A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Three-Dimensional, Serum-Free Culture System for Lacrimal Gland Stem Cells

2.1K views

DOI:

10.3791/63585

June 2nd, 2022

In This Article

Summary

The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.

Abstract

Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture method to obtain a sufficient number of LG stem cells (LGSCs) is one obstacle for further research and application. The three-dimensional (3D), serum-free culture method for adult mouse LGSCs is well established and shown here. The LGSCs could be continuously passaged and induced to differentiate to acinar or ductal-like cells.

For the LGSC primary culture, the LGs from 6-8-week-old mice were digested with dispase, collagenase I, and trypsin-EDTA. A total of 1 × 104 single cells were seeded into 80 µL of matrix gel-lacrimal gland stem cell medium (LGSCM) matrix in each well of a 24-well plate, precoated with 20 µL of matrix gel-LGSCM matrix. The mix was solidified after incubation for 20 min at 37 °C, and 600 µL of LGSCM added.

For LGSC maintenance, LGSCs cultured for 7 days were disaggregated into single cells by dispase and trypsin-EDTA. The single cells were implanted and cultured according to the method used in the LGSC primary culture. LGSCs could be passaged over 40 times and continuously express stem/progenitor cell markers Krt14, Krt5, P63, and nestin. LGSCs cultured in LGSCM have self-renewal capacity and can differentiate into acinar or ductal-like cells in vitro and in vivo.

Introduction

Lacrimal gland stem cells (LGSCs) maintain lacrimal gland (LG) cell renewal and are the source of acinar and ductal cells. Therefore, LGSC transplantation is considered an alternative approach for treating severe inflammatory damage and aqueous-deficient dry eye disease (ADDED)1,2,3. Several culture methods have been applied to enrich LGSCs. Tiwari et al. separated and cultured primary LG cells using collagen I and matrix gel supplemented with several growth factors; however, the LG cells could not be continuously cultured4. Using two-dimensional (2D) culture, mouse LG-derived stem cells were isolated by You et al.5 and Ackermann et al.6, found to express the stem/progenitor cell marker genes, Oct4, Sox2, Nanog, and nestin, and could be subcultured. However, there is no clear indication that these cells can differentiate into acinar or ductal cells, and there is no transplantation experiment to verify the differentiation potential in vivo.

Recently, c-kit+ dim/EpCAM+/Sca1-/CD34-/CD45- cells were isolated from mouse LGs by flow cytometry, found to express LG progenitor cell markers, such as Pax6 and Runx1, and differentiated into ducts and acini in vitro. In mice with ADDED, orthotopic injection with these cells could repair damaged LGs and restore the secretory function of LGs2. However, the number of stem cells isolated by this method was small, and there are no suitable culture conditions for expanding the isolated LGSCs. In summary, an appropriate culture system needs to be established to effectively isolate and culture adult LGSCs with stable and continuous expansion for the study of LGSCs in the treatment of ADDED.

Organoids derived from stem cells or pluripotent stem cells are a group of cells that are histologically similar to the related organs and can maintain their own renewal. After the mouse intestine organoid was successfully cultured by Sato et al. in 20097, organoids from other organs were cultured in succession, based on Sato's culture system, such as gallbladder8, liver9, pancreas10, stomach11, breast12, lung13, prostate14, and salivary gland15. Due to the high proportion of adult stem cells before cell differentiation in organoid culture, the three-dimensional (3D) organoid culture method is considered optimal for the isolation and culture of adult stem cells of LG.

An adult mouse LGSC culture system was established in the present study by optimizing the 3D, serum-free culture method. It is proven that the LGSCs cultured from both normal and ADDED mice showed a stable capacity of self-renewal and proliferation. After transplantation into the ADDED mouse LGs, LGSCs colonized the impaired LGs and improved tear production. In addition, red fluorescent LGSCs were isolated from ROSA26mT/mG mice and cultured. This work provides a reliable reference for LGSC enrichment in vitro and LGSC autograft in clinical application for ADDED therapy.

Access restricted. Please log in or start a trial to view this content.

Protocol

All the experiments in this protocol followed the animal care guidelines of the Ethical Committee on Animal Trial of Sun Yat-sen University. All cell-related operations are to be performed on the ultraclean workbench in the cell operation room. All operations using xylene are to be carried out in fume hoods.

