Application of RNA Interference in the Pinewood Nematode, Bursaphelenchus xylophilus

Summary

Here, we introduce a detailed soaking method of RNA interference in Bursaphelenchus xylophilus to facilitate the study of gene functions.

Abstract

The pinewood nematode, Bursaphelenchus xylophilus, is one of the most destructive invasive species worldwide, causing the wilting and eventual death of pine trees. Despite the recognition of their economic and environmental significance, it has thus far been impossible to study the detailed gene functions of plant-parasitic nematodes (PPNs) using conventional forward genetics and transgenic methods. However, as a reverse genetics technology, RNA interference (RNAi) facilitates the study of the functional genes of nematodes, including B. xylophilus.

This paper outlines a new protocol for RNAi of the ppm-1 gene in B. xylophilus, which has been reported to play crucial roles in the development and reproduction of other pathogenic nematodes. For RNAi, the T7 promoter was linked to the 5′-terminal of the target fragment by polymerase chain reaction (PCR), and double-stranded RNA (dsRNA) was synthesized by in vitro transcription. Subsequently, dsRNA delivery was accomplished by soaking the nematodes in a dsRNA solution mixed with synthetic neurostimulants. Synchronized juveniles of B. xylophilus (approximately 20,000 individuals) were washed and soaked in dsRNA (0.8 µg/μL) in the soaking buffer for 24 h in the dark at 25 °C.

The same quantity of nematodes was placed in a soaking buffer without dsRNA as a control. Meanwhile, another identical quantity of nematodes was placed in a soaking buffer with green fluorescent protein (gfp) gene dsRNA as a control. After soaking, the expression level of the target transcripts was determined using real-time quantitative PCR. The effects of RNAi were then confirmed using microscopic observation of the phenotypes and a comparison of the body size of the adults among the groups. The current protocol can help advance research to better understand the functions of the genes of B. xylophilus and other parasitic nematodes toward developing control strategies through genetic engineering.

Introduction

Plant-parasitic nematodes (PPNs) are a continuing threat to food security and forest ecosystems. They cause an estimated 100 billion USD in economic losses each year¹, the most problematic of which are primarily root-knot nematodes, cyst nematodes, and pinewood nematodes. The pinewood nematode, Bursaphelenchus xylophilus, is a migratory, endoparasitic nematode, which is the causal pathogen of pine wilt disease². It has caused great harm to pine forests worldwide³. Using the terminology of Van Megen et al.⁴, B. xylophilus is a member of the Parasitaphelenchidae and belongs to clade 10, whereas most other major plant parasites belong to clade 12.

As an independent and recently evolved plant parasite, B. xylophilus is an attractive model for comparative studies. To date, there has been substantial research on root-knot nematodes and cyst nematodes belonging to clade 12, which are obligate, sedentary endoparasites and are some of the most intensely studied nematodes. However, conducting further research in this important area comes with a major challenge: the function of parasitism genes is a research bottleneck. Functional studies generally include ectopic expression and knockdown/out experiments but rely on effective genetic transformation protocols for the nematode. As a result, reverse genetics in PPNs almost exclusively relies on gene silencing by RNAi.

RNAi, a mechanism widely present in eukaryotic cells, silences gene expression by introducing double-stranded RNA (dsRNA)⁵. To date, the posttranscriptional gene-silencing mechanism induced by dsRNA has been found in all studied eukaryotes, and RNAi technology, as a tool of functional genomics research and other applications, has developed rapidly in many organisms. Since the discovery of the RNAi machinery in Caenorhabditis elegans in 1998⁶, RNAi techniques have become effective methods for identifying the gene function of nematodes and are proposed as a new way to effectively control pathogenic nematodes⁷.

RNAi is technically facile-soaking the juveniles in dsRNA can suffice; however, the efficacy and reproducibility of this approach vary widely with the nematode species and the target gene⁸. The silencing of 20 genes involved in the RNAi pathways of the root-knot nematode, Meloidogyne incognita, was investigated using long dsRNAs as triggers, resulting in diverse responses, including an increase and no change in the expression of some genes⁹. These results show that target genes may respond to RNAi knockdown differently, necessitating an exhaustive assessment of their suitability as targets for nematode control via RNAi. However, there is currently a paucity of research on the developmental and reproductive biology of B. xylophilus.

As a continuation of previous work^10,11,12,13, we describe here a protocol for applying RNAi to study the function of the ppm-1 gene of B. xylophilus, including the synthesis of dsRNA, synthetic neurostimulant soaking, and quantitative polymerase chain reaction (qPCR) detection. The knowledge gained from this experimental approach will likely contribute markedly to understanding basic biological systems and preventing pine wilt disease.

