The outlined protocol describes the procedure for producing the HiBiT-receptor-binding domain protein complex and its application for fast and sensitive detection of SARS-CoV-2 antibodies.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
The outlined protocol describes the procedure for producing the HiBiT-receptor-binding domain protein complex and its application for fast and sensitive detection of SARS-CoV-2 antibodies.
The emergence of the COVID-19 pandemic has increased the need for better serological detection methods to determine the epidemiologic impact of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The increasing number of SARS-CoV-2 infections raises the need for better antibody detection assays. Current antibody detection methods compromise sensitivity for speed or are sensitive but time-consuming. A large proportion of SARS-CoV-2-neutralizing antibodies target the receptor-binding domain (RBD), one of the primary immunogenic compartments of SARS-CoV-2. We have recently designed and developed a highly sensitive, bioluminescent-tagged RBD (NanoLuc HiBiT-RBD) to detect SARS-CoV-2 antibodies. The following text describes the procedure to produce the HiBiT-RBD complex and a fast assay to evaluate the presence of RBD-targeting antibodies using this tool. Due to the durability of the HiBiT-RBD protein product over a wide range of temperatures and the shorter experimental procedure that can be completed within 1 h, the protocol can be considered as a more efficient alternative to detect SARS-CoV-2 antibodies in patient serum samples.
The recent emergence of a new coronavirus, SARS-CoV21, has caused more than 2,800,000 fatalities and 128 million infections as of March 30th, 20212. Due to the lack of a reliable and well-established treatment procedure for SARS-CoV-2 clinical therapies, many endeavors have been made to restrict further viral transmission and more importantly, to develop an effective and robust treatment or a vaccine3. To date, there are more than 50 COVID-19 vaccine candidates in trials reported by the World Health Organization4. Detection of antibodies against SARS-CoV-2 is of paramount importance to determine the long-term stability of humoral response upon administration of the vaccine as well as in recovered patients of COVID-195. Some studies have demonstrated that there is a possibility that recovered SARS-CoV-2 patients lose most of the RBD-binding antibodies after 1 year5,6,7,8,9. Further investigation is required to better understand lasting immunity, and more sensitive antibody detection platforms can help further such work. Reports of sustained immunity of mild SARS-CoV-2 infections, which suggest long-term antibody responses, is also an interesting and worthwhile area of study. A fast and accurate method of detection is essential for monitoring antibodies in individuals' sera to provide more information about immunity in the population.
Like other coronaviruses, SARS-CoV-2 uses protruding spike glycoprotein to bind to angiotensin-converting enzyme-2 (ACE2) to initiate a cascade of events that lead to the fusion of the viral and cell membranes6,7. Several studies have recently proved the RBD of the Spike protein to have a crucial role in eliciting powerful and specific antibody response against SARS-CoV28,9,10,11. In particular, correlations observed by Premkumar et al. between the titer of RBD-binding antibody and SARS-CoV-2 neutralization potency of patients' plasma are consistent with RBD being an immunogenic compartment of the virus structure9. With that in mind, many diagnostic tests available for SARS-CoV-2 antibody detection are time and cost-intensive, require a lengthy procedure of incubation and washing (enzyme-linked immunosorbent assay [ELISA]), or lack sensitivity and accuracy (lateral flow immunoassay [LFIA])12. Therefore, a quantitative and rapid complementary serological method of COVID-19-derived antibody detection with high sensitivity, fast response, and relatively low cost would serve the need for a reliable serologic test for SARS-CoV-2 epidemiologic surveillance.
Collectively, the limitations of current serological assays prompted the investigation of the bioluminescent reporting system as a potential diagnostic agent in future serosurveys. Bioluminescence is a naturally occurring enzyme/substrate reaction, with light emission. Nanoluc luciferase is the smallest (19 kDa), yet the brightest system compared to Renilla and firefly luciferase (36 kDa and 61 kDa, respectively)13,14. Further, Nanoluc has the highest signal to noise ratio and stability among the previously mentioned systems. The high signal intensity of Nanoluc supports the detection of even very low amounts of reporter fusions15. Nanoluc Binary Technology (NanoBiT) is a split version of the Nanoluc system, which is comprised of two segments: small BiT (11 amino acids; SmBiT) and large BiT (LgBiT) with relatively low-affinity interactions (KD = 190 µM ) to form a luminescent complex16. NanoBiT is extensively used in various studies involving the identification of protein-protein interactions15,17,18,19 and cellular signaling pathways11,20,21.