1. LGSC primary culture

  1. LG isolation
    1. Obtain a 6-8-week-old BALB/c male mouse, and cut the skin behind the ear to expose the LG and the connective tissue around it. Peel off the connective tissue by blunt dissection with the help of tweezers and remove the LG.
    2. Rinse the LGs twice with 4 mL of sterile 10 mM PBS solution to remove blood in a 6 cm dish. Immerse the LGs in a 6 cm dish with 4 mL of 75% ethanol for 10 s and rinse with 10 mM PBS twice immediately.
  2. Obtain single cells of LG
    1. Use HEPES buffer solution (50 mM HEPES/KOH, pH 7.4; 150 mM NaCl in ultrapure water) to prepare 25 U/mL dispase. Prepare the 0.1% collagenase I solution with ultrapure water.
    2. Cut the LGs into small fragments (about 1 mm3), transfer them to a sterile 15 mL centrifuge tube, and treat the tissues with 500 µL of 25 U/mL dispase and 500 µL of 0.1% collagenase I for 1 h at 37 °C.
    3. Use 10 mM PBS to prepare trypsin-EDTA solution (0.05 g/L trypsin, 0.04 g/L EDTA). Treat the LG fragments from step 1.2.2 with 1 mL of 0.05% trypsin-EDTA for 10 min at 37 °C and dissociate the fragments into single cells by pipetting repeatedly.
    4. Filter the suspension through a 70 µm filter, collect the filtrate into a sterile 15 mL centrifuge tube, and centrifuge at 150 × g for 5 min.
    5. After centrifugation, remove the supernatant, add 10 mL of 10 mM PBS to wash the cell pellet, and centrifuge the suspension.
    6. Repeat step 1.2.5, remove the supernatant, and add 1 mL of DMEM/F12 (1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-12) to resuspend the cell pellets.
  3. LGSC primary culture
    1. Prepare the lacrimal gland stem cell medium (LGSCM) containing DMEM/F12, 1x N2 supplement, 1x B27 supplement, 2 mM glutamine substitute, 0.1 mM NEAAs (nonessential amino acids), 50 ng/mL murine epidermal growth factor (EGF), 100 ng/mL fibroblast growth factor 10 (FGF10), 10 ng/mL Wnt3A, and 10 µM Y-27632 (ROCK inhibitor).
    2. Add 20 µL of matrix gel-LGSCM matrix (matrix gel: LGSCM = 1:1) at the center of the well of a 24-well plate. Use a pipette tip to expand it to a circle (6-8 mm diameter) and incubate the mixture for 20 min at 37 °C to precoat the well.
    3. Use a cell counter to determine the cell number and add 40 µL of LGSCM with a total of 1 × 104 cells into 40 µL of the matrix gel. Mix them gently with a pipette to obtain a matrix gel-LGSCM mixture (matrix gel: LGSCM= 1:1).
    4. Use a pipette to carefully drop 80 µL of the mixture over the precoated area in each well of the 24-well plate in step 1.3.2.
    5. Incubate the mixture for 20 min at 37 °C and add 600 µL of LGSCM.
    6. Change the culture medium in each well once every two days. After 7 days of culture, look for LGSC spheres that are 100-300 µm diameter under the inverted microscope (eyepiece: 10x, objective: 4x).
      NOTE: LGSCs can be cultured for more than 14 days in total.
  4. Isolate and culture primary LGSCs of ROSA26mT/mG mice and DED mice (NOD/ShiLtJ) following the steps described above.

2. LGSC maintenance and passage

  1. Remove the culture medium from the sphere culture well.
  2. Disaggregate the LGSC spheres cultured for 7 days by incubation in 20 µL of 10 U/mL dispase and 100 µL of 10 mM PBS for 30 min at 37 °C.
  3. Transfer the suspension to a 15 mL centrifuge tube and centrifuge at 150 × g for 4 min. Remove the supernatant.
  4. Treat the spheres with 1 mL of 0.05% trypsin-EDTA for 5 min at 37 °C. Add 1 mL of 0.05% trypsin inhibitor (TI) and pipette repeatedly to neutralize the trypsin and dissociate the spheres into single cells.
  5. Centrifuge at 150 × g for 5 min and remove the supernatant to obtain LGSCs in the pellet. Add 1 mL of LGSCM to resuspend the LGSC pellet.
  6. Plate the single cells as described in steps 1.3.1 to 1.3.6.

3. LGSC differentiation

  1. Procedure 1: Extend the culture time of LGSCs from 7 to 14 days with the LGSC culture system for random differentiation.
  2. Procedure 2: Change the ratio of the matrix gel-LGSCM mixture from 1:1 to 1:2 at the beginning of the LGSC culture for the differentiation of ductal cells. Seed the LGSCs into the matrix for induction for 14 days (refer to step 1.3).
  3. Procedure 3: After passage, replace the LGSCM with the LGSCM-10% fetal bovine serum (FBS) mixture for the differentiation of acinar cells. Induce differentiation for 14 days.

4. LG tissue dehydration

  1. Obtain LG tissues (step 1.1.1) and rinse the LGs with 4 mL of sterile 10 mM PBS solution in a 6 cm dish for 2 min. Move the tissues to 10% formalin solution for fixation for 24 h.
  2. Rinse the fixed tissues with 10 mM PBS for 2 min to remove the formalin, and transfer the tissue to a tissue embedding box. Put the embedding box into the automatic dehydrator.
  3. Use the automatic dehydrator to dehydrate the tissues as follows: 70% ethanol, 2 h; 80% ethanol, 2 h; 90% ethanol, 30 min; 95% ethanol, 30 min; absolute ethanol, 30min; absolute ethanol, 2 h; absolute ethanol: 100% xylene (1: 1) mixture, 30 min; 100% xylene, 30 min; 100% xylene, 2 h; 100% xylene: paraffin (1: 1) mixture, 30 min; paraffin, 2 h; paraffin,3 h.