Protocol

The study was approved by the council for animal experimentation of Zhejiang Agricultural & Forestry University. The B. xylophilus isolate NXY61 was originally extracted from a diseased Pinus massoniana in the Ningbo area of Zhejiang province, China¹¹.

1. Gene cloning

NOTE: See the Table of Materials for details about the primers used in this protocol.

1. Collect nematodes.
   1. Culture the B. xylophilus strain on the mycelia of Botrytis cinerea on Potato Dextrose Agar (PDA) plates at 25 °C for 3-5 days.
   2. Collect the nematodes using the Bellman funnel method¹⁴.
      1. Place a clamped rubber tube below a funnel and place two layers of filter paper in the mouth of the funnel. Transfer the fungal cultures to the funnel and add water to immerse the fungal mat. Wait for 2 h, then collect the nematodes.
2. Extract the total RNA from the nematodes using a total RNA extraction reagent (see the Table of Materials)¹¹ according to the following steps.
   1. Add 500 µL of extraction reagent and 100 µL of magnetic beads to a 2 mL centrifuge tube. Aspirate 20 µL of the nematodes and transfer the sample to a grinder for grinding at 9,000 × g for 30 s. Incubate for 5 min and then centrifuge for 10 min at 12,000 × g and 4 °C.
   2. Transfer the supernatant to a new centrifuge tube. Add 100 µL of chloroform, cap the tube, and mix by inverting the tube several times. Incubate for 3 min and then centrifuge for 10 min at 12,000 × g at 4 °C.
   3. Transfer the supernatant to a new centrifuge tube. Add 250 µL of isopropyl alcohol and vortex vigorously. Centrifuge at 12,000 × g for 10 min. 
   4. Discard the supernatant. Add 500 µL of 75% ethanol to wash the RNA and then vortex the sample. Centrifuge it for 5 min at 12,000 × g and 4 °C.
   5. Air-dry the RNA pellet for 5 min.
   6. Resuspend the pellet in 30 µL of RNase-free water.
   7. Calculate the RNA concentration using the formula: A260 × dilution × 40 = µg RNA/mL. Calculate the A260/A280 ratio.
      ​NOTE: A ratio of ~2 is considered pure.
3. Perform reverse transcription of good quality RNA to obtain the cDNA template.
   1. Design and use a pair of specific primers, ppm-1-F/R (see the Table of Materials), to amplify the partial coding sequence of the Bx-ppm-1 gene in B. xylophilus (GenBank accession number QTZ96795).
   2. Clone the ppm-1 gene sequences into the pGEM-Teasy vector containing the T7 promoter following a standard cloning protocol¹¹.
      1. Set up the PCR reactions as follows: 2 µL of cDNA, 25 µL of 2x Ex Taq Polymerase Premix, 2 µL of each primer (10 pmol/l), and sterile distilled water to a final volume of 50 µL.
      2. Perform the amplification procedure as follows: 5 min at 94 °C; followed by 35 cycles of 30 s at 94 °C, 30 s at 55 °C, and 1 min at 72 °C; and a final extension step at 72 °C for 5 min.
      3. Clone the amplified products into a pGEM-T Easy vector for sequencing.

2. Synthesis of dsRNA

1. Prepare the DNA template for dsRNA synthesis using PCR with primers designed to add T7 promoter sites at both ends. Add the T7 promoter sequence to the 5' end of the primers.
2. Use the plasmid containing the ppm-1 gene fragment (894 bp) as the template for PCR and recover the fragment containing the T7 promoter¹¹. Use the PCR procedure and system described above.
3. Use an in vitro transcription kit to synthesize dsRNA¹¹.
   1. Thaw the frozen reagents on ice.
   2. Add 2 µL of 10x reaction buffer, 2 µL of enzyme mix, and 1 µg of DNA to a centrifuge tube. Add nuclease-free water to produce a standard 4 µL reaction. Then, mix equal volumes of the four ribonucleotide solutions (ATP, CTP, GTP, and UTP) together and add 8 µL of the mixture to the tube. Mix thoroughly and incubate at 37 °C for 4 h.
   3. Add 1 µL of DNase, mix well, and incubate for 15 min at 37 °C.
   4. Stop the reaction and add 30 µL of nuclease-free water and 30 µL of LiCl precipitation solution to precipitate the RNA. Mix thoroughly. Incubate at -20 °C overnight.
   5. Centrifuge for 15 min at 12,000 × g and 4 °C. Discard the supernatant.
   6. Add 1 mL of 75% ethanol to wash the RNA. Vortex the sample and centrifuge it for 10 min at 12,000 × g and 4 °C.
   7. Air-dry the RNA pellet for 3 min.
   8. Resuspend the pellet in 30 µL of RNase-free water.
   9. Analyze the quality of the dsRNA using a spectrophotometer. Pipette 1 µL of the dsRNA sample onto the measurement pedestal and set the wavelength to 340 nm. Visualize the products on a 1.0% agarose gel.

