The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.
A subscription to JoVE is required to view this content. Sign in or start your free trial.
Method Article
The three-dimensional, serum-free culture method for adult lacrimal gland (LG) stem cells is well established for the induction of LG organoid formation and differentiation into acinar or ductal-like cells.
Lacrimal gland (LG) stem cell-based therapy is a promising strategy for lacrimal gland diseases. However, the lack of a reliable, serum-free culture method to obtain a sufficient number of LG stem cells (LGSCs) is one obstacle for further research and application. The three-dimensional (3D), serum-free culture method for adult mouse LGSCs is well established and shown here. The LGSCs could be continuously passaged and induced to differentiate to acinar or ductal-like cells.
For the LGSC primary culture, the LGs from 6-8-week-old mice were digested with dispase, collagenase I, and trypsin-EDTA. A total of 1 × 104 single cells were seeded into 80 µL of matrix gel-lacrimal gland stem cell medium (LGSCM) matrix in each well of a 24-well plate, precoated with 20 µL of matrix gel-LGSCM matrix. The mix was solidified after incubation for 20 min at 37 °C, and 600 µL of LGSCM added.
For LGSC maintenance, LGSCs cultured for 7 days were disaggregated into single cells by dispase and trypsin-EDTA. The single cells were implanted and cultured according to the method used in the LGSC primary culture. LGSCs could be passaged over 40 times and continuously express stem/progenitor cell markers Krt14, Krt5, P63, and nestin. LGSCs cultured in LGSCM have self-renewal capacity and can differentiate into acinar or ductal-like cells in vitro and in vivo.
Lacrimal gland stem cells (LGSCs) maintain lacrimal gland (LG) cell renewal and are the source of acinar and ductal cells. Therefore, LGSC transplantation is considered an alternative approach for treating severe inflammatory damage and aqueous-deficient dry eye disease (ADDED)1,2,3. Several culture methods have been applied to enrich LGSCs. Tiwari et al. separated and cultured primary LG cells using collagen I and matrix gel supplemented with several growth factors; however, the LG cells could not be continuously cultured4. Using two-dimensional (2D) culture, mouse LG-derived stem cells were isolated by You et al.5 and Ackermann et al.6, found to express the stem/progenitor cell marker genes, Oct4, Sox2, Nanog, and nestin, and could be subcultured. However, there is no clear indication that these cells can differentiate into acinar or ductal cells, and there is no transplantation experiment to verify the differentiation potential in vivo.
Recently, c-kit+ dim/EpCAM+/Sca1-/CD34-/CD45- cells were isolated from mouse LGs by flow cytometry, found to express LG progenitor cell markers, such as Pax6 and Runx1, and differentiated into ducts and acini in vitro. In mice with ADDED, orthotopic injection with these cells could repair damaged LGs and restore the secretory function of LGs2. However, the number of stem cells isolated by this method was small, and there are no suitable culture conditions for expanding the isolated LGSCs. In summary, an appropriate culture system needs to be established to effectively isolate and culture adult LGSCs with stable and continuous expansion for the study of LGSCs in the treatment of ADDED.
Organoids derived from stem cells or pluripotent stem cells are a group of cells that are histologically similar to the related organs and can maintain their own renewal. After the mouse intestine organoid was successfully cultured by Sato et al. in 20097, organoids from other organs were cultured in succession, based on Sato's culture system, such as gallbladder8, liver9, pancreas10, stomach11, breast12, lung13, prostate14, and salivary gland15. Due to the high proportion of adult stem cells before cell differentiation in organoid culture, the three-dimensional (3D) organoid culture method is considered optimal for the isolation and culture of adult stem cells of LG.
An adult mouse LGSC culture system was established in the present study by optimizing the 3D, serum-free culture method. It is proven that the LGSCs cultured from both normal and ADDED mice showed a stable capacity of self-renewal and proliferation. After transplantation into the ADDED mouse LGs, LGSCs colonized the impaired LGs and improved tear production. In addition, red fluorescent LGSCs were isolated from ROSA26mT/mG mice and cultured. This work provides a reliable reference for LGSC enrichment in vitro and LGSC autograft in clinical application for ADDED therapy.
Access restricted. Please log in or start a trial to view this content.