5. LG organoid/sphere dehydration

  1. Obtain LG organoids/spheres (steps 2.1-2.3) in a 1.5 mL microcentrifuge tube and rinse the LG organoids/spheres with 1 mL of sterile 10 mM PBS solution for 2 min.
  2. Centrifuge at 100 × g for 1 min and remove the supernatant.
  3. Prepare the 4% paraformaldehyde (PFA) solution as follows: add 20 g of PFA to a mixture of 400 mL of 10 mM PBS and 40 µL of 1 M NaOH, shake the solution well, and heat it in a 65 °C water bath for 2 h until the PFA is completely dissolved. After cooling to room temperature, use 10 mM PBS to make up the volume to 500 mL and store it at 4 °C.
  4. Add 1 mL of 4% PFA into the microcentrifuge tube with the organoid/sphere pellet and put the tube in a 4 °C refrigerator for at least 24 h for fixation.
  5. After fixation, centrifuge at 100 × g for 1 min and remove the supernatant. Add 1 mL of 10 mM PBS into the microcentrifuge tube with the organoid/sphere pellet and gently mix by pipetting for 2 min to rinse off the PFA. Repeat this step twice.
  6. Centrifuge at 100 × g for 1 min and remove the supernatant.
  7. Heat embedding hydrogel to dissolve and add 50-60 µL of embedding hydrogel to the organoid/sphere pellet and mix. Pipette the mixture onto the parafilm in the form of a droplet and wait for 5 min for it to solidify at room temperature.
  8. Dehydrate the gel with the organoids/spheres in a new 1.5 mL microcentrifuge tube as follows.
    1. Add 1 mL of 50% ethanol to the tube, wait for 30 min at room temperature, and remove the liquid from the tube by pipetting. Repeat this step by changing the ethanol concentration to 70%, 80%, 90%, 95% successively.
    2. Add 1 mL of absolute ethanol to the tube, wait for 30 min at room temperature, and remove the liquid from the tube by pipetting. Repeat this step.
    3. Add 1 mL of a mixture of 0.5 mL of absolute ethanol and 0.5 mL of 100% xylene to the tube, wait for 30 min at room temperature, and remove the liquid from the tube by pipetting.
    4. Add 1 mL of 100% xylene to the tube, wait for 30 min at room temperature, and remove the liquid from the tube by pipetting. Repeat this step.
      NOTE: Steps 5.8.5-5.8.6 must be performed in a metal bath at 65 °C.
    5. Add 1 mL of a mixture of 0.5 mL of paraffin and 0.5 mL of 100% xylene to the tube, wait for 30 min at 65 °C, and remove the liquid from the tube by pipetting.
    6. Add 1 mL of paraffin to the tube, wait for 30 min at 65 °C, and remove the liquid from the tube by pipetting. Repeat this step and extend the processing time to 1 h.

6. Paraffin embedding and sectioning

  1. Paraffin embedding
    1. Before embedding, turn on the embedding machine and preheat it to melt the paraffin wax in the paraffin tank.
    2. Place the dehydrated tissue or organoid/sphere gel into the groove of the embedding iron box, and put the iron box into the paraffin of the embedding machine.
    3. Remove the plastic lid and place the plastic embedding box on the iron box to cover it. Move the embedding iron box to a cooling table.
    4. After the paraffin has condensed into blocks in the embedding box, remove it from the iron box and slice it directly or store it temporarily in a 4 °C refrigerator.
  2. Paraffin sectioning
    1. Before paraffin slicing, preassemble the paraffin slicer and add distilled water to the sink of the slicer for preheating. Start slicing when the water temperature rises to 42 °C.
    2. Fix the sample on the sample slot of the paraffin slicer. Adjust the section thickness to 5 µm during slicing.
    3. Section the sample continuously. Fix the fully tiled section on the antislip slide in the slicer tank.
    4. After sectioning, place the slides affixed with sample tissue in a biochemical incubator at 37 °C for drying for 24 h. Temporarily store the slides in a refrigerator at 4 °C.

7. Hematoxylin and eosin staining

  1. Melt the paraffin sections at 60 °C for 30 min, soak the sections in 100% xylene for 15 min, and repeat.
  2. Treat the sections with absolute ethanol on a shaker for 5 min.
  3. Treat the sections with 90% ethanol, 80% ethanol, and 70% ethanol on a shaker, each for 3 min.
  4. Treat the sections with deionized water on a shaker for 5 min and 2 min successively.
  5. Stain the sections on a wet box for 5 min with 4 mg/mL hematoxylin solution. Rinse the sections in running water for 10 min.
  6. Agitate the sections on a shaker first with deionized water for 2 min and then with 0.5%-1% eosin for 1 min.
  7. Agitate the sections with 70% ethanol, 80% ethanol, and 90% ethanol on a shaker for 3 min (each) successively. Agitate the sections with absolute ethanol on a shaker for 5 min.
  8. Soak the sections in 100% xylene for 15 min and repeat the soaking.
  9. Use a pipette or dropper to add 3-4 drops of neutral balsam to the slide, and cover it slowly with a cover slide. Air-dry the slides at room temperature.