Recently, another small peptide with a distinctly higher affinity to LgBiT (KD = 0.7 nM ) was introduced, namely the HiBiT Nano-Glo system, in place of SmBiT. The high affinity and strong signal of the Nano-Glo "add-mix-read" assay makes HiBiT a suitable, quantitative, luminescent peptide tag. In this approach, the HiBiT tag is appended to the target protein by developing a construct imposing minimal structural interference. HiBiT-protein fusion would actively bind to the LgBiT counterpart, producing a highly active luciferase enzyme to generate detectable bioluminescence in the presence of detection reagents (Figure 1). Similarly, we developed a HiBiT Nano-Glo-based system to readily measure the neutralizing antibody titer in the sera of SARS-CoV-2 recovered individuals and recently developed a HiBiT-tagged SARS-CoV-2 RBD. This paper describes the protocol for producing the HiBiT-RBD bioreporter using standard laboratory procedures and equipment, and shows how this bioreporter can be used in a fast and efficient assay to detect SARS-CoV-2 RBD-targeting antibodies.
Access restricted. Please log in or start a trial to view this content.
NOTE: The protocol described below adheres to all ethics guidelines according to protocol code 20200371-01H.
1. Production and evaluation of the HiBiT-RBD bioreporter
2. Detecting anti-RBD antibody with a fast and sensitive assay
3. High-throughput detection of the SARS-CoV-2-specific antibodies from patient serum samples
Access restricted. Please log in or start a trial to view this content.
The signals from both the HiBit-RBD-containing cell lysate and supernatant of the transfected cells were recorded (Figure 2) to evaluate the appropriate protein source. HiBiT-RBD and LgBit were separately used as controls, and the data showed low background compared to a strong signal when both parts were combined. Hence, HiBiT-RBD interaction with LgBiT is necessary to generate active enzyme for substrate digestion and bioluminescence activity (Figure 1).
<...Access restricted. Please log in or start a trial to view this content.
The increasing number of people infected with the SARS-CoV-2 and the ongoing effort for global vaccination necessitates sensitive and fast serologic tests that can be used in large-scale serosurveys. Recent research shows that split nanoluciferase-based bioreporters can be used to develop such assays. We recently developed the HiBiT-RBD bioreporter to design a test that can be used to detect SARS-CoV-2-specific antibodies in patient serum in a fast and reliable fashion (Figure 4C).
Access restricted. Please log in or start a trial to view this content.
The authors declare no conflict of interest.
We appreciate and thank the technical assistance of Xiaohong He, Ricardo Marius, Julia Petryk, Bradley Austin, and Christiano Tanese De Souza. We also thank Mina Ghahremani for Graphic Design. We would also like to thank all the individuals who participated and donated their blood samples for this study. DWC is supported in part by uOttawa Faculty and Department of Medicine.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| 5x Passive Lysis Buffer | Promega | E194A | 30 mL |
| Bio-Plex Handheld Magnetic Washer | Bio-Rad | 171020100 | |
| DMEM | Sigma | D6429-500ml | |
| Dual-Glo luciferase Assay System | Promega | E2940 | 100 mL kit |
| Fetal Bovine Serum (FBS) | Sigma | F1051 | |