3. RNAi by soaking

1. Mix 4 µL of 5x soaking buffer (0.05% gelatin, 5.5 mM KH₂PO₄, 2.1 mM NaCl, 4.7 mM NH₄Cl, 3 mM spermidine) with the dsRNA and ddH₂O to produce a total volume of 20 µL and a final RNA concentration of 0.8 µg/μL.
2. Acquire J2 larvae.
   1. Collect the nematodes from the fungal cultures and transfer them to a glass Petri dish 6 cm in diameter. Add 10 mL of water to the dish to ensure that the nematodes can swim freely. Keep the nematodes in the dish for 30 min and wait for the eggs to adhere to the bottom.
   2. Remove the water and nematodes carefully, making sure not to disturb the eggs. Repeat the steps until all the larvae and adults are removed, leaving only the eggs in the dish.
   3. Hatch the collected eggs for 24 h in the dark at 25 °C to obtain J2 larvae. Collect the J2 larvae, place them in a tube, and wash them three times with ddH₂O for the RNAi experiment¹⁵.
   4. Transfer the J2 larvae to the 2 mL tube containing the dsRNA solution and add resorcinol solution (wrapped in tinfoil and dissolved in water) to produce a final concentration of 1.0%. Incubate the larvae with centrifugation at 15 × g on a shaking table for 24 h at 25 °C to ensure that the larvae effectively absorb the dsRNA.
   5. Soak the same quantity of nematodes in the soaking buffer without the dsRNA probe or with a GFP dsRNA probe as a control. Use the GFP gene (gfp, M62653.1) as a nonendogenous control and synthesize the dsRNA of gfp using gene-specific primers T7-GFP-F/R.

4. qPCR detection

1. Clean the J2 larvae with ddH₂O, including those with target gene interference, GFP gene interference, and the undisturbed control group. Extract the total RNAs from each group using the method described above.
2. Start the qPCR.
   1. Design the q-ppm-1-F/R primers using the desired software (see the Table of Materials).
   2. Set up the qPCR reaction in 12 µL containing 1 µL of cDNA, 6 µL of fluorescent premix, 0.4 µL of each primer (10 pmol/l), and sterile distilled water.
   3. Perform qPCR as follows: 2 min at 95 °C; followed by 40 cycles of 10 s at 95 °C, 30 s at 55 °C, and 1 min at 72 °C.
   4. Use the actb gene (GenBank accession number EU100952) and tbb-2 gene (GenBank accession number MT769316), or other genes, as internal reference genes to evaluate the changes in gene expression level after RNAi¹⁵.
3. According to the cycle threshold (Ct) value and the dissolution curve, use the 2^-ΔΔCt method to estimate the relative expression level of the target gene and verify the interference efficiency.
   1. Subtract the Ct value of the internal reference gene of each sample from the Ct value of the target gene to obtain the ΔCt value. Then, subtract the ΔCt value of the interference group from the ΔCt value of the control group to obtain the ΔΔCt value.
      ​NOTE: A ΔΔCt value greater than 0 indicates that the interference is effective.

5. Evaluate the body length of nematode adults following RNAi

1. After RNAi, culture the J2 larvae until adulthood on B. cinerea lawns in PDA plates for 60 h at 25 °C¹⁵.
2. Collect the adults using the Bellman funnel method (see step 1.1.2.1)¹⁴.
3. Acquire images of the adult nematodes under a microscope and use ImageJ software (or other measurement software) to measure the body lengths.
   1. Measure the length using ImageJ by selecting Analyze | Set Scale. If the distance is known, enter the length value of the drawn straight line. Enter the unit of length.
   2. Check the Global check box (use this standard for all pictures), and click OK to select the length to be measured with a straight line on the image to be measured.
   3. Use the command Ctrl+M (measurement) to display the results and record them in the results window.
4. Take measurements of 50 male and 50 female nematodes for statistical analysis¹².
5. Analyze the data by calculating the mean and standard deviation for each sample. Compare the means of the samples from the different groups using the Student's t-test.

Results

Analysis of ppm-1 expression of B. xylophilus after RNAi
The relative expression level of the ppm-1 gene of B. xylophilus soaked with GFP dsRNA and that soaked with target gene dsRNA was 0.92 and 0.52, respectively (the ppm-1 gene expression level of the ddH₂O-treated control group was set to 1) (Figure 1). Thus, exogenous dsRNA has no effect on the...