All the experiments in this protocol followed the animal care guidelines of the Ethical Committee on Animal Trial of Sun Yat-sen University. All cell-related operations are to be performed on the ultraclean workbench in the cell operation room. All operations using xylene are to be carried out in fume hoods.
1. LGSC primary culture
2. LGSC maintenance and passage
3. LGSC differentiation
4. LG tissue dehydration
5. LG organoid/sphere dehydration
6. Paraffin embedding and sectioning
7. Hematoxylin and eosin staining
8. Immunohistochemical (IHC) staining
9. Global immunofluorescence staining of organoids/spheres
NOTE: Collect the organoids/spheres fixed with 4% PFA solution in a 1.5 mL microcentrifuge tube (see steps 5.1 to 5.4). Perform the fluorescence labeling as follows.
10. LGSC pLX-mCherry transfection
NOTE: Production of lentiviral particles must be performed in a biosafety cabinet and a clean bench at BSL2 biosafety level.
11. LGSC orthotopic transplantation
NOTE: All surgical operations are performed in an SPF operating room, and all surgical instruments are sterilized.
12. RNA isolation
NOTE: Before the experiment, precool the centrifuge to 4 °C and guarantee all reagents and consumables are free from RNAse contamination.
13. PCR
Access restricted. Please log in or start a trial to view this content.
Establish 3D, serum-free culture system
In this study, LGSCM containing EGF, Wnt3A, FGF10, and Y-27632 for mouse LGSCs was developed, and LGSCs were successfully isolated and cultured by a 3D culture method (Figure 1A). A successful 3D, serum-free culture system of LGSCs from C57BL/6 mice, NOD/ShiLtJ mice, BALB/c mice, and ROSA26mT/mG mice has been established using this method16. For a male mouse, 1.5-2 × 106 cells were obta...
Access restricted. Please log in or start a trial to view this content.
There are well-established methods for the isolation and in vitro culture of lacrimal stem cells for lacrimal stem cell culture and LG injury repair. Shatos et al.17 and Ackermannet al.6 successfully cultured and subcultured lacrimal stem cells of rats and mice by 2D culture methods, respectively, making it possible to transplant lacrimal stem cells for the treatment of ADDED. Studies on stem cells18 and mesenchymal stem cells
Access restricted. Please log in or start a trial to view this content.
The authors declare that they have no competing interests.
This work was supported by a grant from the National Natural Science Foundation of China (No. 31871413) and two Programs of Guangdong Science and Technology (2017B020230002 and 2016B030231001). We are truly grateful to the researchers who have helped us during the study and to the staff members working in the animal center for their support in animal care.
Access restricted. Please log in or start a trial to view this content.
| Name | Company | Catalog Number | Comments |
|---|---|---|---|
| Animal(Mouse) | |||
| Bal B/C | Model Animal Research Center of Nanjing University | ||
| C57 BL/6J | Laboratory Animal Center of Sun Yat-sen University | ||
| NOD/ShiLtJ | Model Animal Research Center of Nanjing University | ||
| ROSA26mT/mG | Model Animal Research Center of Nanjing University | ||
| Equipment | |||
| Analytical balance | Sartorius | ||
| Automatic dehydrator | Thermo | ||