| HiBiT-RBD Plasmid | gacggatcgggagatctcccgatcccctatggt gcactctcagtacaatctgctctgatgccgcata gttaagccagtatctgctccctgcttgtgtgttgg aggtcgctgagtagtgcgcgagcaaaattta agctacaacaaggcaaggcttgaccgacaa ttgcatgaagaatctgcttagggttaggcgttttg cgctgcttcgcgatgtacgggccagatatacgc gttgacattgattattgactagttattaatagt aatcaattacggggtcattagttcatagcccat atatggagttccgcgttacataacttacggtaa atggcccgcctggctgaccgcccaacgaccc ccgcccattgacgtcaataatgacgtatgttccc atagtaacgccaatagggactttccattgacgtc aatgggtggagtatttacggtaaactgcccact tggcagtacatcaagtgtatcatatgccaagta cgccccctattgacgtcaatgacggtaaatgg cccgcctggcattatgcccagtacatgaccttat gggactttcctacttggcagtacatctacgtat tagtcatcgctattaccatggtgatgcggtttt ggcagtacatcaatgggcgtggatagcggtttg actcacggggatttccaagtctccaccccattg acgtcaatgggagtttgttttggcaccaaaatc aacgggactttccaaaatgtcgtaacaactccg ccccattgacgcaaatgggcggtaggcgtgta cggtgggaggtctatataagcagagctctctgg ctaactagagaacccactgcttactggcttatcg aaattaatacgactcactatagggagacccaa gctggctagcgtttaaacttaagcttggtaccga gctcggatccgccaccATGGAGACAGA CACACTCCTGCTATGGGTACTGC TGCTCTGGGTTCCAGGTTCCAC TGGTGACtctggctctagcggctctggctct agcggcggcATGGTGAGCGGCTG GCGGCTGTTCAAGAAGATTAGC tctagcggcGACTACAAGGACC ACGACGGTGACTACAAGGACCA CGACATCGACTACAAGGACGAC GACGACAAGggcagcggctccggca gcagcggaggaggaggctctggaggagga ggctctagcggcggcaacatcacaaatctgtg cccattcggcgaggtgtttaacgccaccagat ttgccagcgtgtatgcctggaaccggaagaga atctctaattgcgtggccgactatagcgtgct gtacaatagcgcctccttctctacctttaagt gctatggcgtgtcccccacaaagctgaacgac ctgtgcttcaccaacgtgtacgccgactcttttgt gatcaggggcgatgaggtgcgccagatcgc acctggacagacaggcaagatcgccgactac aactataagctgccagacgatttcaccggct gcgtgatcgcctggaatagcaacaatctggatt ccaaagtgggcggcaactacaattatctgtac cggctgttcagaaagagcaacctgaagccctt tgagcgggatatcagcacagagatctaccag gcaggctccaccccttgcaacggagtggagg gcttcaattgttattttcccctgcagagctacggc ttccagcctacaaatggcgtgggctatcagcca tacagggtggtggtgctgtcctttgagctgctg cacgcacctgcaaccgtgtcctctggacacatc gagggccgccacatgctggagatgggccatc atcaccatcatcaccaccaccaccactgatag cggccgctcgagtctagagggcccgtttaaac ccgctgatcagcctcgactgtgccttctagtt gccagccatctgttgtttgcccctcccccgtg ccttccttgaccctggaaggtgccactcccac tgtcctttcctaataaaatgaggaaattgcat cgcattgtctgagtaggtgtcattctattctgggg ggtggggtggggcaggacagcaaggggga ggattgggaagacaatagcaggcatgctggg gatgcggtgggctctatggcttctgaggcggaa agaaccagctggggctctagggggtatcccca cgcgccctgtagcggcgcattaagcgcggcg ggtgtggtggttacgcgcagcgtgaccgctac acttgccagcgccctagcgcccgctcctttcg ctttcttcccttcctttctcgccacgttcgccggctt tccccgtcaagctctaaatcgggggctcccttta gggttccgatttagtgctttacggcacctcgacc ccaaaaaacttgattagggtgatggttcacgta gtgggccatcgccctgatagacggtttttcgcc ctttgacgttggagtccacgttctttaatagtg gactcttgttccaaactggaacaacactcaacc ctatctcggtctattcttttgatttataagggatttt gccgatttcggcctattggttaaaaaatgagctg atttaacaaaaatttaacgcgaattaattctgt ggaatgtgtgtcagttagggtgtggaaagtccc caggctccccagcaggcagaagtatgcaaag catgcatctcaattagtcagcaaccaggtgtgg aaagtccccaggctccccagcaggcagaagt atgcaaagcatgcatctcaattagtcagcaac catagtcccgcccctaactccgcccatcccgc ccctaactccgcccagttccgcccattctccgcc ccatggctgactaattttttttatttatgcagaggc cgaggccgcctctgcctctgagctattccagaa gtagtgaggaggcttttttggaggcctaggcttttg caaaaagctcccgggagcttgtatatccattttc ggatctgatcaagagacaggatgaggatcgttt cgcatgattgaacaagatggattgcacgcagg ttctccggccgcttgggtggagaggctattcggc tatgactgggcacaacagacaatcggctgctct gatgccgccgtgttccggctgtcagcgcagggg cgcccggttctttttgtcaagaccgacctgtccgg tgccctgaatgaactgcaggacgaggcagcg cggctatcgtggctggccacgacgggcgttcct tgcgcagctgtgctcgacgttgtcactgaagcg ggaagggactggctgctattgggcgaagtgcc ggggcaggatctcctgtcatctcaccttgctcctg ccgagaaagtatccatcatggctgatgcaatg cggcggctgcatacgcttgatccggctacctgc ccattcgaccaccaagcgaaacatcgcatcg agcgagcacgtactcggatggaagccggtct