Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Errata

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus

doi: 10.3791/6311 Published: March 19, 2019

Abstract

An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus.  There was a typo in Table 1.

In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:

TTCTCATTGATGCTGAAGCC

To:

GAAACTAGTTATTTCCAACGG

Protocol

An erratum was issued for: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus.  There was a typo in Table 1.

In Table 1, the Oligonucleotide sequence for Type III-F5 was updated from:

TTCTCATTGATGCTGAAGCC

To:

GAAACTAGTTATTTCCAACGG

Disclosures

No conflicts of interest declared.

DOI

Cite this Article

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus. J. Vis. Exp. (145), e6311, (2019).More

Erratum: Multiplex PCR Assay for Typing of Staphylococcal Cassette Chromosome Mec Types I to V in Methicillin-resistant Staphylococcus aureus. J. Vis. Exp. (145), e6311, (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter