FUCCI | WiCell | WA09 (H9), WA01 (H1) | human; H9-FUCCI were obtained from Dr. Ludovic Vallier's lab at Cambridge Stem Cell Institute |
| Protein-Free Hybridoma Medium (PFMH) | Gibco | 12040077 | |
| Retinoic Acid | Sigma Aldrich | R2625-50mg | use at 0.5 μM |
| Reverse transcription master mix Brand Name: iScript Reverse Transcription Supermix | BioRad | 1708840 | |
| RNA extraction kit Brand Name: RNeasy Mini Kit | Qiagen | 74104 | |
| Sodium Hydroxide (NaOH) | Fisher Scientific | SS255-1 | |
| Stem cell growth medium Brand Name: mTeSR1 | Stemcell Technologies | 85850 | |
| SYBR Green master mix Brand Name: iTaq Universal SYBR Green Master Mix | BioRad | 1725121 | |
| Trypsin-EDTA | Gibco | 25299956 | 0.25% |
| VEGF165 (VEGF-A) | PeproTech | 100-20 | use at 50 ng/mL |
| α-CD31-FITC | BioLegend | 303104 | 2 μg/mL* |
| α-CD34-Pacific Blue | BioLegend | 343512 | 2 μg/mL* |
| α-CD45-APC/Cy7 | BioLegend | 304014 | 2 μg/mL* |
| α-c-Kit-APC | BioLegend | 313206 | 2 μg/mL* |
| α-Flk-1-PE/Cy7 | BioLegend | 359911 | 2 μg/mL* |
| α-VE-Cadherin-PE | BioLegend | 348506 | 2 μg/mL* |
| * Antibody fluorescent conjugates should be optimized based on the cell sorter used. Presented here are the final concentrations utilized in this study. |
Request permission to reuse the text or figures of this JoVE article
Request Permission