| Blood counting chamber | BLAU | ||
| Cell Counter | CountStar | ||
| CO2 constant temperature incubator | Thermo | ||
| ECL Gel imaging system | GE healthcare | ||
| Electric bath for water bath | Yiheng Technology | ||
| Electrophoresis apparatus | BioRad | ||
| Fluorescence quantitative PCR instrument | Roche | ||
| Frozen tissue slicer | Lecia | ||
| Horizontal centrifuge | CENCE | ||
| Inverted fluorescence microscope | Nikon | ||
| Inverted microscope | Olympus | ||
| Laser lamellar scanning micrograph | Carl Zeiss | ||
| Liquid nitrogen container | Thermo | ||
| Low temperature high speed centrifuge | Eppendorf | ||
| Micropipettor | Gilson | ||
| Microwave oven | Panasonic | ||
| Nanodrop ultraviolet spectrophotometer | Thermo | measure RNA concentration | |
| Paraffin slicing machine | Thermo | ||
| PCR Amplifier | Eppendorf | ||
| pH value tester | Sartorius | ||
| 4 °C Refrigerator | Haier | ||
| Thermostatic culture oscillator | ZHICHENG | ||
| Tissue paraffin embedding instrument | Thermo | ||
| -80°C Ultra-low temperature refrigerator | Thermo | ||
| -20°C Ultra-low temperature refrigerator | Thermo | ||
| Ultra pure water purification system | ELGA | ||
| Reagent | |||
| Animal Experiment | |||
| HCG | Sigma | 9002-61-3 | |
| PMSG | Sigma | 14158-65-7 | |
| Pentobarbital Sodium | Sigma | 57-33-0 | |
| Cell Culture | |||
| B27 | Gibco | 17504044 | |
| Collagenase I | Gibco | 17018029 | |
| Dispase | BD | 354235 | |
| DMEM | Sigma | D6429 | |
| DMEM/F12 | Sigma | D0697 | |
| DMSO | Sigma | 67-68-5 | |
| EDTA | Sangon Biotech | A500895 | |
| Foetal Bovine Serum | Gibco | 04-001-1ACS | |
| GlutaMax | Gibco | 35050087 | |
| Human FGF10 | PeproTech | 100-26 | |
| Matrigel (Matrix gel) | BD | 356231 | |
| Murine Noggin | PeproTech | 250-38 | |
| Murine Wnt3A | PeproTech | 315-20 | |
| Murine EGF | PeproTech | 315-09 | |
| NEAA | Gibco | 11140050 | |
| N2 | Gibco | 17502048 | |
| R-spondin 1 | PeproTech | 120-38 | |
| Trypsin Inhibitor (TI) | Sigma | T6522 | Derived from Glycine max; can inhibit trypsin, chymotrypsin, and plasminase to a lesser extent. One mg will inhibit 1.0-3.0 mg of trypsin. |
| Trypsin | Sigma | T4799 | |
| Y-27632 | Selleck | S1049 | |
| HE staining & Immunostaining | |||
| Alexa Fluor 488 donkey anti-Mouse IgG | Thermo | A-21202 | Used dilution: IHC) 2 μg/mL, (IF) 0.2 μg/mL |
| Alexa Fluor 488 donkey anti-Rabbit IgG | Thermo | A-21206 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Mouse IgG | Thermo | A-10037 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Alexa Fluor 568 donkey anti-Rabbit IgG | Thermo | A-10042 | Used dilution: (IHC) 2 μg/mL, (IF) 4 μg/mL |
| Anti-AQP5 rabbit antibody | Abcam | ab104751 | Used dilution: (IHC) 1 μg/mL, (IF) 0.1 μg/mL |
| Anti-E-cadherin Rat antibody | Abcam | ab11512 | Used dilution: (IF) 5 μg/mL |
| Anti-Keratin14 rabbit antibody | Abcam | ab181595 | Used dilution: (IHC) 1 μg/mL, (IF) 2 μg/mL |
| Anti-Ki67 rabbit antibody | Abcam | ab15580 | Used dilution: (IHC) 1 μg/mL, (IF) 1 μg/mL |
| Anti-mCherry mouse antibody | Abcam | ab125096 | Used dilution: (IHC) 2 μg/mL, (IF) 2 μg/mL |
| Anti-mCherry rabbit antibody | Abcam | ab167453 | Used dilution: (IF) 2 μg/mL |
| C6H8O7 | Sangon Biotech | A501702-0500 | |
| Citric Acid | Sangon Biotech | 201-069-1 | |