8. Immunohistochemical (IHC) staining

  1. Melt the paraffin sections at 60 °C for 30 min, soak the sections in 100% xylene for 10 min, and repeat this step twice.
  2. Agitate the sections on a shaker first with absolute ethanol, 90% ethanol, and 80% ethanol for 2 min (each), successively, and then with deionized water for 3 min. Repeat the agitation with deionized water twice.
  3. Agitate the sections on a shaker first with a mixture of 20 mL of 30% H2O2 and 180 mL of methanol for 10 min and then deionized water for 5 min. Repeat this step three times.
  4. Transfer the sections to preboiled citric acid buffer (1 L deionized water with 3 g of Na3C6H5O7.2H2O and 0.4 g C6H8O7, pH 6.0), microwave for 10 min to keep them at subcritical boiling point, and cool at room temperature for 30 min. Agitate the sections with deionized water on a shaker for 5 min. Repeat this step three times.
  5. Agitate the sections with 10 mM PBS on a shaker for 5 min, and repeat this step three times. Enclose the tissue area on the wet box with a water-repellant marker, add a drop of ready-to-use nonimmune goat serum to cover the samples, and place them at room temperature for 1 h.
  6. Remove the serum, add primary antibody to the samples (see the Table of Materials), and incubate them overnight at 4 °C. Remove the primary antibody, agitate the sections with 10 mM PBS on a shaker for 5 min, and repeat this agitation step with 10 mM PBS three times.
  7. Add secondary antibody (see the Table of Materials) to cover the samples and incubate them on a wet box for 30 min at room temperature. Agitate the sections with 10 mM PBS on a shaker for 5 min, and repeat the agitation step three times.
  8. Add freshly prepared 0.03-0.05% 3,3'-diaminobenzidine (DAB) solution to cover the samples on the wet box and stain for 30-90 s. Rinse the sections with running water for 10 min.
    NOTE: Control the staining time by observing under a light microscope until yellow color appears.
  9. Add 4 mg/mL hematoxylin solution to cover the samples, stain for 5 min on a wet box, and rinse the sections with running water for 10 min.
  10. Agitate the sections on a shaker with 80% ethanol, 90% ethanol, and absolute ethanol for 2 min each, successively, and soak the sections in 100% xylene for 30 min.
  11. Use a pipette or dropper to add 3-4 drops of neutral balsam to the slide, and cover it slowly with a cover slide. Air-dry the slides at room temperature.

9. Global immunofluorescence staining of organoids/spheres

NOTE: Collect the organoids/spheres fixed with 4% PFA solution in a 1.5 mL microcentrifuge tube (see steps 5.1 to 5.4). Perform the fluorescence labeling as follows.

  1. Dehydrate the organoids/spheres by adding 1 mL of 30% sucrose solution to the tube and incubate it overnight in a refrigerator at 4 °C.
  2. Add 100 µL of PBST solution (10 mM PBS solution with 0.1% Triton X-100) to the tube to rinse the organoids/spheres for 5 min, centrifuge the tube at 100 × g for 1 min, and collect the pellet. Repeat this step three times.
  3. Add 0.5-1 mL of ready-to-use nonimmune goat serum to the tube and seal it at room temperature for 1 h. Centrifuge the tube at 100 × g for 1 min and collect the pellet.
  4. Add several drops of diluted primary antibody to just cover the pellet and incubate in a refrigerator at 4 °C for 48 h. Centrifuge the tube at 100 × g for 1 min and collect the pellet.
  5. Repeat step 9.2.
  6. Add several drops of a fluorescent secondary antibody and 4',6-diamidino-2-phenylindole (DAPI) solution to the tube to just cover the pellet and incubate in a refrigerator at 4 °C for 24 h, avoiding light.
  7. Repeat step 9.2, avoiding light.
  8. Add 100 µL of PBST solution to the tube and store it temporarily in a 4 °C refrigerator, away from light. Observe and photograph the organoids/spheres using the light-sheet scanning microscope.

10. LGSC pLX-mCherry transfection

NOTE: Production of lentiviral particles must be performed in a biosafety cabinet and a clean bench at BSL2 biosafety level.

  1. Culture the lentivirus packaging cell 293T in a 6-well plate with DMEM + 10% FBS at 37 °C, 5% CO2 for 3-5 days to reach 80% cell confluency.
  2. Transfect the lentivirus vector pLX-mCherry into LGSCs.
    NOTE: Reagent preparation is indicated for one well of a 6-well plate.
    1. Prepare two sterile 1.5 mL centrifuge tubes and add 250 µL of DMEM/F12 to each tube.
    2. Add 7.5 µL of transfection reagent to one tube and mix the reagent thoroughly by pipetting.
    3. Add 2 µg of pLX-mCherry plasmid without endotoxin and matching lentivirus packaging plasmid into another tube, and add the transfection reagent (2 µL/µg of plasmid).
    4. Mix the liquid in both centrifuge tubes and let the mixtures stand for 5 min at room temperature.
    5. Remove the culture medium of the 293T cells and add the mixture from step 10.2.4 to the 293T cells. Change the culture medium to fresh DMEM + 10% FBS after 8 h.
    6. After 48 h, collect the virus supernatant for the first time and filter it through a 0.45 µm filter. After 72 h, collect the virus supernatant for the second time and filter it through a 0.45 µm filter again.
      NOTE: Store both filtered supernatants on ice until lentivirus transduction.
  3. Obtain the LGSCs from DED mice (NOD/ShiLtJ) (see step 1).
  4. Add 1 mL of the precollected pLX-mCherry lentivirus supernatant to resuspend the cells.
  5. Set the centrifuge tube on a shaker in the CO2 incubator at 37 °C. Shake it at 100 rpm to maximize contact between the lentivirus and the cells. After 8 h, centrifuge the mixture at 250 × g for 4 min and remove the supernatant.
  6. Add 1 mL of DMEM/F12 to resuspend the cell pellet. Use a cell counter to determine the cell number and seed a total of 1 × 104 cells into 100 µL of matrix gel-LGSCM matrix (matrix gel: LGSCM = 1:1) in each well of a 24-well plate precoated with 20 µL of matrix gel-LGSCM matrix (see step 1.3.2).
  7. After 7 days of culture (see step 1), select spheres exhibiting red fluorescence under a fluorescence microscope to expand the culture.