tgtcgatcaggatgatctggacgaagagcat caggggctcgcgccagccgaactgttcgcca ggctcaaggcgcgcatgcccgacggcgagg atctcgtcgtgacccatggcgatgcctgcttg ccgaatatcatggtggaaaatggccgctttt ctggattcatcgactgtggccggctgggtgt ggcggaccgctatcaggacatagcgttggct acccgtgatattgctgaagagcttggcggcg aatgggctgaccgcttcctcgtgctttacgg tatcgccgctcccgattcgcagcgcatcgcc ttctatcgccttcttgacgagttcttctgagcg ggactctggggttcgaaatgaccgaccaag cgacgcccaacctgccatcacgagatttcgat tccaccgccgccttctatgaaaggttgggctt cggaatcgttttccgggacgccggctggatga tcctccagcgcggggatctcatgctggagt tcttcgcccaccccaacttgtttattgcagctta taatggttacaaataaagcaatagcatcacaa atttcacaaataaagcatttttttcactgcatt ctagttgtggtttgtccaaactcatcaatgtat cttatcatgtctgtataccgtcgacctctagct agagcttggcgtaatcatggtcatagctgtttc ctgtgtgaaattgttatccgctcacaattccacac aacatacgagccggaagcataaagtgtaaag cctggggtgcctaatgagtgagctaactcacat taattgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatgaa tcggccaacgcgcggggagaggcggtttgcg tattgggcgctcttccgcttcctcgctcactgactc gctgcgctcggtcgttcggctgcggcgagcggt atcagctcactcaaaggcggtaatacggttatc cacagaatcaggggataacgcaggaaagaa catgtgagcaaaaggccagcaaaaggccag gaaccgtaaaaaggccgcgttgctggcgtttt tccataggctccgcccccctgacgagcatcac aaaaatcgacgctcaagtcagaggtggcgaa acccgacaggactataaagataccaggcgtt tccccctggaagctccctcgtgcgctctcctgtt ccgaccctgccgcttaccggatacctgtccgcc tttctcccttcgggaagcgtggcgctttctcat agctcacgctgtaggtatctcagttcggtgtag gtcgttcgctccaagctgggctgtgtgcacgaa ccccccgttcagcccgaccgctgcgccttatcc ggtaactatcgtcttgagtccaacccggtaag acacgacttatcgccactggcagcagccactg gtaacaggattagcagagcgaggtatgtaggc ggtgctacagagttcttgaagtggtggcctaact acggctacactagaagaacagtatttggtatc tgcgctctgctgaagccagttaccttcggaaa aagagttggtagctcttgatccggcaaacaaa ccaccgctggtagcggtggtttttttgtttgca agcagcagattacgcgcagaaaaaaaggat ctcaagaagatcctttgatcttttctacggggt ctgacgctcagtggaacgaaaactcacgttaa gggattttggtcatgagattatcaaaaaggatct tcacctagatccttttaaattaaaaatgaagtt ttaaatcaatctaaagtatatatgagtaaactt ggtctgacagttaccaatgcttaatcagtgagg cacctatctcagcgatctgtctatttcgttcatcca tagttgcctgactccccgtcgtgtagataactac gatacgggagggcttaccatctggccccagtg ctgcaatgataccgcgagacccacgctcacc ggctccagatttatcagcaataaaccagccag ccggaagggccgagcgcagaagtggtcctg caactttatccgcctccatccagtctattaattgtt gccgggaagctagagtaagtagttcgccagtt aatagtttgcgcaacgttgttgccattgctacag gcatcgtggtgtcacgctcgtcgtttggtatgg cttcattcagctccggttcccaacgatcaaggc gagttacatgatcccccatgttgtgcaaaaaag cggttagctccttcggtcctccgatcgttgtca gaagtaagttggccgcagtgttatcactcatggt tatggcagcactgcataattctcttactgtcatg ccatccgtaagatgcttttctgtgactggtgagta ctcaaccaagtcattctgagaatagtgtatgcg gcgaccgagttgctcttgcccggcgtcaatacg ggataataccgcgccacatagcagaactttaa aagtgctcatcattggaaaacgttcttcggggc gaaaactctcaaggatcttaccgctgttgagat ccagttcgatgtaacccactcgtgcacccaact gatcttcagcatcttttactttcaccagcgtttc tgggtgagcaaaaacaggaaggcaaaatgc cgcaaaaaagggaataagggcgacacgga aatgttgaatactcatactcttcctttttcaat attattgaagcatttatcagggttattgtc tcatgagcggatacatatttgaatgtattt agaaaaataaacaaataggggttccgcgca catttccccgaaaagtgccacctgacgtc | ||
| LgBiT | Promega | N3030 | |
| penicillin Streptomycin | Thermo Fisher Scientific | 15140122 | |
| Pierce Protein G Magnetic Beads | Thermo Fisher Scientific | 88848 | |
| PolyJet In Vitro DNA Transfection Reagent | Signagen | SL100688.5 | |
| SARS-CoV-2 (2019-nCoV) Spike Neutralizing Antibody, Mouse Mab | SinoBiological | 40592-MM57 | |
| Synergy Mx Microplate Reader | BioTek | 96-well plate reader luminometer | |
| Trypsin-EDTA | Thermo Fisher Scientific | 2520056 | 0.25% |
Access restricted. Please log in or start a trial to view this content.