Here we provide a protocol for screening potential transcription factors involved in the development of dendritic cell (DC) using lentiviral transduction of shRNA to obtain stable knockdown cell lines for in vitro DC differentiation.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
Here we provide a protocol for screening potential transcription factors involved in the development of dendritic cell (DC) using lentiviral transduction of shRNA to obtain stable knockdown cell lines for in vitro DC differentiation.
Dendritic cells (DCs) are important antigen-presenting cells that connect innate and adaptive immune responses. DCs are heterogeneous and can be divided into conventional DCs (cDCs) and plasmacytoid DCs (pDCs). cDCs specializes in presenting antigens to and activate naïve T cells. On the other hand, pDCs can produce large quantities of type I interferons (IFN-I) during viral infection. The specification of DCs occurs at an early stage of DC progenitors in the bone marrow (BM) and is defined by a network of transcription factors (TFs). For example, cDCs highly express ID2, while pDCs highly express E2-2. Since more and more subsets of DCs are being identified, there is a growing interest in understanding specific TFs controlling DC development. Here, we establish a method to screen TFs critical for DCs differentiation in vitro by delivering lentivirus carrying short hairpin RNA (shRNA) into an immortalized hematopoietic stem and progenitor cell (iHSPCs) line. After the selection and in vitro differentiation, cDC and pDC potential of the stable knockdown cell lines are analyzed by flow cytometry. This approach provides a platform to identify genes potentially governing DC fates from progenitors in vitro.
DCs are key regulators of innate and adaptive immunity1. DCs are mainly classified into two functionally distinct populations, namely pDCs and cDCs. Moreover, cDCs comprise two subsets, namely, type I and type II cDCs or cDC1s and cDC2s, respectively2. pDCs, expressing BST2, Siglec-H, and intermediate levels of CD11c in mice3,4, are the cells that can secrete large amounts of IFN-I during inflammation and viral infection5. Due to their robust IFN-I-producing ability, they are also suspected to play a key role in the progression of autoimmune diseases, including systemic lupus erythematosus (SLE)6. cDC1s, defined by the surface expression of XCR1, CD8a, CLEC9A, and CD103 in mice7, are specialized in the activation and polarization of cytotoxic CD8+ T cells (CTLs) through the antigen cross-presentation, thereby initiating type I immunity in response to intracellular pathogens and cancer8,9. On the other hand, cDC2s, expressing CD11b and CD172α (also known as Sirpα) in both humans and mice, can activate CD4+ T cells and promote type II immune response against allergen and parasites10, as well as modulate type III immunity following extracellular bacteria and microbiota recognition11,12.
Diversification of DCs is determined by a group of TFs from hematopoietic stem and progenitor cells (HSPCs) in the BM. E2-2 (encoded by Tcf4) is a master regulator for differentiation and function of pDCs13,14. In contrast, the inhibitor of DNA binding 2 (ID2) drives cDC specification and inhibits pDC development through blocking E protein activity15. Moreover, the development of cDC1s requires IRF8 and BATF3, while differentiation of cDC2s highly depends on IRF416. Recent works have explored the heterogeneity of pDCs17 and cDCs and their transcriptional regulation18. Because of the complexity of DC network, there is an unmet need to establish a platform to identify other TFs controlling the development and functionality of DCs.
Here, we used an iHSPC that was generated by expressing estrogen-regulated nuclear translocation of Hoxb8 in BM cells (also referred to as Hoxb8-FL cells)19. iHSPCs can proliferate and remain in an undifferentiated stage in the presence of β-estradiol and Flt3 ligand (FL), whereas they start to differentiate into different DC types in the presence of FL upon withdrawal of β-estradiol19. Based on this feature, we can knock down genes of interest at the progenitor stage, followed by examining the effect on in vitro differentiation of pDCs and cDCs. Therefore, this method is a powerful tool to discover the genes that regulate the development and function of DCs.
Access restricted. Please log in or start a trial to view this content.
Handling of lentivirus is performed as per the regulation of the Department of Environmental Health and Safety of National Taiwan University College of Medicine.
1. Preparation of immortalized hematopoietic stem and progenitor cell lines (iHSPCs)
2. Lentiviral transduction

3. Measurement of knockdown efficiency by reverse transcription and real-time PCR (RT-PCR)
4. In vitro differentiation of the stable knockdown iHSPC cell lines
5. Flow cytometric analysis of the differentiated DCs
Access restricted. Please log in or start a trial to view this content.
The map of lentiviral vector pLKO.1-Puro is shown (Figure 1). After the delivery of lentivirus expressing shRNA against LacZ (a non-targeting control), Tcf4, and Id2 in iHSPCs, the knockdown efficiency confirmed by RT-qPCR revealed that the expression of Tcf4 was reduced in shTcf4 iHSPCs, compared to shLacZ iHSPCs (Figure 2A). On the other hand, the decreased expression of Id2 was also observed in sh...
Access restricted. Please log in or start a trial to view this content.
Lentivirus-based shRNA vectors are often used for gene silencing by viral transduction into cells and permit stable integration into the host genome. However, various transduction efficiency in different cell types needs to be considered, and a number of approaches have been taken to overcome this problem.
Polybrene is a polycationic polymer that can neutralize the charges on the cell membrane, thereby enhancing the binding of the virion to the cells during transduction20
Access restricted. Please log in or start a trial to view this content.
The authors have nothing to disclose.
We are grateful for technical support from Dr. Tz-Ling Chen. We thank the National RNAi Core Facility (Academia Sinica, Taiwan) for providing shRNA lentivirus (http://rnai.genmed.sinica.edu.tw). This work was supported by the Ministry of Science and Technology, Taiwan (MOST 108-2320-B-002-037-MY3 and MOST 109-2320-B-002-054-MY3).
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Antibodies | |||
| APC/Cy7 anti-mouse CD11c Antibody | Biolegend | 117324 | (Clone: N418) |
| FITC anti-mouse/human CD11b Antibody | Biolegend | 101206 | (Clone: M1/70) |
| PE anti-mouse/human B220 Antibody | Biolegend | 103208 | (Clone: RA3-6B2) |
| Cell culture | |||
| 1.5 mL Micro tube | ExtraGene | TUBE-170-C | |
| 12-well tissue culture-treated plate | Falcon | 353043 | |
| Fetal bovine serum (FBS) | Corning | 35-010-CV | |
| RPMI 1640 medium | gibco | 11875-085 | |
| Reagent | |||
| β-estradiol | Sigma-Aldrich | E2758-250MG | |
| β-mercaptoethanol (β-ME) | Sigma-Aldrich | M6250 | |
| FACS buffer | home-made | Formula: 1xPBS+0.5 %FBS+0.1%NaN3 | |
| Flt3 ligand (FL) | home-made | ||
| Polybrene | Sigma-Aldrich | TR-1003-G | |
| Puromycin | Invivogen | ant-pr-1 | |
| TRIsure | BIOLINE | BIO-38032 | |
| shRNA (Taregt sequence/clone ID) | Company | ||
| shId2 (GCTTATGTCGAATGATAGCAA/TRCN0000054390) | The RNAi Consortium (TRC) | ||
| shLacZ (CGCGATCGTAATCACCCGAGT/TRCN0000072224) | The RNAi Consortium (TRC) | ||
| shTcf4 (GCTGAGTGATTTACTGGATTT/TRCN0000012094) | The RNAi Consortium (TRC) |
Access restricted. Please log in or start a trial to view this content.