11. LGSC orthotopic transplantation

NOTE: All surgical operations are performed in an SPF operating room, and all surgical instruments are sterilized.

  1. Obtain the LGSC spheres from ROSA26mT/mG mice with red fluorescence (td-Tomato) or mCherry transfection cultured for 7 days (see step 1).
  2. Cool a 1.5 mL microcentrifuge tube containing a 1:1 mixture of matrix gel and DMEM/F12 on ice before use. Digest the LGSC spheres into single cells and resuspend the cells at a density of 2 × 106 cells/mL in the tube.
  3. Anesthetize the NOD/ShiLtJ mice by intraperitoneal injection of pentobarbital sodium (50 mg/kg).
    NOTE: NOD/ShiLtJ mouse is an ideal model with idiopathic ADDED symptoms, including reduced tear secretion, inflammatory infiltration, and orbital ulceration.
  4. After anesthesia, use saline or vet ointment on eyes to prevent dryness, and then use ophthalmic scissors to make a 5-8 mm cut in the skin behind the ear (near the eye) of the anesthetic mice to expose the LGs.
    NOTE: Iodophor should be strictly used for disinfection around the incision.
  5. Inject 2 × 104 cells into the left-side LG and inject the mixture without cells (see step 11.2) into the right-side LG as the control.
  6. After injection, restore the LGs to their original positions with ophthalmic forceps and suture the wound. Feed the mice for 2 months and observe the effect of the treatment.
    NOTE: The cage cushion material must also be strictly sterilized after the operation, and the cushion material should be replaced once a day. After suturing the wound, tramadol can be selectively injected into the tail vein of mice at the standard dose of 2.5 mg/kg to achieve analgesia.
  7. Anesthetize these mice 2 months after the experiment (see step 11.3). Film the symptoms of the ocular region.
    1. During anesthesia, look for the following symptoms: neck and limb muscle relaxation; deep, slow, and steady breathing; pupil narrowing; corneal reflex disappearance.
    2. During anesthesia and operation, keep the body temperature of mice at 37 °C. After surgery, add appropriate antibiotics to the drinking water for mice to reduce the risk of wound infection. Do not leave the mice unattended until they have regained sufficient consciousness to maintain sternal recumbency. Do not return the mice that have undergone surgery to the company of other mice until fully recovered.
    3. After filming the symptoms of the ocular region, open the ImageJ software, click on File | Open | Freehand selections, hold down the left mouse button, and select the area of orbital ulceration in the image. Click on Analyze | Measure to obtain the relative area of ulceration.
  8. Put the phenol red cotton thread on the lateral canthus of anesthetic mice for 10 s; measure and record the length of the discolored part of the cotton thread. Euthanize the mice by cervical vertebra dislocation after tear measurement.
  9. Dissect the mice and obtain the LGs for IHC analysis.

12. RNA isolation

NOTE: Before the experiment, precool the centrifuge to 4 °C and guarantee all reagents and consumables are free from RNAse contamination.

  1. Collect LGSCs or LG fragments in a microcentrifuge tube. Add 1 mL of cell lysis buffer and fully lyse the cells or tissues by vortex oscillation.
  2. Add 0.2 mL of chloroform, and let it stand at room temperature for 10 min after vortex oscillation for 1 min. Centrifuge for 15 min at 4 °C, 12,000 × g.
    NOTE: After centrifugation, the liquid is divided into three layers, and the RNA is in the uppermost transparent aqueous phase.
  3. Carefully pipette the uppermost transparent aqueous phase and transfer it to a new 1.5 mL RNAse-free centrifuge tube.
  4. Add an equal volume of isopropyl alcohol and mix gently. Let the mixture stand at room temperature for 10 min and then centrifuge for 15 min at 4 °C, 12,000 × g.
  5. Remove the supernatant, and add 1 mL of 75% ethanol. Invert the tube to wash the pellet and centrifuge for 5 min at 4 °C, 7,500 × g. Repeat this step.
  6. Remove the supernatant carefully and put the centrifuge tube in the ultraclean workbench to dry it for about 20 min.
    NOTE: Proceed to the next step when the white pellet becomes translucent. Carry out all operations on ice.
  7. Add 20 µL of RNAse-free water to dissolve the pellet completely. Measure the RNA concentration using a spectrophotometer (see the Table of Materials) and store the RNA solution at -80 °C.