Discussion

Although the life history and parasitic environment of B. xylophilus are different from those of other nematodes, there has been limited research on the molecular pathogenesis of this plant pathogen. Despite great progress made in the application of CRISPR/Cas9 genome editing technology in C. elegans and other nematodes, only RNAi technology applied to B. xylophilus has been published to date¹⁷. RNAi is one of the most powerful tools available to study the gene function ...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Baermann funnel	n/a	n/a	to isolate nematodes
Beacon Designer 7.9	Shanghai kangyusheng information technology co.	n/a	to design qPCR primers
Botrytis cinerea	n/a	n/a	as food for nematodes
Bursaphelenchus xylophilus	n/a	n/a	its number was NXY61 and was it was originally extracted from diseased Pinus massoniana in Ningbo, Zhejiang province, China.
constant temperature incubator	Shanghai Jing Hong Laboratory Instrument Co.	H1703544	to cultur nematodes
Electrophoresis apparatus	Bio-Rad Laboratories	1704466	to achieve electrophoretic analysis
Ethanol, 75%	Sinopharm Chemical Reagent Co.	80176961	to extract RNA
Ex Taq Polymerase Premix	Takara Bio Inc.	RR030A	for PCR
Ex Taq Polymerase Premix	Takara Bio Inc.	RR390A	for PCR
Gel imager	LongGene Scientific Instruments Co.	LG2020	to make nucleic acid bands visible
GraphPad Prism 8	GraphPad Prism	n/a	to analyze the data and make figurs
High Speed Centrifuge	Hangzhou Allsheng Instruments Co.	AS0813000	centrifug
High-flux tissue grinder	Bertin		to extract RNA
ImageJ software	National Institutes of Health	n/a	to measure the body lengths
isopropyl alcohol	Shanghai Aladdin Biochemical Technology Co.	L1909022	to extract RNA
Leica DM4B microscope	Leica Microsystems Inc.		to observe nematodes
magnetic beads	Aoran science technology co.	150010C	to extract RNA
MEGAscript T7 High Yield Transcription Kit	Thermo Fisher Scientific Inc.	AM1333	to synthesize dsRNA in vitro
NanoDrop ND-2000 spectrophotometer	Thermo Fisher Scientific Inc.	NanoDrop 2000/2000C	to analyze the quality of the dsRNA
PCR Amplifier	Bio-Rad Life Medical Products Co.	1851148	to amplify nucleic acid sequence
Petri dishes	n/a	n/a	to cultur nematodes
pGEM-T Easy vector	Promega Corporation	A1360	for cloning
Potato Dextrose Agar (Medium)	n/a	n/a	to cultur Botrytis cinerea
Prime Script RT reagent Kit with gDNA Eraser	Takara Bio Inc.	RR047B	to synthetic cDNA
Primer Premier 5.0	PREMIER Biosoft	n/a	to design PCR primers
primers:ppm-1-F/R	Tsingke Biotechnology Co.	n/a	F: 5'-GATGCGAAGTTGCCAATCATTCT -3'; R: 5'- CCAGATCCAGTCCACCATACACC -3
q-ppm-1-F/R	Tsingke Biotechnology Co.	n/a	F: 5'-CATCCGAATGGCAATACAG-3'; R: 5'-ACTATCCTCAGCGTTAGC-3'
Real-time thermal cycler qTOWER 2.2	Analytique Jena Instruments (Beijing) Co.		for qPCR
shaking table	Shanghai Zhicheng analytical instrument manufacturing co.		to soak nematodes
stereoscopic microscope	Chongqing Optec Instrument Co.	1814120	to observe nematodes
T7-GFP-F/R	Tsingke Biotechnology Co.	n/a	F: 5'-TAATACGACTCACTATAGGGAAA GGAGAAGAACTTTTCAC-3'; R: 5'-TAATACGACTCACTATAGGGCTG TTACAAACTCAAGAAGG-3'
T7 promoter	Tsingke Biotechnology Co.	n/a	TAATACGACTCACTATAGGG
Takara MiniBEST Agarose Gel DNA Extraction Kit	Takara Bio Inc.	9762	to recover DNA
TaKaRa TB Green Premix Ex Taq (Tli RNaseH Plus)	Takara Bio Inc.	RR820A	for qPCR
trichloroethane	Shanghai LingFeng Chemical Reagent Co.		to extract RNA
TRIzol Reagent	Thermo Fisher Scientific Inc.	15596026	total RNA extraction reagent,to extract RNA