| DAB Kit (20x) | CWBIO | CW0125 | |
| DAPI | Thermo | 62248 | |
| Eosin | BASO | 68115 | |
| Fluorescent Mounting Medium | Dako | S3023 | |
| Formalin | Sangon Biotech | A501912-0500 | |
| Goat anti-Mouse IgG antibody (HRP) | Abcam | ab6789 | Used dilution: 2 μg/mL |
| Goat anti-Rabbit IgG antibody(HRP) | Abcam | ab6721 | Used dilution: 2 μg/mL |
| Hematoxylin | BASO | 517-28-2 | |
| Histogel (Embedding hydrogel) | Thermo | HG-400-012 | |
| 30% H2O2 | Guangzhou Chemistry | KD10 | |
| 30% Hydrogen Peroxide Solution | Guangzhou Chemistry | 7722-84-1 | |
| Methanol | Guangzhou Chemistry | 67-56-1 | |
| Na3C6H5O7.2H2O | Sangon Biotech | A501293-0500 | |
| Neutral balsam | SHANGHAI YIYANG | YY-Neutral balsam | |
| Non-immunized Goat Serum | BOSTER | AR0009 | |
| Paraffin | Sangon Biotech | A601891-0500 | |
| Paraformaldehyde | DAMAO | 200-001-8 | |
| Saccharose | Guangzhou Chemistry | 57-50-1 | |
| Sodium citrate tribasic dihydrate | Sangon Biotech | 200-675-3 | |
| Sucrose | Guangzhou Chemistry | IB11-AR-500G | |
| Tissue-Tek O.T.C. Compound | SAKURA | SAKURA.4583 | |
| Triton X-100 | DINGGUO | 9002-93-1 | |
| Xylene | Guangzhou Chemistry | 128686-03-3 | |
| RT-PCR & qRT-PCR | |||
| Agarose | Sigma | 9012-36-6 | |
| Alcohol | Guangzhou Chemistry | 64-17-5 | |
| Chloroform | Guangzhou Chemistry | 865-49-6 | |
| Ethidium Bromide | Sangon Biotech | 214-984-6 | |
| Isopropyl Alcohol | Guangzhou Chemistry | 67-63-0 | |
| LightCycler 480 SYBR Green I Master Mix | Roche | 488735200H | |
| ReverTra Ace qPCR RT Master Mix | TOYOBO | - | |
| Taq DNA Polymerase | TAKARA | R10T1 | |
| Goldview (nucleic acid stain) | BioSharp | BS357A | |
| TRIzol | Magen | R4801-02 | |
| Vector Construction & Cell Transfection | |||
| Agar | OXID | - | |
| Ampicillin | Sigma | 69-52-3 | |
| Chloramphenicol | Sigma | 56-75-7 | |
| Endotoxin-free Plasmid Extraction Kit | Thermo | A36227 | |
| Kanamycin | Sigma | 25389-94-0 | |
| Lipo3000 Plasmid Transfection Kit | Thermo | L3000015 | |
| LR Reaction Kit | Thermo | 11791019 | |
| Plasmid Extraction Kit | TIANGEN | DP103 | |
| Trans5α Chemically Competent Cell | TRANSGEN | CD201-01 | |
| Trytone | OXID | - | |
| Yeast Extract | OXID | - | |
| Primers and Sequence | Company | ||
| Primer: AQP5 Sequence: F: CATGAACCCAGCCCGATCTT R: CTTCTGCTCCCATCCCATCC | Synbio Tech | ||
| Primer: β-actin Sequence: F: AGATCAAGATCATTGCTCCTCCT R: AGATCAAGATCATTGCTCCTCCT | Synbio Tech | ||
| Primer: Epcam Sequence: F: CATTTGCTCCAAACTGGCGT R: TGTCCTTGTCGGTTCTTCGG | Synbio Tech | ||
| Primer: Krt5 Sequence: F: AGCAATGGCGTTCTGGAGG R: GCTGAAGGTCAGGTAGAGCC | Synbio Tech | ||
| Primer: Krt14 Sequence: F: CGGACCAAGTTTGAGACGGA R: GCCACCTCCTCGTGGTTC | Synbio Tech | ||
| Primer: Krt19 Sequence: F: TCTTTGAAAAACACTGAACCCTG R: TGGCTCCTCAGGGCAGTAAT | Synbio Tech | ||
| Primer: Ltf Sequence: F: CACATGCTGTCGTATCCCGA R: CGATGCCCTGATGGACGA | Synbio Tech | ||
| Primer: Nestin Sequence: F: GGGGCTACAGGAGTGGAAAC R: GACCTCTAGGGTTCCCGTCT | Synbio Tech | ||
| Primer: P63 Sequence: F: TCCTATCACGGGAAGGCAGA R: GTACCATCGCCGTTCTTTGC | Synbio Tech | ||
| Vector | |||
| pLX302 lentivirus no-load vector | Addgene | ||
| pENRTY-mCherry | Xiaofeng Qin laboratory, Sun Yat-sen University |
Access restricted. Please log in or start a trial to view this content.