13. PCR

  1. Reverse transcription reaction
    1. Add 1 µg of total RNA (calculate the volume of added RNA solution according to the concentration of the RNA solution) into the PCR reaction tube and incubate at 65 °C for 5 min for denaturation.
    2. Put it on ice for 1 min and then add enzyme-free water until the total volume reaches 12 µL. Add 4 µL of 4x DNA Master Mix and incubate it at 37 °C for 5 min.
    3. Put the tube on ice, add 4 µL of 5x RT Master Mix, and mix it gently. Set the following PCR settings: 37 °C for 15 min, 50 °C for 5 min, 98 °C for 5 min, 4 °C for 1 min.
    4. Store it at -20 °C or proceed to the next step after the reverse transcription reaction is completed.
  2. PCR reaction
    1. Prepare the PCR reaction in the PCR tube as follows: 14.1 µL of enzyme-free water, 2 µL of dNTP, 2 µL of 10x Buffer, 0.8 µL of Primer (10 µM, 0.4 µL of Forward Primer, and 0.4 µL of Reverse Primer, refer to the Table of Materials), 1 µL of reverse transcription cDNA (refer to step 13.1) and 0.1 µL of Taq enzyme.
    2. Place the prepared PCR reaction in the PCR apparatus for PCR. Refer to the instructions of the Taq enzyme kit for the PCR procedure (see the Table of Materials).
  3. Agarose gel electrophoresis
    1. Use an analytical balance to weigh 242 g of Tris and 37.2 g of Na2EDTA·2H2O and add them to a 1 L beaker. Add ~800 mL of deionized water and 57.1 mL of glacial acetic acid to the beaker, mix well, add deionized water to 1 L to obtain 50x TAE buffer, and store it at room temperature.
      NOTE: Dilute 50x TAE buffer with deionized water before use.
    2. Use an analytical balance to weigh 1.2 g of agarose and add it to a conical flask containing 80 mL of 1x TAE buffer. Heat it repeatedly in the microwave oven until completely dissolved.
    3. Cool the flask under running tap water until the solution temperature drops to 60 °C. Add 8 µL of nucleic acid stain, pour the solution into the gelatinizing tank after mixing well, place the comb, and let it stand at room temperature for 30 min.
    4. Pull out the comb and load the PCR products in the prepared agarose gel. Perform electrophoresis at 120 V for 30 min.
    5. Place the gel in the ECL Gel imaging system and photograph.

Access restricted. Please log in or start a trial to view this content.

Results

Establish 3D, serum-free culture system
In this study, LGSCM containing EGF, Wnt3A, FGF10, and Y-27632 for mouse LGSCs was developed, and LGSCs were successfully isolated and cultured by a 3D culture method (Figure 1A). A successful 3D, serum-free culture system of LGSCs from C57BL/6 mice, NOD/ShiLtJ mice, BALB/c mice, and ROSA26mT/mG mice has been established using this method16. For a male mouse, 1.5-2 × 106 cells were obta...

Access restricted. Please log in or start a trial to view this content.

Discussion

There are well-established methods for the isolation and in vitro culture of lacrimal stem cells for lacrimal stem cell culture and LG injury repair. Shatos et al.17 and Ackermannet al.6 successfully cultured and subcultured lacrimal stem cells of rats and mice by 2D culture methods, respectively, making it possible to transplant lacrimal stem cells for the treatment of ADDED. Studies on stem cells18 and mesenchymal stem cells

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no competing interests.

Acknowledgements

This work was supported by a grant from the National Natural Science Foundation of China (No. 31871413) and two Programs of Guangdong Science and Technology (2017B020230002 and 2016B030231001). We are truly grateful to the researchers who have helped us during the study and to the staff members working in the animal center for their support in animal care.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
Animal(Mouse)
Bal B/CModel Animal Research Center of Nanjing University
C57 BL/6JLaboratory Animal Center of Sun Yat-sen University
NOD/ShiLtJModel Animal Research Center of Nanjing University
ROSA26mT/mGModel Animal Research Center of Nanjing University
Equipment
Analytical balanceSartorius
Automatic dehydratorThermo
Blood counting chamberBLAU
Cell CounterCountStar
CO2 constant temperature incubatorThermo
ECL Gel imaging systemGE healthcare
Electric bath for water bathYiheng Technology
Electrophoresis apparatusBioRad
Fluorescence quantitative PCR instrumentRoche
Frozen tissue slicerLecia
Horizontal centrifugeCENCE
Inverted fluorescence microscopeNikon
Inverted microscopeOlympus
Laser lamellar scanning micrographCarl Zeiss
Liquid nitrogen containerThermo
Low temperature high speed centrifugeEppendorf
MicropipettorGilson
Microwave ovenPanasonic
Nanodrop ultraviolet spectrophotometerThermomeasure RNA concentration
Paraffin slicing machineThermo
PCR AmplifierEppendorf
pH value testerSartorius
4 °C RefrigeratorHaier
Thermostatic culture oscillatorZHICHENG
Tissue paraffin embedding instrumentThermo
 -80°C Ultra-low temperature refrigeratorThermo
 -20°C Ultra-low temperature refrigeratorThermo
Ultra pure water purification systemELGA
Reagent
Animal Experiment
HCGSigma9002-61-3
PMSGSigma14158-65-7
Pentobarbital SodiumSigma57-33-0
Cell Culture
B27Gibco17504044
Collagenase IGibco17018029
DispaseBD354235
DMEMSigmaD6429
DMEM/F12SigmaD0697
DMSOSigma67-68-5
EDTASangon BiotechA500895
Foetal Bovine SerumGibco04-001-1ACS
GlutaMaxGibco35050087
Human FGF10PeproTech100-26
Matrigel (Matrix gel)BD356231
Murine NogginPeproTech250-38
Murine Wnt3APeproTech315-20
Murine EGFPeproTech315-09
NEAAGibco11140050
N2Gibco17502048
R-spondin 1PeproTech120-38
Trypsin Inhibitor (TI)SigmaT6522Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin.
TrypsinSigma T4799
Y-27632SelleckS1049
HE staining & Immunostaining
Alexa Fluor 488 donkey anti-Mouse IgGThermoA-21202Used dilution: IHC) 2 μg/mL, (IF) 0.2 μg/mL
Alexa Fluor 488 donkey anti-Rabbit IgGThermoA-21206Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL
Alexa Fluor 568 donkey anti-Mouse IgGThermoA-10037Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL
Alexa Fluor 568 donkey anti-Rabbit IgGThermoA-10042Used dilution: (IHC) 2 μg/mL, (IF) 4 μg/mL
Anti-AQP5 rabbit antibodyAbcamab104751Used dilution: (IHC) 1 μg/mL, (IF) 0.1 μg/mL
Anti-E-cadherin Rat antibodyAbcamab11512Used dilution: (IF)  5 μg/mL
Anti-Keratin14 rabbit antibodyAbcamab181595Used dilution: (IHC) 1 μg/mL, (IF) 2 μg/mL
Anti-Ki67 rabbit antibodyAbcamab15580Used dilution: (IHC) 1 μg/mL, (IF) 1 μg/mL
Anti-mCherry mouse antibodyAbcamab125096Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL
Anti-mCherry rabbit antibodyAbcamab167453Used dilution: (IF)  2 μg/mL
C6H8O7Sangon BiotechA501702-0500
Citric AcidSangon Biotech201-069-1
DAB Kit (20x)CWBIOCW0125
DAPIThermo62248
EosinBASO68115
Fluorescent Mounting MediumDakoS3023
FormalinSangon BiotechA501912-0500
Goat anti-Mouse IgG antibody (HRP)Abcamab6789Used dilution: 2 μg/mL
Goat anti-Rabbit IgG antibody(HRP)Abcamab6721Used dilution: 2 μg/mL
HematoxylinBASO517-28-2
Histogel (Embedding hydrogel)ThermoHG-400-012
30% H2O2Guangzhou ChemistryKD10
30% Hydrogen Peroxide SolutionGuangzhou Chemistry7722-84-1
MethanolGuangzhou Chemistry67-56-1
Na3C6H5O7.2H2OSangon BiotechA501293-0500
Neutral balsamSHANGHAI YIYANGYY-Neutral balsam
Non-immunized Goat SerumBOSTERAR0009
ParaffinSangon BiotechA601891-0500
ParaformaldehydeDAMAO200-001-8
SaccharoseGuangzhou Chemistry57-50-1
Sodium citrate tribasic dihydrateSangon Biotech200-675-3
SucroseGuangzhou ChemistryIB11-AR-500G
Tissue-Tek O.T.C. CompoundSAKURASAKURA.4583
Triton X-100DINGGUO9002-93-1
XyleneGuangzhou Chemistry128686-03-3
RT-PCR & qRT-PCR
AgaroseSigma9012-36-6
AlcoholGuangzhou Chemistry64-17-5
ChloroformGuangzhou Chemistry865-49-6
Ethidium BromideSangon Biotech214-984-6
Isopropyl AlcoholGuangzhou Chemistry67-63-0
LightCycler 480 SYBR Green I Master MixRoche488735200H
ReverTra Ace qPCR RT Master MixTOYOBO-
Taq DNA PolymeraseTAKARAR10T1
Goldview (nucleic acid stain)BioSharpBS357A
TRIzolMagenR4801-02
Vector Construction & Cell Transfection
AgarOXID-
AmpicillinSigma69-52-3
ChloramphenicolSigma56-75-7
Endotoxin-free Plasmid Extraction KitThermoA36227
KanamycinSigma25389-94-0
Lipo3000 Plasmid Transfection KitThermoL3000015
LR Reaction KitThermo11791019
Plasmid Extraction KitTIANGENDP103
Trans5α Chemically Competent CellTRANSGENCD201-01
TrytoneOXID-
Yeast ExtractOXID-
Primers and SequenceCompany
Primer: AQP5
Sequence:
F: CATGAACCCAGCCCGATCTT
R: CTTCTGCTCCCATCCCATCC
Synbio Tech
Primer: β-actin
Sequence:
F: AGATCAAGATCATTGCTCCTCCT
R: AGATCAAGATCATTGCTCCTCCT
Synbio Tech
Primer: Epcam
Sequence:
F: CATTTGCTCCAAACTGGCGT
R: TGTCCTTGTCGGTTCTTCGG
Synbio Tech
Primer: Krt5
Sequence:
F: AGCAATGGCGTTCTGGAGG
R: GCTGAAGGTCAGGTAGAGCC
Synbio Tech
Primer: Krt14
Sequence:
F: CGGACCAAGTTTGAGACGGA
R: GCCACCTCCTCGTGGTTC
Synbio Tech
Primer: Krt19
Sequence:
F: TCTTTGAAAAACACTGAACCCTG
R: TGGCTCCTCAGGGCAGTAAT
Synbio Tech
Primer: Ltf
Sequence:
F: CACATGCTGTCGTATCCCGA
R: CGATGCCCTGATGGACGA
Synbio Tech
Primer: Nestin
Sequence:
F: GGGGCTACAGGAGTGGAAAC
R: GACCTCTAGGGTTCCCGTCT
Synbio Tech
Primer: P63
Sequence:
F: TCCTATCACGGGAAGGCAGA
R: GTACCATCGCCGTTCTTTGC
Synbio Tech
Vector
pLX302 lentivirus no-load vectorAddgene
pENRTY-mCherryXiaofeng Qin laboratory, Sun Yat-sen University

References

  1. Zoukhri, D., Macari, E., Kublin, C. L. A single injection of interleukin-1 induces reversible aqueous tear deficiency, lacrimal gland inflammation, and acinar and ductal cell proliferation. Experimental Eye Research. 84 (5), 894-904 (2007).
  2. Gromova, A., et al. Lacrimal gland repair using progenitor cells. Stem Cells Translational Medicine. 6 (1), 88-98 (2016).
  3. Buzhor, E., et al. Cell-based therapy approaches: the hope for incurable diseases. Regenerative Medicine. 9 (5), 649-672 (2014).
  4. Tiwari, S., et al. Establishing human lacrimal gland cultures with secretory function. PLoS One. 7 (1), 29458(2012).
  5. You, S., Kublin, C. L., Avidan, O., Miyasaki, D., Zoukhri, D. Isolation and propagation of mesenchymal stem cells from the lacrimal gland. Investigative Ophthalmology & Visual Science. 52 (5), 2087-2094 (2011).
  6. Ackermann, P., et al. Isolation and investigation of presumptive murine lacrimal gland stem cells. Investigative Ophthalmology & Visual Science. 56 (8), 4350-4363 (2015).
  7. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459 (7244), 262-265 (2009).
  8. Lugli, N., et al. R-spondin 1 and noggin facilitate expansion of resident stem cells from non-damaged gallbladders. EMBO Reports. 17 (5), 769-779 (2016).
  9. Huch, M., et al. Long-term culture of genome-stable bipotent stem cells from adult human liver. Cell. 160 (1), 299-312 (2015).
  10. Boj, S. F., et al. Organoid models of human and mouse ductal pancreatic cancer. Cell. 160 (1), 324-338 (2015).
  11. Barker, N., et al. Lgr5+(ve) stem cells drive self-renewal in the stomach and build long-lived gastric units in vitro. Cell Stem Cell. 6 (1), 25-36 (2010).
  12. Linnemann, J. R., et al. Quantification of regenerative potential in primary human mammary epithelial cells. Development. 142 (18), 3239-3251 (2015).
  13. Rock, J. R., et al. Basal cells as stem cells of the mouse trachea and human airway epithelium. Proceedings of the National Academy of Sciences of the United States of America. 106 (31), 12771-12775 (2009).
  14. Chua, C. W., et al. Single luminal epithelial progenitors can generate prostate organoids in culture. Nature Cell Biology. 16 (1), 951-961 (2014).
  15. Maimets, M., et al. Long-term in vitro expansion of salivary gland stem cells driven by Wnt signals. Stem Cell Reports. 6 (1), 150-162 (2016).
  16. Xiao, S., Zhang, Y. Establishment of long-term serum-free culture for lacrimal gland stem cells aiming at lacrimal gland repair. Stem Cell Research & Therapy. 11 (1), 20(2020).
  17. Shatos, M. A., Haugaard-Kedstrom, L., Hodges, R. R., Dartt, D. A. Isolation and characterization of progenitor cells in uninjured, adult rat lacrimal gland. Investigative Ophthalmology & Visual Science. 53 (6), 2749-2759 (2012).
  18. Mishima, K., et al. Transplantation of side population cells restores the function of damaged exocrine glands through clusterin. Stem Cells. 30 (9), 1925-1937 (2012).
  19. Aluri, H. S., et al. Delivery of bone marrow-derived mesenchymal stem cells improves tear production in a mouse model of sjögren's syndrome. Stem Cells International. 2017, 1-10 (2017).
  20. Dietrich, J., Schrader, S. Towards lacrimal gland regeneration: current concepts and experimental approaches. Current Eye Research. 45 (3), 230-240 (2020).
  21. Sato, T., Clevers, H. SnapShot: growing organoids from stem cells. Cell. 161 (7), 1700(2015).
  22. Kleinman, H. K., Martin, G. R. Matrigel: basement membrane matrix with biological activity. Seminars in Cancer Biology. 15 (5), 378-386 (2005).
  23. Arnaoutova, I., George, J., Kleinman, H. K., Benton, G. Basement membrane matrix (BME) has multiple uses with stem cells. Stem Cell Reviews and Reports. 8 (1), 163-169 (2012).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Three Dimensional CultureStem Cell DifferentiationAcinar Cell InductionDuctal Cell DifferentiationMatrix Gel CultureStem Cell MarkersPrimary Cell IsolationStem Cell Expansion